The Block City












Welcome to The Block City

To access different camera angles, click on the hambuger menu. To load a building’s NFT data card, double click the building of your choice.Own a space in The Block City through the ownership of the Building’s NFT. You can find more information on our website or double click the building you wish to find more information about. With the NFT ownership you can update the buildings information card and add your own content.

Please wait while the scene is loading…

©2022 The Block City. All rights reserved.



`;


var customLoadingScreenCss = document.createElement(‘style’);
customLoadingScreenCss.type = ‘text/css’;
customLoadingScreenCss.innerHTML = `
#wrapperLoading1{
font-family: “Bebas Neue, Open Sans Condensed”, “Oswald”, “Rajdhani”, “Anton”, “Abel”, “Oswald”, “Helvetica Neue”, Helvetica, Arial, sans-serif;
width: 100%;
height: 100%;
background-color: #1f1d1e;
background-size: cover;
background-repeat: no-repeat;
background-position-y: center;
background-position-x: center;
color: white;
font-size:24px;
text-align:center;
}

#customLoadingScreenDiv{
font-family: “Open Sans Condensed”, “Oswald”, “Rajdhani”, “Anton”, “Abel”, “Oswald”, “Helvetica Neue”, Helvetica, Arial, sans-serif;
background-color: #37383af5;
color: white;
font-size:24px;
text-align:center;
}
h1 {
font-family: “Bebas Neue, Open Sans Condensed”, “Oswald”, “Rajdhani”, “Anton”, “Abel”, “Oswald”, “Helvetica Neue”, Helvetica, Arial, sans-serif;
font-size:24px;
color: white;
}
#loadingScreen2 h1 {
padding-top: 40px;
text-align: center;
}
#loadingScreen2 h3 {
padding-top: 40px;
text-align: justify;
}
h3 {
font-family: “Open Sans Condensed”, “Oswald”, “Rajdhani”, “Anton”, “Abel”, “Oswald”, “Helvetica Neue”, Helvetica, Arial, sans-serif;
font-size:18px;
color: white;
font-weight: 400;
padding-left: 5%;
padding-right: 5%;

}
@media (min-width: 992px) {
#loadingScreen2 h3 {
padding-left: 25%;
padding-right: 25%;
}
}

@media (max-width: 991px) {
#loadingScreen2 h3 {
padding-left: 10%;
padding-right: 10%;
}
}
#loadingScreen{
//background-color: #BB464Bcc;
height: 5%;
color: White;
font-size:30px;
text-align:center;
padding-top: 10px;
padding-bottom: 10px;
padding-left: 10%;
padding-right: 10%;
margin-bottom: 2%;
}
#loadingScreen2{
//background-color: #BB464Bcc;
height: 23%;
color: White;
font-size:30px;
text-align:center;
padding-top: 40px;
padding-bottom: 10px;
}
#loadingImg{
// background-color: #BB464Bcc;
color: White;
height: 50%;
font-size: 50px;
text-align: center;
opacity: 0.8;
align-content: center;
}
#loadingImg img{
padding-top: 5%;
max-height: 75%;
}
#loadingVendor{
// background-color: #BB464Bcc;
position: absolute;
color: White;
height: 19%;
font-size: 50px;
text-align: center;
opacity: 0.8;
align-content: bottom;
width: 100%;
bottom: 65px;
}
#loadingVendor img{
max-width: 100%;
vertical-align: middle;
}
#labelPercent{
align-content: center;
text-align: center;
min-height: 13%;
bottom: 180px;
}
.vendorscreen {
height: 50% !important;
}
.vendor1{
padding: 5px;
max-height: 115px;
}
.vendor2{
max-width: 33% !important;
max-height: 110px;
}
.vendor3{
max-height: 96px;
}
#loadingPercent{
position: absolute;
width: 95%;
font-family: “Open Sans Condensed”, “Oswald”, “Rajdhani”, “Anton”, “Abel”, “Oswald”, “Helvetica Neue”, Helvetica, Arial, sans-serif;
font-weight: 400;
padding-left: 10px;
padding-right: 10px;
color: #6d6f71f2;
font-size: 14px;
text-align: center;
align-content: center;
bottom: 40px;
}
#loadingPercent2{
position: absolute;
background-color: #BB464Bcc;
color: White;
font-size: 14px;
max-height: 25px;
text-align: left;
padding-left: 10px;
align-content: right;
bottom: 0;
}
#hintPercent{
font-family: “Open Sans Condensed”, “Oswald”, “Rajdhani”, “Anton”, “Abel”, “Oswald”, “Helvetica Neue”, Helvetica, Arial, sans-serif;
font-size:18px;
color: white;
font-weight: 400;
}
#versioning{
display: block;
position: absolute;
background-color: transparent;
color: white;
font-size: 14px;
max-height: 25px;
text-align: right;
padding-right: 10px;
align-content: right;
bottom: 0;
right:0;
}
.color{
color: #bbbbbbf2;
}
.copyright{
font-family: “Open Sans Condensed”, “Oswald”, “Rajdhani”, “Anton”, “Abel”, “Oswald”, “Helvetica Neue”, Helvetica, Arial, sans-serif;
font-weight: 400;
padding-left: 10px;
padding-right: 10px;
color: #6d6f71f2;
font-size: 14px;
text-align: center;
}
}
`;


//append styles and manage screen resize

document.getElementsByTagName(‘head’)[0].appendChild(customLoadingScreenCss);

this._resizeLoadingUI();
window.addEventListener(“resize”, this._resizeLoadingUI);
document.body.appendChild(this._loadingDiv);

};

//hide loading screen on scene/mesh loaded
BABYLON.DefaultLoadingScreen.prototype.hideLoadingUI = function(){
document.getElementById(“customLoadingScreenDiv”).style.display = “none”;
document.getElementById(“wrapperLoading1”).style.display = “none”;


// console.log(“scene is now loaded”);
}

//manage loading screens sequence
var loadingScreenChange = function() {
if (_loadedPercent 85)
{
document.getElementById(“wrapperLoading1”).style.display = “none”;
document.getElementById(“wrapperLoading2”).style.display = “initial”;
document.getElementById(“loadingScreen2”).style.display = “initial”;

_loadingIndex = 1;
}
//console.log(“loading screen change”);
};


//*** END OF :: LOADING SCREEN ***



var delayCreateScene = function () {
engine.displayLoadingUI();
const scene = new BABYLON.Scene(engine);
scene.environmentTexture = BABYLON.CubeTexture.CreateFromPrefilteredData(“https://assets.babylonjs.com/environments/studio.env”, scene);
scene.environmentIntensity = 0.1;

///// * * * CAMERAS * * * /////

//Create Camera
// Parameters: name, alpha, beta, radius, target position, scene
// Creates, angles, distances and targets the camera
var camera = new BABYLON.ArcRotateCamera(“Camera”, 100, 300, 802, new BABYLON.Vector3(-38, 55, 0), scene);

// This attaches the camera to the canvas
camera.attachControl(canvas, true);

//CAMERA OPTIONS

//Camera limits
camera.lowerBetaLimit =1;
camera.upperBetaLimit = (Math.PI / 3.5) * 1.6;
camera.lowerRadiusLimit = 200;
camera.upperRadiusLimit = 350;

//Camera framing
camera.useFramingBehavior = true;
camera.framingBehavior.framingTime = 3000;


///// * * * LIGHTS * * * /////

//Create Lights
// light1
var light = new BABYLON.DirectionalLight(“dir01”, new BABYLON.Vector3(1, 2, 1), scene);
light.position = new BABYLON.Vector3(20, 40, 20);
light.intensity = 0.02;

// light2
var light = new BABYLON.DirectionalLight(“dir02”, new BABYLON.Vector3(-1, -2, -1), scene);
light.position = new BABYLON.Vector3(20, 40, 20);
light.intensity = 0.02;

///// * * * ENVIRONMENT * * * /////

//Create SkyBox
// Skybox
var skybox = BABYLON.Mesh.CreateBox(“skyBox”, 2000, scene);
var skyboxMaterial = new BABYLON.StandardMaterial(“skyBox”, scene);
skyboxMaterial.backFaceCulling = false;
skyboxMaterial.reflectionTexture = new BABYLON.Texture(“https://dl.dropbox.com/s/bo4d8sl5t32i3w4/space10.png”, scene, true);
skyboxMaterial.reflectionTexture.coordinatesMode = BABYLON.Texture.FIXED_EQUIRECTANGULAR_MODE;
skyboxMaterial.disableLighting = false
skybox.material = skyboxMaterial;
skybox.isPickable = false;


///// * * * START OF :: IMPORT MESHES * * * /////



//Import meshes
var base64_model_content = “data:base64,Z2xURgIAAAAEjs8BCCkDAEpTT057ImFzc2V0Ijp7ImdlbmVyYXRvciI6Iktocm9ub3MgZ2xURiBCbGVuZGVyIEkvTyB2My4yLjQwIiwidmVyc2lvbiI6IjIuMCJ9LCJleHRlbnNpb25zVXNlZCI6WyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiJdLCJleHRlbnNpb25zUmVxdWlyZWQiOlsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iXSwic2NlbmUiOjAsInNjZW5lcyI6W3sibmFtZSI6IlNjZW5lIiwibm9kZXMiOlswLDEsMiwzLDQsNSw2LDcsOCw5LDEwLDExLDEyLDEzLDE0LDE1LDE2LDE3LDE4LDE5LDIwLDIxLDIyLDIzLDI0LDI1LDI2LDI3LDI4LDI5LDMwLDMxLDMyLDMzLDM0LDM1LDM2LDM3LDM4LDM5LDQwLDQxLDQyLDQzLDQ0LDQ1LDQ2LDQ3LDQ4LDQ5LDUwLDUxLDUyLDUzLDU0LDU1LDU2LDU3LDU4LDU5LDYwLDYxLDYyLDYzLDY0LDY1LDY2LDY3LDY4LDY5LDcwLDcxLDcyLDczLDc0LDc1LDc2LDc3LDc4LDc5LDgwLDgxLDgyLDgzLDg0LDg1LDg2LDg3LDg4LDg5LDkwLDkxLDkyLDkzLDk0LDk1LDk2LDk3LDk4LDk5LDEwMCwxMDEsMTAyLDEwMywxMDQsMTA1LDEwNiwxMDcsMTA4LDEwOSwxMTAsMTExLDExMiwxMTMsMTE0LDExNSwxMTYsMTE3LDExOCwxMTksMTIwLDEyMSwxMjIsMTIzLDEyNCwxMjUsMTI2LDEyNywxMjgsMTI5LDEzMCwxMzEsMTMyLDEzMywxMzQsMTM1LDEzNiwxMzcsMTM4LDEzOSwxNDAsMTQxLDE0MiwxNDMsMTQ0LDE0NSwxNDYsMTQ3LDE0OCwxNDksMTUwLDE1MSwxNTIsMTUzLDE1NCwxNTUsMTU2LDE1NywxNTgsMTU5LDE2MCwxNjEsMTYyLDE2MywxNjQsMTY1LDE2NiwxNjcsMTY4LDE2OSwxNzAsMTcxLDE3MiwxNzMsMTc0LDE3NSwxNzYsMTc3LDE3OCwxNzksMTgwLDE4MSwxODIsMTgzLDE4NCwxODUsMTg2LDE4NywxODgsMTg5LDE5MCwxOTEsMTkyLDE5MywxOTQsMTk1LDE5NiwxOTcsMTk4LDE5OSwyMDAsMjAxLDIwMiwyMDMsMjA0LDIwNSwyMDYsMjA3LDIwOCwyMDksMjEwLDIxMSwyMTIsMjEzLDIxNCwyMTUsMjE2LDIxNywyMTgsMjE5LDIyMCwyMjEsMjIyLDIyMywyMjQsMjI1LDIyNiwyMjcsMjI4LDIyOSwyMzAsMjMxLDIzMiwyMzMsMjM0LDIzNSwyMzYsMjM3LDIzOCwyMzksMjQwLDI0MSwyNDIsMjQzLDI0NCwyNDUsMjQ2LDI0NywyNDgsMjQ5LDI1MCwyNTEsMjUyLDI1MywyNTQsMjU1LDI1NiwyNTcsMjU4LDI1OSwyNjAsMjYxLDI2MiwyNjMsMjY0LDI2NSwyNjYsMjY3LDI2OCwyNjksMjcwLDI3MSwyNzIsMjczLDI3NCwyNzUsMjc2LDI3NywyNzgsMjc5LDI4MCwyODEsMjgyLDI4MywyODQsMjg1LDI4NiwyODcsMjg4LDI4OSwyOTAsMjkxLDI5MiwyOTMsMjk0LDI5NSwyOTYsMjk3LDI5OCwyOTksMzAwLDMwMSwzMDIsMzAzLDMwNCwzMDUsMzA2LDMwNywzMDgsMzA5LDMxMCwzMTEsMzEyLDMxMywzMTQsMzE1LDMxNiwzMTcsMzE4LDMxOSwzMjAsMzIxLDMyMiwzMjMsMzI0LDMyNSwzMjYsMzI3LDMyOCwzMjksMzMwLDMzMSwzMzIsMzMzLDMzNCwzMzUsMzM2LDMzNywzMzgsMzM5LDM0MCwzNDEsMzQyLDM0MywzNDQsMzQ1LDM0NiwzNDcsMzQ4LDM0OSwzNTAsMzUxLDM1MiwzNTMsMzU0LDM1NSwzNTYsMzU3LDM1OCwzNTksMzYwLDM2MSwzNjIsMzYzLDM2NCwzNjUsMzY2LDM2NywzNjgsMzY5LDM3MCwzNzEsMzcyLDM3MywzNzQsMzc1LDM3NiwzNzcsMzc4LDM3OSwzODAsMzgxLDM4MiwzODMsMzg0LDM4NSwzODYsMzg3LDM4OCwzODksMzkwLDM5MSwzOTIsMzkzLDM5NCwzOTUsMzk2LDM5NywzOTgsMzk5LDQwMCw0MDEsNDAyLDQwMyw0MDQsNDA1LDQwNiw0MDcsNDA4LDQwOSw0MTAsNDExLDQxMiw0MTMsNDE0LDQxNSw0MTYsNDE3LDQxOCw0MTksNDIwLDQyMSw0MjIsNDIzLDQyNCw0MjUsNDI2LDQyNyw0MjgsNDI5LDQzMCw0MzEsNDMyLDQzMyw0MzQsNDM1LDQzNiw0MzcsNDM4LDQzOSw0NDAsNDQxLDQ0Miw0NDMsNDQ0LDQ0NSw0NDYsNDQ3LDQ0OCw0NDksNDUwLDQ1MSw0NTIsNDUzLDQ1NCw0NTUsNDU2LDQ1Nyw0NTgsNDU5LDQ2MCw0NjEsNDYyLDQ2Myw0NjQsNDY1LDQ2Niw0NjcsNDY4LDQ2OSw0NzAsNDcxLDQ3Miw0NzMsNDc0LDQ3NSw0NzYsNDc3LDQ3OCw0NzksNDgwLDQ4MSw0ODIsNDgzLDQ4NCw0ODUsNDg2LDQ4Nyw0ODgsNDg5LDQ5MCw0OTEsNDkyLDQ5Myw0OTQsNDk1LDQ5Niw0OTcsNDk4LDQ5OSw1MDAsNTAxLDUwMiw1MDMsNTA0LDUwNSw1MDYsNTA3LDUwOCw1MDksNTEwLDUxMSw1MTIsNTEzLDUxNCw1MTUsNTE2LDUxNyw1MTgsNTE5LDUyMCw1MjEsNTIyLDUyMyw1MjQsNTI1LDUyNiw1MjcsNTI4LDUyOSw1MzAsNTMxLDUzMiw1MzMsNTM0LDUzNSw1MzYsNTM3LDUzOCw1MzksNTQwLDU0MSw1NDIsNTQzLDU0NCw1NDUsNTQ2LDU0Nyw1NDgsNTQ5LDU1MCw1NTEsNTUyLDU1Myw1NTQsNTU1LDU1Niw1NTcsNTU4LDU1OSw1NjAsNTYxLDU2Miw1NjMsNTY0LDU2NSw1NjYsNTY3LDU2OCw1NjksNTcwLDU3MSw1NzIsNTczLDU3NCw1NzUsNTc2LDU3Nyw1NzgsNTc5LDU4MCw1ODEsNTgyLDU4Myw1ODQsNTg1LDU4Niw1ODcsNTg4LDU4OSw1OTAsNTkxLDU5Miw1OTMsNTk0LDU5NSw1OTYsNTk3LDU5OCw1OTksNjAwLDYwMSw2MDIsNjAzLDYwNCw2MDUsNjA2LDYwNyw2MDgsNjA5LDYxMCw2MTEsNjEyLDYxMyw2MTQsNjE1LDYxNiw2MTcsNjE4LDYxOSw2MjAsNjIxLDYyMiw2MjMsNjI0LDYyNSw2MjYsNjI3LDYyOCw2MjksNjMwLDYzMSw2MzIsNjMzLDYzNCw2MzUsNjM2LDYzNyw2MzgsNjM5LDY0MCw2NDEsNjQyLDY0Myw2NDQsNjQ1LDY0Niw2NDcsNjQ4LDY0OSw2NTAsNjUxLDY1Miw2NTMsNjU0XX1dLCJub2RlcyI6W3sibWVzaCI6MCwibmFtZSI6IkNpcmNsZS4wMDUiLCJzY2FsZSI6WzE3Ni4yMDcyMTQzNTU0Njg3NSwxNzYuMjA3MjE0MzU1NDY4NzUsMTc2LjIwNzIxNDM1NTQ2ODc1XSwidHJhbnNsYXRpb24iOlswLDMuNzQ0MzA5NDI1MzU0MDA0LDBdfSx7Im1lc2giOjEsIm5hbWUiOiJDaXJjbGUuMDAzIiwic2NhbGUiOlsyODguNjI0MTE0OTkwMjM0NCwyODguNjI0MTE0OTkwMjM0NCwyODguNjI0MTE0OTkwMjM0NF0sInRyYW5zbGF0aW9uIjpbMCwzLjYzOTczOTUxMzM5NzIxNywwXX0seyJtZXNoIjoyLCJuYW1lIjoiQ2lyY2xlLjAyOCIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJzY2FsZSI6WzE3Ni4yMDcyMTQzNTU0Njg3NSwxNzYuMjA3MjE0MzU1NDY4NzUsMTc2LjIwNzIxNDM1NTQ2ODc1XSwidHJhbnNsYXRpb24iOlswLDMuNjM5NzM5NTEzMzk3MjE3LDBdfSx7Im1lc2giOjMsIm5hbWUiOiJDaXJjbGUuMDA3Iiwic2NhbGUiOlsxNzYuMjA3MjE0MzU1NDY4NzUsMTc2LjIwNzIxNDM1NTQ2ODc1LDE3Ni4yMDcyMTQzNTU0Njg3NV0sInRyYW5zbGF0aW9uIjpbMCwzLjI4NzQyNzkwMjIyMTY3OTcsMF19LHsibWVzaCI6NCwibmFtZSI6IkN1YmUuMDAxIiwic2NhbGUiOlsxNzYuMjA3MjE0MzU1NDY4NzUsMTc2LjIwNzIxNDM1NTQ2ODc1LDE3Ni4yMDcyMTQzNTU0Njg3NV0sInRyYW5zbGF0aW9uIjpbMTE5LjczMjA0ODAzNDY2Nzk3LDIuMzAxNDE5OTczMzczNDEzLC0yMi42NTc5MTUxMTUzNTY0NDVdfSx7Im1lc2giOjUsIm5hbWUiOiJQUk9QUy4wODQiLCJyb3RhdGlvbiI6WzAsMC42NDYzNjYyMzg1OTQwNTUyLDAsMC43NjMwMjczMTAzNzEzOTg5XSwidHJhbnNsYXRpb24iOlszMzUuOTAxNjExMzI4MTI1LDMuOTE2NjQ3NDM0MjM0NjE5LDcyLjc3NDk2MzM3ODkwNjI1XX0seyJtZXNoIjo2LCJuYW1lIjoiUk9BREJMT0NLLjA0MCIsInJvdGF0aW9uIjpbMCwwLjU0Nzg1MjQ1NjU2OTY3MTYsMCwwLjgzNjU3NDk3MTY3NTg3MjhdLCJ0cmFuc2xhdGlvbiI6WzEyOS4zNzUxNjc4NDY2Nzk3LDMuODY0NjA0NDczMTE0MDEzNywtMjM3LjMwNzgzMDgxMDU0Njg4XX0seyJtZXNoIjo3LCJuYW1lIjoiMTAwMzYgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbODEuMjYxMDYyNjIyMDcwMzEsNS44NDAwNDIxMTQyNTc4MTI1LC00OTguOTgxMjMxNjg5NDUzMV19LHsibWVzaCI6OCwibmFtZSI6IjEwMDM1IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wzc0Ljg3MjU1ODU5Mzc1LDguMDMzNjIwODM0MzUwNTg2LC01MDAuNTI3NjE4NDA4MjAzMV19LHsibWVzaCI6OSwibmFtZSI6IjEwMDM0IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzY2LjQyMDI1NzU2ODM1OTM4LDUuNzMxMzkzMzM3MjQ5NzU2LC00OTkuNzQ5MzU5MTMwODU5NF19LHsibWVzaCI6MTAsIm5hbWUiOiIxMDAzMyBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOls1Ni4zNDY3NDgzNTIwNTA3OCw1LjIxMjQ4Mzg4MjkwNDA1MywtNTAxLjY5Nzk2NzUyOTI5NjldfSx7Im1lc2giOjExLCJuYW1lIjoiMTAwMzIgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbNDQuMzU0ODgxMjg2NjIxMDk0LDYuNTY3NjU1MDg2NTE3MzM0LC00OTkuMzA3MjIwNDU4OTg0NF19LHsibWVzaCI6MTIsIm5hbWUiOiIxMDAzMSBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlszNS45NDUzNDMwMTc1NzgxMjUsNS42Mjg0MTA4MTYxOTI2MjcsLTQ5OS4yNjQyNTE3MDg5ODQ0XX0seyJtZXNoIjoxMywibmFtZSI6IjEwMDMwIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzI0LjYwNzU2NDkyNjE0NzQ2LDYuOTk4NTExNzkxMjI5MjQ4LC00OTcuMDQ0MzQyMDQxMDE1Nl19LHsibWVzaCI6MTQsIm5hbWUiOiIxMDAyOSBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlsxMi42ODM3NzQ5NDgxMjAxMTcsOC40MzY5OTI2NDUyNjM2NzIsLTQ5OC42NTY3MDc3NjM2NzE5XX0seyJtZXNoIjoxNSwibmFtZSI6IjEwMDM4IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wzk2LjU4NTI3Mzc0MjY3NTc4LDQuMDM0NDk1ODMwNTM1ODg5LC01MDAuNjEyODg0NTIxNDg0NF19LHsibWVzaCI6MTYsIm5hbWUiOiIxMDAzNyBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOls4OC41NDEyNDQ1MDY4MzU5NCw2Ljg5Njc5MDk4MTI5MjcyNSwtNTAwLjY3OTQ3Mzg3Njk1MzFdfSx7Im1lc2giOjcsIm5hbWUiOiIxMDA1NiBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlsyNjguOTgyNTEzNDI3NzM0NCw1Ljg0MDA0MjExNDI1NzgxMjUsLTQ5OC45ODEyMzE2ODk0NTMxXX0seyJtZXNoIjo4LCJuYW1lIjoiMTAwNTggU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMjg0LjYzODM5NzIxNjc5NjksOC4wMzM2MjA4MzQzNTA1ODYsLTUwMC41Mjc2MTg0MDgyMDMxXX0seyJtZXNoIjo5LCJuYW1lIjoiMTAwNTQgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMjU0LjE0MTcyMzYzMjgxMjUsNS43MzEzOTMzMzcyNDk3NTYsLTQ5OS43NDkzNTkxMzA4NTk0XX0seyJtZXNoIjoxMCwibmFtZSI6IjEwMDUzIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzI0NC4wNjgyMDY3ODcxMDkzOCw1LjIxMjQ4Mzg4MjkwNDA1MywtNTAxLjY5Nzk2NzUyOTI5NjldfSx7Im1lc2giOjExLCJuYW1lIjoiMTAwNTIgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMjMyLjA3NjM1NDk4MDQ2ODc1LDYuNTY3NjU1MDg2NTE3MzM0LC00OTkuMzA3MjIwNDU4OTg0NF19LHsibWVzaCI6MTIsIm5hbWUiOiIxMDA1MSBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlsyMjMuNjY2ODA5MDgyMDMxMjUsNS42Mjg0MTA4MTYxOTI2MjcsLTQ5OS4yNjQyNTE3MDg5ODQ0XX0seyJtZXNoIjoxMywibmFtZSI6IjEwMDUwIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzIxMi4zMjkwMjUyNjg1NTQ3LDYuOTk4NTExNzkxMjI5MjQ4LC00OTcuMDQ0MzQyMDQxMDE1Nl19LHsibWVzaCI6MTQsIm5hbWUiOiIxMDA0MiBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlsxMzcuMTkyNDU5MTA2NDQ1Myw4LjQzNjk5MjY0NTI2MzY3MiwtNDk4LjY1NjcwNzc2MzY3MTldfSx7Im1lc2giOjE1LCJuYW1lIjoiMTAwNTUgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMjYyLjU0NTg2NzkxOTkyMTksNC4wMzQ0OTU4MzA1MzU4ODksLTUwMC42MTI4ODQ1MjE0ODQ0XX0seyJtZXNoIjoxNiwibmFtZSI6IjEwMDU3IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzI3Ni4yNjI3MjU4MzAwNzgxLDYuODk2NzkwOTgxMjkyNzI1LC01MDAuNjc5NDczODc2OTUzMV19LHsibWVzaCI6NywibmFtZSI6IjEwMDYyIEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlsyOTIuNTY4MDg0NzE2Nzk2OSw1Ljg0MDA0MjExNDI1NzgxMjUsLTQ3Ny40NzAyNDUzNjEzMjgxXX0seyJtZXNoIjo4LCJuYW1lIjoiMTAwNjQgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6WzI5OC45NTY2MDQwMDM5MDYyNSw4LjAzMzYyMDgzNDM1MDU4NiwtNDc1LjkyMzg1ODY0MjU3ODFdfSx7Im1lc2giOjksIm5hbWUiOiIxMDA2NiBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMzA3LjQwODkwNTAyOTI5NjksNS43MzEzOTMzMzcyNDk3NTYsLTQ3Ni43MDIxMTc5MTk5MjE5XX0seyJtZXNoIjoxMCwibmFtZSI6IjEwMDY4IEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlszMTcuNDgyMzkxMzU3NDIxOSw1LjIxMjQ4Mzg4MjkwNDA1MywtNDc0Ljc1MzUwOTUyMTQ4NDRdfSx7Im1lc2giOjExLCJuYW1lIjoiMTAwNzAgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6WzMyOS40NzQyNzM2ODE2NDA2LDYuNTY3NjU1MDg2NTE3MzM0LC00NzcuMTQ0MjU2NTkxNzk2OV19LHsibWVzaCI6MTIsIm5hbWUiOiIxMDA3MiBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMzM3Ljg4MzgxOTU4MDA3ODEsNS42Mjg0MTA4MTYxOTI2MjcsLTQ3Ny4xODcyMjUzNDE3OTY5XX0seyJtZXNoIjoxNSwibmFtZSI6IjEwMDU4IEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlsyNzcuMjQzODk2NDg0Mzc1LDQuMDM0NDk1ODMwNTM1ODg5LC00NzUuODM4NTkyNTI5Mjk2OV19LHsibWVzaCI6MTYsIm5hbWUiOiIxMDA2MCBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMjg1LjI4NzkzMzM0OTYwOTQsNi44OTY3OTA5ODEyOTI3MjUsLTQ3NS43NzIwMDMxNzM4MjgxXX0seyJtZXNoIjo3LCJuYW1lIjoiMTAwMjIgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6WzEwNC44NDY2NDkxNjk5MjE4OCw1Ljg0MDA0MjExNDI1NzgxMjUsLTQ3Ny40NzAyNDUzNjEzMjgxXX0seyJtZXNoIjo4LCJuYW1lIjoiMTAwMjQgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6WzExMS4yMzUxMzAzMTAwNTg2LDguMDMzNjIwODM0MzUwNTg2LC00NzUuOTIzODU4NjQyNTc4MV19LHsibWVzaCI6OSwibmFtZSI6IjEwMDI2IEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlsxMTkuNjg3NDMxMzM1NDQ5MjIsNS43MzEzOTMzMzcyNDk3NTYsLTQ3Ni43MDIxMTc5MTk5MjE5XX0seyJtZXNoIjoxMCwibmFtZSI6IjEwMDI4IEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlsxMjkuNzYwOTQwNTUxNzU3OCw1LjIxMjQ4Mzg4MjkwNDA1MywtNDc0Ljc1MzUwOTUyMTQ4NDRdfSx7Im1lc2giOjExLCJuYW1lIjoiMTAwMzAgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6WzE0MS43NTI3OTIzNTgzOTg0NCw2LjU2NzY1NTA4NjUxNzMzNCwtNDc3LjE0NDI1NjU5MTc5NjldfSx7Im1lc2giOjEyLCJuYW1lIjoiMTAwMzIgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6WzE1MC4xNjIzMzgyNTY4MzU5NCw1LjYyODQxMDgxNjE5MjYyNywtNDc3LjE4NzIyNTM0MTc5NjldfSx7Im1lc2giOjEzLCJuYW1lIjoiMTAwMzQgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6WzE2MS41MDAxMjIwNzAzMTI1LDYuOTk4NTExNzkxMjI5MjQ4LC00NzkuNDA3MTM1MDA5NzY1Nl19LHsibWVzaCI6MTQsIm5hbWUiOiIxMDA0NCBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMjA1LjY0MDEwNjIwMTE3MTg4LDguNDM2OTkyNjQ1MjYzNjcyLC00NzcuNzk0NzY5Mjg3MTA5NF19LHsibWVzaCI6MTUsIm5hbWUiOiIxMDAxOCBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbODkuNTIyNDIyNzkwNTI3MzQsNC4wMzQ0OTU4MzA1MzU4ODksLTQ3NS44Mzg1OTI1MjkyOTY5XX0seyJtZXNoIjoxNiwibmFtZSI6IjEwMDIwIEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOls5Ny41NjY0MjkxMzgxODM2LDYuODk2NzkwOTgxMjkyNzI1LC00NzUuNzcyMDAzMTczODI4MV19LHsibWVzaCI6NywibmFtZSI6IjEwMDYyIE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzI5My4yMjAxODQzMjYxNzE5LDUuODQwMDQyMTE0MjU3ODEyNSwtNDM1LjkwMjc3MDk5NjA5Mzc1XX0seyJtZXNoIjo4LCJuYW1lIjoiMTAwNjQgTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbMjk5LjYwODcwMzYxMzI4MTI1LDguMDMzNjIwODM0MzUwNTg2LC00MzQuMzU2Mzg0Mjc3MzQzNzVdfSx7Im1lc2giOjE1LCJuYW1lIjoiMTAwNTggTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbMjc3Ljg5NTk5NjA5Mzc1LDQuMDM0NDk1ODMwNTM1ODg5LC00MzQuMjcxMTE4MTY0MDYyNV19LHsibWVzaCI6MTYsIm5hbWUiOiIxMDA2MCBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOlsyODUuOTQwMDMyOTU4OTg0NCw2Ljg5Njc5MDk4MTI5MjcyNSwtNDM0LjIwNDUyODgwODU5Mzc1XX0seyJtZXNoIjo3LCJuYW1lIjoiMTAwMjIgTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbMTA1LjQ5ODc0ODc3OTI5Njg4LDUuODQwMDQyMTE0MjU3ODEyNSwtNDM1LjkwMjc3MDk5NjA5Mzc1XX0seyJtZXNoIjo4LCJuYW1lIjoiMTAwMjQgTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbMTExLjg4NzIyOTkxOTQzMzYsOC4wMzM2MjA4MzQzNTA1ODYsLTQzNC4zNTYzODQyNzczNDM3NV19LHsibWVzaCI6OSwibmFtZSI6IjEwMDI2IE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzEyMC4zMzk1MzA5NDQ4MjQyMiw1LjczMTM5MzMzNzI0OTc1NiwtNDM1LjEzNDY0MzU1NDY4NzVdfSx7Im1lc2giOjEwLCJuYW1lIjoiMTAwMjggTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbMTMwLjQxMzA1NTQxOTkyMTg4LDUuMjEyNDgzODgyOTA0MDUzLC00MzMuMTg2MDM1MTU2MjVdfSx7Im1lc2giOjExLCJuYW1lIjoiMTAwMzAgTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbMTQyLjQwNDkwNzIyNjU2MjUsNi41Njc2NTUwODY1MTczMzQsLTQzNS41NzY3ODIyMjY1NjI1XX0seyJtZXNoIjoxMiwibmFtZSI6IjEwMDMyIE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzE1MC44MTQ0NTMxMjUsNS42Mjg0MTA4MTYxOTI2MjcsLTQzNS42MTk3NTA5NzY1NjI1XX0seyJtZXNoIjoxMywibmFtZSI6IjEwMDM0IE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzE2Mi4xNTIyMzY5Mzg0NzY1Niw2Ljk5ODUxMTc5MTIyOTI0OCwtNDM3LjgzOTY2MDY0NDUzMTI1XX0seyJtZXNoIjoxNCwibmFtZSI6IjEwMDM2IE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzE3NC4wNzYwMTkyODcxMDkzOCw4LjQzNjk5MjY0NTI2MzY3MiwtNDM2LjIyNzI5NDkyMTg3NV19LHsibWVzaCI6MTUsIm5hbWUiOiIxMDAxOCBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOls5MC4xNzQ1MjIzOTk5MDIzNCw0LjAzNDQ5NTgzMDUzNTg4OSwtNDM0LjI3MTExODE2NDA2MjVdfSx7Im1lc2giOjE2LCJuYW1lIjoiMTAwMjAgTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbOTguMjE4NTI4NzQ3NTU4Niw2Ljg5Njc5MDk4MTI5MjcyNSwtNDM0LjIwNDUyODgwODU5Mzc1XX0seyJtZXNoIjo3LCJuYW1lIjoiMTAwMTEgQXJjaGFpZGUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzU3LjAwMzAxMzYxMDgzOTg0NCw1Ljg0MDA0MjExNDI1NzgxMjUsLTQ1NS42MjQ5MDg0NDcyNjU2XX0seyJtZXNoIjo4LCJuYW1lIjoiMTAwMDkgQXJjaGFpZGUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzUwLjYxNDQ4NjY5NDMzNTk0LDguMDMzNjIwODM0MzUwNTg2LC00NTcuMTcxMjk1MTY2MDE1Nl19LHsibWVzaCI6OSwibmFtZSI6IjEwMDA3IEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOls0Mi4xNjIxODU2Njg5NDUzMSw1LjczMTM5MzMzNzI0OTc1NiwtNDU2LjM5MzAzNTg4ODY3MTldfSx7Im1lc2giOjEwLCJuYW1lIjoiMTAwMDUgQXJjaGFpZGUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzMyLjA4ODY5OTM0MDgyMDMxLDUuMjEyNDgzODgyOTA0MDUzLC00NTguMzQxNjQ0Mjg3MTA5NF19LHsibWVzaCI6MTEsIm5hbWUiOiIxMDAwMyBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMjAuMDk2ODEzMjAxOTA0Mjk3LDYuNTY3NjU1MDg2NTE3MzM0LC00NTUuOTUwODk3MjE2Nzk2OV19LHsibWVzaCI6MTIsIm5hbWUiOiIxMDAwMSBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTEuNjg3MjY4MjU3MTQxMTEzLDUuNjI4NDEwODE2MTkyNjI3LC00NTUuOTA3OTI4NDY2Nzk2OV19LHsibWVzaCI6MTUsIm5hbWUiOiIxMDAxNSBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbNzIuMzI3MTg2NTg0NDcyNjYsNC4wMzQ0OTU4MzA1MzU4ODksLTQ1Ny4yNTY1NjEyNzkyOTY5XX0seyJtZXNoIjoxNiwibmFtZSI6IjEwMDEzIEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOls2NC4yODMxNDk3MTkyMzgyOCw2Ljg5Njc5MDk4MTI5MjcyNSwtNDU3LjMyMzE1MDYzNDc2NTZdfSx7Im1lc2giOjcsIm5hbWUiOiIxMDA1MSBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMjQ0LjcyNDQ0MTUyODMyMDMsNS44NDAwNDIxMTQyNTc4MTI1LC00NTUuNjI0OTA4NDQ3MjY1Nl19LHsibWVzaCI6OCwibmFtZSI6IjEwMDU1IEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsyNjAuNDAyMTMwMTI2OTUzMSw4LjAzMzYyMDgzNDM1MDU4NiwtNDU3LjE3MTI5NTE2NjAxNTZdfSx7Im1lc2giOjksIm5hbWUiOiIxMDA0MyBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMjA5LjU2NTU1MTc1NzgxMjUsNS43MzEzOTMzMzcyNDk3NTYsLTQ1Ni4zOTMwMzU4ODg2NzE5XX0seyJtZXNoIjoxMCwibmFtZSI6IjEwMDQ1IEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsyMTguMzM2MjczMTkzMzU5MzgsNS4yMTI0ODM4ODI5MDQwNTMsLTQ1OC4zNDE2NDQyODcxMDk0XX0seyJtZXNoIjoxMSwibmFtZSI6IjEwMDM5IEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxODYuNDM2ODg5NjQ4NDM3NSw2LjU2NzY1NTA4NjUxNzMzNCwtNDU1Ljk1MDg5NzIxNjc5NjldfSx7Im1lc2giOjEyLCJuYW1lIjoiMTAwNDEgQXJjaGFpZGUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzE5OS40MDg3NTI0NDE0MDYyNSw1LjYyODQxMDgxNjE5MjYyNywtNDU1LjkwNzkyODQ2Njc5NjldfSx7Im1lc2giOjEzLCJuYW1lIjoiMTAwNDcgQXJjaGFpZGUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzIyOS4wMzgxNjIyMzE0NDUzLDYuOTk4NTExNzkxMjI5MjQ4LC00NTMuNjg4MDE4Nzk4ODI4MV19LHsibWVzaCI6MTQsIm5hbWUiOiIxMDAzNyBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTc2LjE0NzE4NjI3OTI5Njg4LDguNDM2OTkyNjQ1MjYzNjcyLC00NTUuMzAwMzg0NTIxNDg0NF19LHsibWVzaCI6MTUsIm5hbWUiOiIxMDA0OSBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMjM4LjA1OTUzOTc5NDkyMTg4LDQuMDM0NDk1ODMwNTM1ODg5LC00NTcuMjU2NTYxMjc5Mjk2OV19LHsibWVzaCI6MTYsIm5hbWUiOiIxMDA1NyBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMjY5Ljk3MDQ1ODk4NDM3NSw2Ljg5Njc5MDk4MTI5MjcyNSwtNDU3LjMyMzE1MDYzNDc2NTZdfSx7Im1lc2giOjcsIm5hbWUiOiJTdGFjayAxMDAyMiIsInRyYW5zbGF0aW9uIjpbMTA1LjQ5ODc0ODc3OTI5Njg4LDUuODQwMDQyMTE0MjU3ODEyNSwtMzkyLjQ1OTQ3MjY1NjI1XX0seyJtZXNoIjo4LCJuYW1lIjoiU3RhY2sgMTAwMjQiLCJ0cmFuc2xhdGlvbiI6WzExMS44ODcyMjk5MTk0MzM2LDguMDMzNjIwODM0MzUwNTg2LC0zOTAuOTEzMDg1OTM3NV19LHsibWVzaCI6OSwibmFtZSI6IlN0YWNrIDEwMDI2IiwidHJhbnNsYXRpb24iOlsxMjAuMzM5NTMwOTQ0ODI0MjIsNS43MzEzOTMzMzcyNDk3NTYsLTM5MS42OTEzNDUyMTQ4NDM3NV19LHsibWVzaCI6MTAsIm5hbWUiOiJTdGFjayAxMDAyOCIsInRyYW5zbGF0aW9uIjpbMTMwLjQxMzA1NTQxOTkyMTg4LDUuMjEyNDgzODgyOTA0MDUzLC0zODkuNzQyNzM2ODE2NDA2MjVdfSx7Im1lc2giOjExLCJuYW1lIjoiU3RhY2sgMTAwMzAiLCJ0cmFuc2xhdGlvbiI6WzE0Mi40MDQ5MDcyMjY1NjI1LDYuNTY3NjU1MDg2NTE3MzM0LC0zOTIuMTMzNDgzODg2NzE4NzVdfSx7Im1lc2giOjEyLCJuYW1lIjoiU3RhY2sgMTAwMzIiLCJ0cmFuc2xhdGlvbiI6WzE1MC44MTQ0NTMxMjUsNS42Mjg0MTA4MTYxOTI2MjcsLTM5Mi4xNzY0NTI2MzY3MTg3NV19LHsibWVzaCI6MTMsIm5hbWUiOiJTdGFjayAxMDAzNCIsInRyYW5zbGF0aW9uIjpbMTYyLjE1MjIzNjkzODQ3NjU2LDYuOTk4NTExNzkxMjI5MjQ4LC0zOTQuMzk2MzYyMzA0Njg3NV19LHsibWVzaCI6MTQsIm5hbWUiOiJTdGFjayAxMDAzNiIsInRyYW5zbGF0aW9uIjpbMTc0LjA3NjAxOTI4NzEwOTM4LDguNDM2OTkyNjQ1MjYzNjcyLC0zOTIuNzgzOTk2NTgyMDMxMjVdfSx7Im1lc2giOjE1LCJuYW1lIjoiU3RhY2sgMTAwMTgiLCJ0cmFuc2xhdGlvbiI6WzkwLjE3NDUyMjM5OTkwMjM0LDQuMDM0NDk1ODMwNTM1ODg5LC0zOTAuODI3ODE5ODI0MjE4NzVdfSx7Im1lc2giOjE2LCJuYW1lIjoiU3RhY2sgMTAwMjAiLCJ0cmFuc2xhdGlvbiI6Wzk4LjIxODUyODc0NzU1ODYsNi44OTY3OTA5ODEyOTI3MjUsLTM5MC43NjEyMzA0Njg3NV19LHsibWVzaCI6NywibmFtZSI6IjEwMDExIE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzU3LjAwMzAxMzYxMDgzOTg0NCw1Ljg0MDA0MjExNDI1NzgxMjUsLTQxMi4xODE2MTAxMDc0MjE5XX0seyJtZXNoIjo4LCJuYW1lIjoiMTAwMDkgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbNTAuNjE0NDg2Njk0MzM1OTQsOC4wMzM2MjA4MzQzNTA1ODYsLTQxMy43Mjc5OTY4MjYxNzE5XX0seyJtZXNoIjo5LCJuYW1lIjoiMTAwMDcgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbNDIuMTYyMTg1NjY4OTQ1MzEsNS43MzEzOTMzMzcyNDk3NTYsLTQxMi45NDk3Mzc1NDg4MjgxXX0seyJtZXNoIjoxMCwibmFtZSI6IjEwMDA1IE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzMyLjA4ODY5OTM0MDgyMDMxLDUuMjEyNDgzODgyOTA0MDUzLC00MTQuODk4MzQ1OTQ3MjY1Nl19LHsibWVzaCI6MTEsIm5hbWUiOiIxMDAwMyBNaWRkbGV0b3duIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsyMC4wOTY4MTMyMDE5MDQyOTcsNi41Njc2NTUwODY1MTczMzQsLTQxMi41MDc1OTg4NzY5NTMxXX0seyJtZXNoIjoxMiwibmFtZSI6IjEwMDAxIE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzExLjY4NzI2ODI1NzE0MTExMyw1LjYyODQxMDgxNjE5MjYyNywtNDEyLjQ2NDYzMDEyNjk1MzFdfSx7Im1lc2giOjE1LCJuYW1lIjoiMTAwMTUgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbNzIuMzI3MTg2NTg0NDcyNjYsNC4wMzQ0OTU4MzA1MzU4ODksLTQxMy44MTMyNjI5Mzk0NTMxXX0seyJtZXNoIjoxNiwibmFtZSI6IjEwMDEzIE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzY0LjI4MzE0OTcxOTIzODI4LDYuODk2NzkwOTgxMjkyNzI1LC00MTMuODc5ODUyMjk0OTIxOV19LHsibWVzaCI6NywibmFtZSI6IjEwMDUxIE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzI0NC43MjQ0NDE1MjgzMjAzLDUuODQwMDQyMTE0MjU3ODEyNSwtNDEyLjE4MTYxMDEwNzQyMTldfSx7Im1lc2giOjgsIm5hbWUiOiIxMDA0OSBNaWRkbGV0b3duIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsyMzguMzM1OTUyNzU4Nzg5MDYsOC4wMzM2MjA4MzQzNTA1ODYsLTQxMy43Mjc5OTY4MjYxNzE5XX0seyJtZXNoIjo5LCJuYW1lIjoiMTAwNDcgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMjI5Ljg4MzY1MTczMzM5ODQ0LDUuNzMxMzkzMzM3MjQ5NzU2LC00MTIuOTQ5NzM3NTQ4ODI4MV19LHsibWVzaCI6MTAsIm5hbWUiOiIxMDA0NSBNaWRkbGV0b3duIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsyMTkuODEwMTUwMTQ2NDg0MzgsNS4yMTI0ODM4ODI5MDQwNTMsLTQxNC44OTgzNDU5NDcyNjU2XX0seyJtZXNoIjoxMSwibmFtZSI6IjEwMDQzIE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzIwNy44MTgyOTgzMzk4NDM3NSw2LjU2NzY1NTA4NjUxNzMzNCwtNDEyLjUwNzU5ODg3Njk1MzFdfSx7Im1lc2giOjEyLCJuYW1lIjoiMTAwNDEgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTk5LjQwODc1MjQ0MTQwNjI1LDUuNjI4NDEwODE2MTkyNjI3LC00MTIuNDY0NjMwMTI2OTUzMV19LHsibWVzaCI6MTMsIm5hbWUiOiIxMDAzOSBNaWRkbGV0b3duIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxODguMDcwOTY4NjI3OTI5Nyw2Ljk5ODUxMTc5MTIyOTI0OCwtNDEwLjI0NDcyMDQ1ODk4NDRdfSx7Im1lc2giOjE0LCJuYW1lIjoiMTAwMzMgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTU3LjU3OTcyNzE3Mjg1MTU2LDguNDM2OTkyNjQ1MjYzNjcyLC00MTEuODU3MDg2MTgxNjQwNl19LHsibWVzaCI6MTUsIm5hbWUiOiIxMDA1NSBNaWRkbGV0b3duIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsyNjAuMDQ4Njc1NTM3MTA5NCw0LjAzNDQ5NTgzMDUzNTg4OSwtNDEzLjgxMzI2MjkzOTQ1MzFdfSx7Im1lc2giOjE2LCJuYW1lIjoiMTAwNTMgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMjUyLjAwNDY1MzkzMDY2NDA2LDYuODk2NzkwOTgxMjkyNzI1LC00MTMuODc5ODUyMjk0OTIxOV19LHsibWVzaCI6NywibmFtZSI6IjEwMDIyIFZpZXcgUG9pbnQiLCJyb3RhdGlvbiI6WzAsLTAuMTQ4NDA0NTY4NDMzNzYxNiwwLDAuOTg4OTI2NzA4Njk4MjcyN10sInRyYW5zbGF0aW9uIjpbMTA1Ljc2MjE2ODg4NDI3NzM0LDUuODQwMDQyMTE0MjU3ODEyNSwtMzQ0LjM1MjU2OTU4MDA3ODFdfSx7Im1lc2giOjgsIm5hbWUiOiIxMDAyNCBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjE0ODQwNDU2ODQzMzc2MTYsMCwwLjk4ODkyNjcwODY5ODI3MjddLCJ0cmFuc2xhdGlvbiI6WzExMS40MTUzNTE4Njc2NzU3OCw4LjAzMzYyMDgzNDM1MDU4NiwtMzQwLjk5OTE0NTUwNzgxMjVdfSx7Im1lc2giOjksIm5hbWUiOiIxMDAyNiBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjE0ODQwNDU2ODQzMzc2MTYsMCwwLjk4ODkyNjcwODY5ODI3MjddLCJ0cmFuc2xhdGlvbiI6WzExOS43MjM3Nzc3NzA5OTYxLDUuNzMxMzkzMzM3MjQ5NzU2LC0zMzkuMjYyMTc2NTEzNjcxOV19LHsibWVzaCI6MTAsIm5hbWUiOiIxMDAyOCBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjE0ODQwNDU2ODQzMzc2MTYsMCwwLjk4ODkyNjcwODY5ODI3MjddLCJ0cmFuc2xhdGlvbiI6WzEyOC43ODE2MzE0Njk3MjY1Niw1LjIxMjQ4Mzg4MjkwNDA1MywtMzM0LjQ0MjU5NjQzNTU0NjldfSx7Im1lc2giOjExLCJuYW1lIjoiMTAwMzAgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwtMC4xNDg0MDQ1Njg0MzM3NjE2LDAsMC45ODg5MjY3MDg2OTgyNzI3XSwidHJhbnNsYXRpb24iOlsxNDAuOTQ2OTkwOTY2Nzk2ODgsNi41Njc2NTUwODY1MTczMzQsLTMzMy4yMDgxNjA0MDAzOTA2XX0seyJtZXNoIjoxMiwibmFtZSI6IjEwMDMyIFZpZXcgUG9pbnQiLCJyb3RhdGlvbiI6WzAsLTAuMTQ4NDA0NTY4NDMzNzYxNiwwLDAuOTg4OTI2NzA4Njk4MjcyN10sInRyYW5zbGF0aW9uIjpbMTQ4Ljk5ODczMzUyMDUwNzgsNS42Mjg0MTA4MTYxOTI2MjcsLTMzMC43ODA4MjI3NTM5MDYyNV19LHsibWVzaCI6MTMsIm5hbWUiOiIxMDAzNCBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjIyMDcwMDMyMzU4MTY5NTU2LDAsMC45NzUzNDE2Nzc2NjU3MTA0XSwidHJhbnNsYXRpb24iOlsxNjEuNTU2NzE2OTE4OTQ1Myw2Ljk5ODUxMTc5MTIyOTI0OCwtMzI2Ljg1OTIyMjQxMjEwOTRdfSx7Im1lc2giOjE0LCJuYW1lIjoiMTAwMzYgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwtMC4yMjA3MDAzMjM1ODE2OTU1NiwwLDAuOTc1MzQxNjc3NjY1NzEwNF0sInRyYW5zbGF0aW9uIjpbMTcxLjYyNDc3MTExODE2NDA2LDguNDM2OTkyNjQ1MjYzNjcyLC0zMjAuMjcwNTA3ODEyNV19LHsibWVzaCI6MTUsIm5hbWUiOiIxMDAxOCBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjA4NjE3MzAyMDMwMzI0OTM2LDAsMC45OTYyODAxOTMzMjg4NTc0XSwidHJhbnNsYXRpb24iOls4OS43NzUyNjA5MjUyOTI5Nyw0LjAzNDQ5NTgzMDUzNTg4OSwtMzQ1Ljk5NDcyMDQ1ODk4NDRdfSx7Im1lc2giOjE2LCJuYW1lIjoiMTAwMjAgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwtMC4wODYxNzMwMjAzMDMyNDkzNiwwLDAuOTk2MjgwMTkzMzI4ODU3NF0sInRyYW5zbGF0aW9uIjpbOTcuNjg4MzY5NzUwOTc2NTYsNi44OTY3OTA5ODEyOTI3MjUsLTM0NC41NDc5MTI1OTc2NTYyNV19LHsibWVzaCI6NywibmFtZSI6IlN0YWNrIDEwMDExIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOls1Ny4wMDMwMTM2MTA4Mzk4NDQsNS44NDAwNDIxMTQyNTc4MTI1LC0zNzMuMjczNDA2OTgyNDIxOV19LHsibWVzaCI6OCwibmFtZSI6IlN0YWNrIDEwMDA5Iiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOls1MC42MTQ0ODY2OTQzMzU5NCw4LjAzMzYyMDgzNDM1MDU4NiwtMzc0LjgxOTc5MzcwMTE3MTldfSx7Im1lc2giOjksIm5hbWUiOiJTdGFjayAxMDAwNyIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbNDIuMTYyMTg1NjY4OTQ1MzEsNS43MzEzOTMzMzcyNDk3NTYsLTM3NC4wNDE1MzQ0MjM4MjgxXX0seyJtZXNoIjoxMCwibmFtZSI6IlN0YWNrIDEwMDA1Iiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlszMi4wODg2OTkzNDA4MjAzMSw1LjIxMjQ4Mzg4MjkwNDA1MywtMzc1Ljk5MDE0MjgyMjI2NTZdfSx7Im1lc2giOjExLCJuYW1lIjoiU3RhY2sgMTAwMDMiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzIwLjA5NjgxMzIwMTkwNDI5Nyw2LjU2NzY1NTA4NjUxNzMzNCwtMzczLjU5OTM5NTc1MTk1MzFdfSx7Im1lc2giOjEyLCJuYW1lIjoiU3RhY2sgMTAwMDEiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzExLjY4NzI2ODI1NzE0MTExMyw1LjYyODQxMDgxNjE5MjYyNywtMzczLjU1NjQyNzAwMTk1MzFdfSx7Im1lc2giOjE1LCJuYW1lIjoiU3RhY2sgMTAwMTUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzcyLjMyNzE4NjU4NDQ3MjY2LDQuMDM0NDk1ODMwNTM1ODg5LC0zNzQuOTA1MDU5ODE0NDUzMV19LHsibWVzaCI6MTYsIm5hbWUiOiJTdGFjayAxMDAxMyIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbNjQuMjgzMTQ5NzE5MjM4MjgsNi44OTY3OTA5ODEyOTI3MjUsLTM3NC45NzE2NDkxNjk5MjE5XX0seyJtZXNoIjo5LCJuYW1lIjoiU3RhY2sgMTAwNDciLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzIyOS44ODM2NTE3MzMzOTg0NCw1LjczMTM5MzMzNzI0OTc1NiwtMzc0LjA0MTUzNDQyMzgyODFdfSx7Im1lc2giOjEwLCJuYW1lIjoiU3RhY2sgMTAwNDUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzIxOS44MTAxNTAxNDY0ODQzOCw1LjIxMjQ4Mzg4MjkwNDA1MywtMzc1Ljk5MDE0MjgyMjI2NTZdfSx7Im1lc2giOjExLCJuYW1lIjoiU3RhY2sgMTAwNDMiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzIwNy44MTgyOTgzMzk4NDM3NSw2LjU2NzY1NTA4NjUxNzMzNCwtMzczLjU5OTM5NTc1MTk1MzFdfSx7Im1lc2giOjEyLCJuYW1lIjoiU3RhY2sgMTAwMzciLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzE3Ni44ODQ2ODkzMzEwNTQ3LDUuNjI4NDEwODE2MTkyNjI3LC0zNzMuNTU2NDI3MDAxOTUzMV19LHsibWVzaCI6MTMsIm5hbWUiOiJTdGFjayAxMDAzOSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTg4LjA3MDk2ODYyNzkyOTcsNi45OTg1MTE3OTEyMjkyNDgsLTM3MS4zMzY1MTczMzM5ODQ0XX0seyJtZXNoIjoxNCwibmFtZSI6IlN0YWNrIDEwMDQxIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxOTkuNzIwNzk0Njc3NzM0MzgsOC40MzY5OTI2NDUyNjM2NzIsLTM3Mi45NDg4ODMwNTY2NDA2XX0seyJtZXNoIjo3LCJuYW1lIjoiTmlydGFuaWEiLCJyb3RhdGlvbiI6WzAsMC4zODcxNzg5ODcyNjQ2MzMyLDAsMC45MjIwMDQ1ODA0OTc3NDE3XSwidHJhbnNsYXRpb24iOlsyMDkuNzE3ODgwMjQ5MDIzNDQsNS44NDAwNDIxMTQyNTc4MTI1LC0zMzkuNjQ5OTMyODYxMzI4MV19LHsibWVzaCI6OCwibmFtZSI6IlVuZGVyYXJ2YSIsInJvdGF0aW9uIjpbMCwwLjM4NzE3ODk4NzI2NDYzMzIsMCwwLjkyMjAwNDU4MDQ5Nzc0MTddLCJ0cmFuc2xhdGlvbiI6WzIxNS4yOTUxMDQ5ODA0Njg3NSw4LjAzMzYyMDgzNDM1MDU4NiwtMzQzLjEyODI5NTg5ODQzNzVdfSx7Im1lc2giOjksIm5hbWUiOiJEYXZpc3BlbiIsInJvdGF0aW9uIjpbMCwwLjM4NzE3ODk4NzI2NDYzMzIsMCwwLjkyMjAwNDU4MDQ5Nzc0MTddLCJ0cmFuc2xhdGlvbiI6WzIyMC42NTc2Mzg1NDk4MDQ3LDUuNzMxMzkzMzM3MjQ5NzU2LC0zNDkuNzA3ODI0NzA3MDMxMjVdfSx7Im1lc2giOjEwLCJuYW1lIjoiT3hvcmNhc3RsZSIsInJvdGF0aW9uIjpbMCwwLjM4NzE3ODk4NzI2NDYzMzIsMCwwLjkyMjAwNDU4MDQ5Nzc0MTddLCJ0cmFuc2xhdGlvbiI6WzIyOS4xMDIyMDMzNjkxNDA2Miw1LjIxMjQ4Mzg4MjkwNDA1MywtMzU1LjUzNTUyMjQ2MDkzNzVdfSx7Im1lc2giOjE1LCJuYW1lIjoiU2hvcnRyaXZlciIsInJvdGF0aW9uIjpbMCwwLjM4NzE3ODk4NzI2NDYzMzIsMCwwLjkyMjAwNDU4MDQ5Nzc0MTddLCJ0cmFuc2xhdGlvbiI6WzIwMC4xNTMwMTUxMzY3MTg3NSw0LjAzNDQ5NTgzMDUzNTg4OSwtMzI3LjU2NjYxOTg3MzA0NjldfSx7Im1lc2giOjE2LCJuYW1lIjoiRnlubnZpZXciLCJyb3RhdGlvbiI6WzAsMC4zODcxNzg5ODcyNjQ2MzMyLDAsMC45MjIwMDQ1ODA0OTc3NDE3XSwidHJhbnNsYXRpb24iOlsyMDUuODMyODg1NzQyMTg3NSw2Ljg5Njc5MDk4MTI5MjcyNSwtMzMzLjI2MzA2MTUyMzQzNzVdfSx7Im1lc2giOjcsIm5hbWUiOiIxMDAxMSBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLDAuOTk3NzIzODc3NDI5OTYyMiwwLDAuMDY3NDMyNjcxNzg1MzU0NjFdLCJ0cmFuc2xhdGlvbiI6WzU5LjI1ODg2OTE3MTE0MjU4LDUuODQwMDQyMTE0MjU3ODEyNSwtMzIyLjcwMDE2NDc5NDkyMTldfSx7Im1lc2giOjgsIm5hbWUiOiIxMDAwOSBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLDAuOTk3NzIzODc3NDI5OTYyMiwwLDAuMDY3NDMyNjcxNzg1MzU0NjFdLCJ0cmFuc2xhdGlvbiI6WzUzLjEzNjUyNDIwMDQzOTQ1LDguMDMzNjIwODM0MzUwNTg2LC0zMjUuMDkyMTMyNTY4MzU5NF19LHsibWVzaCI6OSwibmFtZSI6IjEwMDA3IFZpZXcgUG9pbnQiLCJyb3RhdGlvbiI6WzAsMC45OTkxOTUzOTY5MDAxNzcsMCwwLjA0MDEwNzQ0MzkyODcxODU3XSwidHJhbnNsYXRpb24iOls0My4xNzM0NDI4NDA1NzYxNyw1LjczMTM5MzMzNzI0OTc1NiwtMzI1LjI0MzkyNzAwMTk1MzFdfSx7Im1lc2giOjEwLCJuYW1lIjoiMTAwMDUgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwwLjk5OTE5NTM5NjkwMDE3NywwLDAuMDQwMTA3NDQzOTI4NzE4NTddLCJ0cmFuc2xhdGlvbiI6WzMzLjI4ODU0NzUxNTg2OTE0LDUuMjEyNDgzODgyOTA0MDUzLC0zMjcuOTkzNjUyMzQzNzVdfSx7Im1lc2giOjExLCJuYW1lIjoiMTAwMDMgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwwLjk5OTE5NTM5NjkwMDE3NywwLDAuMDQwMTA3NDQzOTI4NzE4NTddLCJ0cmFuc2xhdGlvbiI6WzIxLjE0MzYyMzM1MjA1MDc4LDYuNTY3NjU1MDg2NTE3MzM0LC0zMjYuNTcxNzc3MzQzNzVdfSx7Im1lc2giOjEyLCJuYW1lIjoiMTAwMDEgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwwLjk5OTE5NTM5NjkwMDE3NywwLDAuMDQwMTA3NDQzOTI4NzE4NTddLCJ0cmFuc2xhdGlvbiI6WzEyLjc1NzY4ODUyMjMzODg2Nyw1LjYyODQxMDgxNjE5MjYyNywtMzI3LjIwMjk3MjQxMjEwOTRdfSx7Im1lc2giOjE1LCJuYW1lIjoiMTAwMTUgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwwLjk5NzcyMzg3NzQyOTk2MjIsMCwwLjA2NzQzMjY3MTc4NTM1NDYxXSwidHJhbnNsYXRpb24iOls3NC42NjMyMzA4OTU5OTYxLDQuMDM0NDk1ODMwNTM1ODg5LC0zMjIuMjU0OTc0MzY1MjM0NF19LHsibWVzaCI6MTYsIm5hbWUiOiIxMDAxMyBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLDAuOTk3NzIzODc3NDI5OTYyMiwwLDAuMDY3NDMyNjcxNzg1MzU0NjFdLCJ0cmFuc2xhdGlvbiI6WzY2LjcwMTMxNjgzMzQ5NjEsNi44OTY3OTA5ODEyOTI3MjUsLTMyMy40MDMzNTA4MzAwNzgxXX0seyJtZXNoIjoxMiwibmFtZSI6IkhpZ2ggWWVubmVzIiwicm90YXRpb24iOlswLDAuNDIxOTEwOTExNzk4NDc3MiwwLDAuOTA2NjM3MzEwOTgxNzUwNV0sInRyYW5zbGF0aW9uIjpbMTQxLjM1NTkxMTI1NDg4MjgsNS42Mjg0MTA4MTYxOTI2MjcsLTI2Mi43NTMwNTE3NTc4MTI1XX0seyJtZXNoIjoxMywibmFtZSI6IldpbnRlcmVueWEiLCJyb3RhdGlvbiI6WzAsMC40MjE5MTA5MTE3OTg0NzcyLDAsMC45MDY2MzczMTA5ODE3NTA1XSwidHJhbnNsYXRpb24iOlsxNDYuOTU4OTUzODU3NDIxODgsNi45OTg1MTE3OTEyMjkyNDgsLTI3Mi44NTY1MDYzNDc2NTYyNV19LHsibWVzaCI6MTQsIm5hbWUiOiJOZXcgTGVhaGN1dCIsInJvdGF0aW9uIjpbMCwwLjQyMTkxMDkxMTc5ODQ3NzIsMCwwLjkwNjYzNzMxMDk4MTc1MDVdLCJ0cmFuc2xhdGlvbiI6WzE1NS44NzExNTQ3ODUxNTYyNSw4LjQzNjk5MjY0NTI2MzY3MiwtMjgwLjk0MDMwNzYxNzE4NzVdfSx7Im1lc2giOjcsIm5hbWUiOiJUaGV0YSBCYXkiLCJyb3RhdGlvbiI6WzAsLTAuMTM3MjAyMTg4MzcyNjEyLDAsMC45OTA1NDMwNjc0NTUyOTE3XSwidHJhbnNsYXRpb24iOls2NS44MDQyNjc4ODMzMDA3OCw1Ljg0MDA0MjExNDI1NzgxMjUsLTI3Ni4wNjg0ODE0NDUzMTI1XX0seyJtZXNoIjo4LCJuYW1lIjoiRXRhIEJheSIsInJvdGF0aW9uIjpbMCwtMC4xMzcyMDIxODgzNzI2MTIsMCwwLjk5MDU0MzA2NzQ1NTI5MTddLCJ0cmFuc2xhdGlvbiI6WzcxLjUzMTg5MDg2OTE0MDYyLDguMDMzNjIwODM0MzUwNTg2LC0yNzIuODQzOTAyNTg3ODkwNl19LHsibWVzaCI6OSwibmFtZSI6IlpldGEgQmF5Iiwicm90YXRpb24iOlswLC0wLjEzNzIwMjE4ODM3MjYxMiwwLDAuOTkwNTQzMDY3NDU1MjkxN10sInRyYW5zbGF0aW9uIjpbNzkuODc3NTEwMDcwODAwNzgsNS43MzEzOTMzMzcyNDk3NTYsLTI3MS4yOTU0NDA2NzM4MjgxXX0seyJtZXNoIjoxMCwibmFtZSI6IkVwc2lsb24gQmF5Iiwicm90YXRpb24iOlswLC0wLjEzNzIwMjE4ODM3MjYxMiwwLDAuOTkwNTQzMDY3NDU1MjkxN10sInRyYW5zbGF0aW9uIjpbODkuMDQyMTI5NTE2NjAxNTYsNS4yMTI0ODM4ODI5MDQwNTMsLTI2Ni42ODIxMjg5MDYyNV19LHsibWVzaCI6MTEsIm5hbWUiOiJEZWx0YSBCYXkiLCJyb3RhdGlvbiI6WzAsLTAuMTM3MjAyMTg4MzcyNjEyLDAsMC45OTA1NDMwNjc0NTUyOTE3XSwidHJhbnNsYXRpb24iOlsxMDEuMjMyMzE1MDYzNDc2NTYsNi41Njc2NTUwODY1MTczMzQsLTI2NS43MjMzNTgxNTQyOTY5XX0seyJtZXNoIjoxMiwibmFtZSI6IkdhbW1hIEJheSIsInJvdGF0aW9uIjpbMCwtMC4xMzcyMDIxODgzNzI2MTIsMCwwLjk5MDU0MzA2NzQ1NTI5MTddLCJ0cmFuc2xhdGlvbiI6WzEwOS4zMzY5MzY5NTA2ODM2LDUuNjI4NDEwODE2MTkyNjI3LC0yNjMuNDc4ODgxODM1OTM3NV19LHsibWVzaCI6MTMsIm5hbWUiOiJCZXRhIEJheSIsInJvdGF0aW9uIjpbMCwtMC4yMDk2NDcwNTk0NDA2MTI4LDAsMC45Nzc3NzcxMjM0NTEyMzI5XSwidHJhbnNsYXRpb24iOlsxMjEuOTgwNDYxMTIwNjA1NDcsNi45OTg1MTE3OTEyMjkyNDgsLTI1OS44NDI0OTg3NzkyOTY5XX0seyJtZXNoIjoxNCwibmFtZSI6IkFscGhhIEJheSIsInJvdGF0aW9uIjpbMCwtMC4yMDk2NDcwNTk0NDA2MTI4LDAsMC45Nzc3NzcxMjM0NTEyMzI5XSwidHJhbnNsYXRpb24iOlsxMzIuMTk1MDY4MzU5Mzc1LDguNDM2OTkyNjQ1MjYzNjcyLC0yNTMuNDgzMzk4NDM3NV19LHsibWVzaCI6MTUsIm5hbWUiOiJLYXBwYSBCYXkiLCJyb3RhdGlvbiI6WzAsLTAuMDc0ODkxMTQ5OTk3NzExMTgsMCwwLjk5NzE5MTcyNzE2MTQwNzVdLCJ0cmFuc2xhdGlvbiI6WzQ5Ljc4NDI3MTI0MDIzNDM3NSw0LjAzNDQ5NTgzMDUzNTg4OSwtMjc3LjM0ODM1ODE1NDI5NjldfSx7Im1lc2giOjE2LCJuYW1lIjoiSW90YSBCYXkiLCJyb3RhdGlvbiI6WzAsLTAuMDc0ODkxMTQ5OTk3NzExMTgsMCwwLjk5NzE5MTcyNzE2MTQwNzVdLCJ0cmFuc2xhdGlvbiI6WzU3LjcyODEwMzYzNzY5NTMxLDYuODk2NzkwOTgxMjkyNzI1LC0yNzYuMDgxMDU0Njg3NV19LHsibWVzaCI6NywibmFtZSI6IlBpIEJheSIsInJvdGF0aW9uIjpbMCwtMC43MDI5NjEwMjc2MjIyMjI5LDAsMC43MTEyMjgzNzA2NjY1MDM5XSwidHJhbnNsYXRpb24iOlsxNS4zODc1MTEyNTMzNTY5MzQsNS44NDAwNDIxMTQyNTc4MTI1LC0zMDUuMzA0ODQwMDg3ODkwNl19LHsibWVzaCI6OCwibmFtZSI6IlhpIEJheSIsInJvdGF0aW9uIjpbMCwtMC43MDI5NjEwMjc2MjIyMjI5LDAsMC43MTEyMjgzNzA2NjY1MDM5XSwidHJhbnNsYXRpb24iOlsxMy45MTU4OTQ1MDgzNjE4MTYsOC4wMzM2MjA4MzQzNTA1ODYsLTI5OC44OTg2ODE2NDA2MjVdfSx7Im1lc2giOjE2LCJuYW1lIjoiUmhvIEJheSIsInJvdGF0aW9uIjpbMCwtMC43MDI5NjEwMjc2MjIyMjI5LDAsMC43MTEyMjgzNzA2NjY1MDM5XSwidHJhbnNsYXRpb24iOlsxMy42MDQyODA0NzE4MDE3NTgsNi44OTY3OTA5ODEyOTI3MjUsLTMxMi41NjQ2MzYyMzA0Njg3NV19LHsibWVzaCI6NywibmFtZSI6IjEwMDA0IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy0yOTQuNTUzNzcxOTcyNjU2MjUsNS44NDAwNDIxMTQyNTc4MTI1LC00OTYuNDM0OTA2MDA1ODU5NF19LHsibWVzaCI6OSwibmFtZSI6IjEwMDAzIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy0zMDguNzMxNDc1ODMwMDc4MSw1LjczMTM5MzMzNzI0OTc1NiwtNDk3LjIwMzAzMzQ0NzI2NTZdfSx7Im1lc2giOjEwLCJuYW1lIjoiMTAwMDIgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTMxOC44MDQ5OTI2NzU3ODEyNSw1LjIxMjQ4Mzg4MjkwNDA1MywtNDk5LjE1MTY0MTg0NTcwMzFdfSx7Im1lc2giOjEyLCJuYW1lIjoiMTAwMDEgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTMzOC4yMTE3MzA5NTcwMzEyNSw1LjYyODQxMDgxNjE5MjYyNywtNDk2LjcxNzkyNjAyNTM5MDZdfSx7Im1lc2giOjE2LCJuYW1lIjoiMTAwMDUgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTI4Ny4yNzM1NTk1NzAzMTI1LDYuODk2NzkwOTgxMjkyNzI1LC00OTguMTMzMTQ4MTkzMzU5NF19LHsibWVzaCI6OCwibmFtZSI6IjEwMDE5IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy0xMTIuNTc2MTI2MDk4NjMyODEsOC4wMzM2MjA4MzQzNTA1ODYsLTQ5Ny45ODEyOTI3MjQ2MDk0XX0seyJtZXNoIjo5LCJuYW1lIjoiMTAwMTggU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTEyMS4wMjg0MjcxMjQwMjM0NCw1LjczMTM5MzMzNzI0OTc1NiwtNDk3LjIwMzAzMzQ0NzI2NTZdfSx7Im1lc2giOjEwLCJuYW1lIjoiMTAwMTcgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTEzNC42MTcwMDQzOTQ1MzEyNSw1LjIxMjQ4Mzg4MjkwNDA1MywtNDk5LjE1MTY0MTg0NTcwMzFdfSx7Im1lc2giOjExLCJuYW1lIjoiMTAwMTYgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTE0Ni42MDg4NTYyMDExNzE4OCw2LjU2NzY1NTA4NjUxNzMzNCwtNDk2Ljc2MDg5NDc3NTM5MDZdfSx7Im1lc2giOjEyLCJuYW1lIjoiMTAwMTUgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTE1OC4xNjUwNjk1ODAwNzgxMiw1LjYyODQxMDgxNjE5MjYyNywtNDk2LjcxNzkyNjAyNTM5MDZdfSx7Im1lc2giOjEzLCJuYW1lIjoiMTAwMTQgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTE2OS41MDI4NTMzOTM1NTQ3LDYuOTk4NTExNzkxMjI5MjQ4LC00OTQuNDk4MDE2MzU3NDIxOV19LHsibWVzaCI6MTUsIm5hbWUiOiIxMDAyMSBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlstODkuODUwMzQxNzk2ODc1LDQuMDM0NDk1ODMwNTM1ODg5LC00OTguMDY2NTU4ODM3ODkwNl19LHsibWVzaCI6MTYsIm5hbWUiOiIxMDAyMCBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlstOTcuODk0MzQ4MTQ0NTMxMjUsNi44OTY3OTA5ODEyOTI3MjUsLTQ5OC4xMzMxNDgxOTMzNTk0XX0seyJtZXNoIjoxNywibmFtZSI6IjEwMDA2IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy0yNjguNTk4MzU4MTU0Mjk2OSw4LjQzNjk5MjY0NTI2MzY3MiwtNDk2LjExMDM4MjA4MDA3ODFdfSx7Im1lc2giOjE4LCJuYW1lIjoiMTAwMDcgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTI2MS4xNDA3MTY1NTI3MzQ0LDUuNjI4NDEwODE2MTkyNjI3LC00OTYuNzE3OTI2MDI1MzkwNl19LHsibWVzaCI6MTksIm5hbWUiOiIxMDAwOCBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlstMjQ0Ljc3Mzk3MTU1NzYxNzIsNi41Njc2NTUwODY1MTczMzQsLTQ5Ni43NjA4OTQ3NzUzOTA2XX0seyJtZXNoIjoyMCwibmFtZSI6IjEwMDA5IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy0yMzQuODgxOTI3NDkwMjM0MzgsNS4yMTI0ODM4ODI5MDQwNTMsLTQ5OS4xNTE2NDE4NDU3MDMxXX0seyJtZXNoIjoyMSwibmFtZSI6IjEwMDEwIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy0yMTguNzI5OTY1MjA5OTYwOTQsNS43MzEzOTMzMzcyNDk3NTYsLTQ5Ny4yMDMwMzM0NDcyNjU2XX0seyJtZXNoIjoyMiwibmFtZSI6IjEwMDExIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy0yMTAuMjc3NjY0MTg0NTcwMyw4LjAzMzYyMDgzNDM1MDU4NiwtNDk3Ljk4MTI5MjcyNDYwOTRdfSx7Im1lc2giOjIzLCJuYW1lIjoiMTAwMTIgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTE5NC40MjY3ODgzMzAwNzgxMiw2Ljg5Njc5MDk4MTI5MjcyNSwtNDk4LjEzMzE0ODE5MzM1OTRdfSx7Im1lc2giOjI0LCJuYW1lIjoiMTAwMTMgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTE4Ni4zODI3NTE0NjQ4NDM3NSw0LjAzNDQ5NTgzMDUzNTg4OSwtNDk4LjA2NjU1ODgzNzg5MDZdfSx7Im1lc2giOjI1LCJuYW1lIjoiMTAwMjIgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTY4LjQwMDUxMjY5NTMxMjUsNi45OTg1MTE3OTEyMjkyNDgsLTQ5NC40OTgwMTYzNTc0MjE5XX0seyJtZXNoIjoxOCwibmFtZSI6IjEwMDIzIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy01Ny4wNjI3NDQxNDA2MjUsNS42Mjg0MTA4MTYxOTI2MjcsLTQ5Ni43MTc5MjYwMjUzOTA2XX0seyJtZXNoIjoxOSwibmFtZSI6IjEwMDI0IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy00OC42NTMxOTgyNDIxODc1LDYuNTY3NjU1MDg2NTE3MzM0LC00OTYuNzYwODk0Nzc1MzkwNl19LHsibWVzaCI6MjAsIm5hbWUiOiIxMDAyNSBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlstMzYuNjYxMzE1OTE3OTY4NzUsNS4yMTI0ODM4ODI5MDQwNTMsLTQ5OS4xNTE2NDE4NDU3MDMxXX0seyJtZXNoIjoyMSwibmFtZSI6IjEwMDI2IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy0yNi41ODc4Mjk1ODk4NDM3NSw1LjczMTM5MzMzNzI0OTc1NiwtNDk3LjIwMzAzMzQ0NzI2NTZdfSx7Im1lc2giOjIyLCJuYW1lIjoiMTAwMjcgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTE4LjEzNTQ5ODA0Njg3NSw4LjAzMzYyMDgzNDM1MDU4NiwtNDk3Ljk4MTI5MjcyNDYwOTRdfSx7Im1lc2giOjI2LCJuYW1lIjoiMTAwMjggU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTExLjc0NzAzMzExOTIwMTY2LDUuODQwMDQyMTE0MjU3ODEyNSwtNDk2LjQzNDkwNjAwNTg1OTRdfSx7Im1lc2giOjE3LCJuYW1lIjoiMTAwMzkgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMTA2LjExMTMwNTIzNjgxNjQsOC40MzY5OTI2NDUyNjM2NzIsLTQ5OC42NTY3MDc3NjM2NzE5XX0seyJtZXNoIjoyNSwibmFtZSI6IjEwMDQwIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzExOC4wMzUwOTUyMTQ4NDM3NSw2Ljk5ODUxMTc5MTIyOTI0OCwtNDk3LjA0NDM0MjA0MTAxNTZdfSx7Im1lc2giOjE4LCJuYW1lIjoiMTAwNDEgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMTI5LjM3Mjg3OTAyODMyMDMsNS42Mjg0MTA4MTYxOTI2MjcsLTQ5OS4yNjQyNTE3MDg5ODQ0XX0seyJtZXNoIjoyMCwibmFtZSI6IjEwMDQzIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzE0OS43NzQyNzY3MzMzOTg0NCw1LjIxMjQ4Mzg4MjkwNDA1MywtNTAxLjY5Nzk2NzUyOTI5NjldfSx7Im1lc2giOjE5LCJuYW1lIjoiMTAwNDQgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMTU4LjY1Nzc0NTM2MTMyODEyLDYuNTY3NjU1MDg2NTE3MzM0LC00OTkuMzA3MjIwNDU4OTg0NF19LHsibWVzaCI6MjIsIm5hbWUiOiIxMDA0NSBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlsxNjguMzAwMDk0NjA0NDkyMiw4LjAzMzYyMDgzNDM1MDU4NiwtNTAwLjUyNzYxODQwODIwMzFdfSx7Im1lc2giOjI2LCJuYW1lIjoiMTAwNDYgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMTc0LjY4ODU4MzM3NDAyMzQ0LDUuODQwMDQyMTE0MjU3ODEyNSwtNDk4Ljk4MTIzMTY4OTQ1MzFdfSx7Im1lc2giOjIzLCJuYW1lIjoiMTAwNDcgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMTgxLjk2ODc2NTI1ODc4OTA2LDYuODk2NzkwOTgxMjkyNzI1LC01MDAuNjc5NDczODc2OTUzMV19LHsibWVzaCI6MjQsIm5hbWUiOiIxMDA0OCBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlsxOTAuMDEyODAyMTI0MDIzNDQsNC4wMzQ0OTU4MzA1MzU4ODksLTUwMC42MTI4ODQ1MjE0ODQ0XX0seyJtZXNoIjoyMSwibmFtZSI6IjEwMDQ5IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzIwMC42NzU2ODk2OTcyNjU2Miw1LjczMTM5MzMzNzI0OTc1NiwtNDk5Ljc0OTM1OTEzMDg1OTRdfSx7Im1lc2giOjE3LCJuYW1lIjoiMTAwNTkgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMjkzLjgzMjc2MzY3MTg3NSw4LjQzNjk5MjY0NTI2MzY3MiwtNDk4LjY1NjcwNzc2MzY3MTldfSx7Im1lc2giOjI1LCJuYW1lIjoiMTAwNjAgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMzA1Ljc1NjU2MTI3OTI5NjksNi45OTg1MTE3OTEyMjkyNDgsLTQ5Ny4wNDQzNDIwNDEwMTU2XX0seyJtZXNoIjoxOCwibmFtZSI6IjEwMDYxIFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzMxNy4wOTQzMjk4MzM5ODQ0LDUuNjI4NDEwODE2MTkyNjI3LC00OTkuMjY0MjUxNzA4OTg0NF19LHsibWVzaCI6MTksIm5hbWUiOiIxMDA2MiBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlszMjUuNTAzODc1NzMyNDIxOSw2LjU2NzY1NTA4NjUxNzMzNCwtNDk5LjMwNzIyMDQ1ODk4NDRdfSx7Im1lc2giOjIwLCJuYW1lIjoiMTAwNjMgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMzM3LjQ5NTc1ODA1NjY0MDYsNS4yMTI0ODM4ODI5MDQwNTMsLTUwMS42OTc5Njc1MjkyOTY5XX0seyJtZXNoIjoyMSwibmFtZSI6IjEwMDY0IFNob3JlbGluZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzM0Ny41NjkyNDQzODQ3NjU2LDUuNzMxMzkzMzM3MjQ5NzU2LC00OTkuNzQ5MzU5MTMwODU5NF19LHsibWVzaCI6MjIsIm5hbWUiOiIxMDA2NSBTaG9yZWxpbmUiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlszNTYuMDIxNTc1OTI3NzM0NCw4LjAzMzYyMDgzNDM1MDU4NiwtNTAwLjUyNzYxODQwODIwMzFdfSx7Im1lc2giOjI2LCJuYW1lIjoiMTAwNjYgU2hvcmVsaW5lIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMzYyLjQxMDAzNDE3OTY4NzUsNS44NDAwNDIxMTQyNTc4MTI1LC00OTguOTgxMjMxNjg5NDUzMV19LHsibWVzaCI6MjcsIm5hbWUiOiJTYXRvc2hpJ3MgTWFuc2lvbiIsInJvdGF0aW9uIjpbMCwtMC42Nzc4MTU4NTQ1NDk0MDgsMCwwLjczNTIzMTY5NzU1OTM1NjddLCJzY2FsZSI6WzkuMTQxNTk4NzAxNDc3MDUsOS4xNDE1OTg3MDE0NzcwNSw5LjE0MTU5ODcwMTQ3NzA1XSwidHJhbnNsYXRpb24iOlszNTYuNjMyODEyNSw1LjIzNzIyNjk2MzA0MzIxMywtODkuNDI2NzU3ODEyNV19LHsibWVzaCI6MjgsIm5hbWUiOiJTaGFkeSBBY3JlcyIsInJvdGF0aW9uIjpbMCwtMC43MDcxMDY1OTAyNzA5OTYxLDAsMC43MDcxMDY5NDc4OTg4NjQ3XSwic2NhbGUiOls5Ljc4MTgwNzg5OTQ3NTA5OCw5Ljc4MTgwNzg5OTQ3NTA5OCw5Ljc4MTgwNzg5OTQ3NTA5OF0sInRyYW5zbGF0aW9uIjpbNDQ1LjM2NzA5NTk0NzI2NTYsMTAuMTg0Nzk3Mjg2OTg3MzA1LC0zMDkuMDQ3NDU0ODMzOTg0NF19LHsibWVzaCI6MjksIm5hbWUiOiJTaGVpa2FoIFRvd2VyIiwicm90YXRpb24iOlswLC0wLjcwNzEwNjU5MDI3MDk5NjEsMCwwLjcwNzEwNjk0Nzg5ODg2NDddLCJ0cmFuc2xhdGlvbiI6WzQ0Ny42ODQxNDMwNjY0MDYyNSwzLjkyNTc4OTgzMzA2ODg0NzcsMjUuNzA2Njk1NTU2NjQwNjI1XX0seyJtZXNoIjozMCwibmFtZSI6IlRoZSBXYXNoaW5ndG9uIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbNDkxLjY3ODUyNzgzMjAzMTI1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMjE1LjI5Mjc4NTY0NDUzMTI1XX0seyJtZXNoIjozMSwibmFtZSI6IlRyYXNoIFRvd2VyIiwicm90YXRpb24iOlswLC0wLjk5Njc5NDI4MzM5MDA0NTIsMCwwLjA4MDAwNzI1NTA3NzM2MjA2XSwidHJhbnNsYXRpb24iOlsyNS4zOTUyNzcwMjMzMTU0MywzLjkyNTc4OTgzMzA2ODg0NzcsMTE5Ljg3MzQyODM0NDcyNjU2XX0seyJtZXNoIjozMiwibmFtZSI6Ildpc2ggWW91IFdlcmUgSGVyZSIsInNjYWxlIjpbMTIuMTgzNzI0NDAzMzgxMzQ4LDEyLjE4MzcyNDQwMzM4MTM0OCwxMi4xODM3MjQ0MDMzODEzNDhdLCJ0cmFuc2xhdGlvbiI6Wy0zNTYuMzA1ODQ3MTY3OTY4NzUsMTkuNjQ2Mjg0MTAzMzkzNTU1LDM5OC41Mzk5MTY5OTIxODc1XX0seyJtZXNoIjoyNiwibmFtZSI6IjEwMDQyIEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlsxOTkuMTQwNTYzOTY0ODQzNzUsNS44NDAwNDIxMTQyNTc4MTI1LC00NzcuNDcwMjQ1MzYxMzI4MV19LHsibWVzaCI6MjIsIm5hbWUiOiIxMDAzNiBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMTc1LjEyNDMyODYxMzI4MTI1LDguMDMzNjIwODM0MzUwNTg2LC00NzUuOTIzODU4NjQyNTc4MV19LHsibWVzaCI6MjEsIm5hbWUiOiIxMDA0NiBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMjEzLjk4MTM1Mzc1OTc2NTYyLDUuNzMxMzkzMzM3MjQ5NzU2LC00NzYuNzAyMTE3OTE5OTIxOV19LHsibWVzaCI6MjAsIm5hbWUiOiIxMDA0OCBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMjI0LjA1NDg3MDYwNTQ2ODc1LDUuMjEyNDgzODgyOTA0MDUzLC00NzQuNzUzNTA5NTIxNDg0NF19LHsibWVzaCI6MTksIm5hbWUiOiIxMDA1MCBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMjM2LjA0NjczNzY3MDg5ODQ0LDYuNTY3NjU1MDg2NTE3MzM0LC00NzcuMTQ0MjU2NTkxNzk2OV19LHsibWVzaCI6MTgsIm5hbWUiOiIxMDA1MiBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMjQ0LjQ1NjI2ODMxMDU0Njg4LDUuNjI4NDEwODE2MTkyNjI3LC00NzcuMTg3MjI1MzQxNzk2OV19LHsibWVzaCI6MjUsIm5hbWUiOiIxMDA1NCBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMjU1Ljc5NDA1MjEyNDAyMzQ0LDYuOTk4NTExNzkxMjI5MjQ4LC00NzkuNDA3MTM1MDA5NzY1Nl19LHsibWVzaCI6MTcsIm5hbWUiOiIxMDA1NiBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMjY3LjcxNzg2NDk5MDIzNDQsOC40MzY5OTI2NDUyNjM2NzIsLTQ3Ny43OTQ3NjkyODcxMDk0XX0seyJtZXNoIjoyNCwibmFtZSI6IjEwMDM4IEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlsxODMuODE2MzQ1MjE0ODQzNzUsNC4wMzQ0OTU4MzA1MzU4ODksLTQ3NS44Mzg1OTI1MjkyOTY5XX0seyJtZXNoIjoyMywibmFtZSI6IjEwMDQwIEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlsxOTEuODYwMzgyMDgwMDc4MTIsNi44OTY3OTA5ODEyOTI3MjUsLTQ3NS43NzIwMDMxNzM4MjgxXX0seyJtZXNoIjoyNiwibmFtZSI6IjEwMDAyIEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlsxMS40MTkxMjU1NTY5NDU4LDUuODQwMDQyMTE0MjU3ODEyNSwtNDc3LjQ3MDI0NTM2MTMyODFdfSx7Im1lc2giOjIyLCJuYW1lIjoiMTAwMDQgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6WzE3LjgwNzU3NzEzMzE3ODcxLDguMDMzNjIwODM0MzUwNTg2LC00NzUuOTIzODU4NjQyNTc4MV19LHsibWVzaCI6MjEsIm5hbWUiOiIxMDAwNiBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbMjYuMjU5OTA4Njc2MTQ3NDYsNS43MzEzOTMzMzcyNDk3NTYsLTQ3Ni43MDIxMTc5MTk5MjE5XX0seyJtZXNoIjoyMCwibmFtZSI6IjEwMDA4IEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOlszNi4zMzMzOTMwOTY5MjM4Myw1LjIxMjQ4Mzg4MjkwNDA1MywtNDc0Ljc1MzUwOTUyMTQ4NDRdfSx7Im1lc2giOjE5LCJuYW1lIjoiMTAwMTAgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6WzQ4LjMyNTI3NTQyMTE0MjU4LDYuNTY3NjU1MDg2NTE3MzM0LC00NzcuMTQ0MjU2NTkxNzk2OV19LHsibWVzaCI6MTgsIm5hbWUiOiIxMDAxMiBBcmNoYWlkZSIsInRyYW5zbGF0aW9uIjpbNTYuNzM0ODIxMzE5NTgwMDgsNS42Mjg0MTA4MTYxOTI2MjcsLTQ3Ny4xODcyMjUzNDE3OTY5XX0seyJtZXNoIjoyNSwibmFtZSI6IjEwMDE0IEFyY2hhaWRlIiwidHJhbnNsYXRpb24iOls2OC4wNzI1OTM2ODg5NjQ4NCw2Ljk5ODUxMTc5MTIyOTI0OCwtNDc5LjQwNzEzNTAwOTc2NTZdfSx7Im1lc2giOjE3LCJuYW1lIjoiMTAwMTYgQXJjaGFpZGUiLCJ0cmFuc2xhdGlvbiI6Wzc5Ljk5NjM5MTI5NjM4NjcyLDguNDM2OTkyNjQ1MjYzNjcyLC00NzcuNzk0NzY5Mjg3MTA5NF19LHsibWVzaCI6MjYsIm5hbWUiOiIxMDA0MiBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOlsxOTkuNzkyNjc4ODMzMDA3OCw1Ljg0MDA0MjExNDI1NzgxMjUsLTQzNS45MDI3NzA5OTYwOTM3NV19LHsibWVzaCI6MjIsIm5hbWUiOiIxMDA0NCBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOlsyMDYuMTgxMTY3NjAyNTM5MDYsOC4wMzM2MjA4MzQzNTA1ODYsLTQzNC4zNTYzODQyNzczNDM3NV19LHsibWVzaCI6MjEsIm5hbWUiOiIxMDA0NiBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOlsyMTQuNjMzNDY4NjI3OTI5Nyw1LjczMTM5MzMzNzI0OTc1NiwtNDM1LjEzNDY0MzU1NDY4NzVdfSx7Im1lc2giOjIwLCJuYW1lIjoiMTAwNDggTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbMjI0LjcwNjk4NTQ3MzYzMjgsNS4yMTI0ODM4ODI5MDQwNTMsLTQzMy4xODYwMzUxNTYyNV19LHsibWVzaCI6MTksIm5hbWUiOiIxMDA1MCBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOlsyMzYuNjk4ODUyNTM5MDYyNSw2LjU2NzY1NTA4NjUxNzMzNCwtNDM1LjU3Njc4MjIyNjU2MjVdfSx7Im1lc2giOjE4LCJuYW1lIjoiMTAwNTIgTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbMjQ1LjEwODM4MzE3ODcxMDk0LDUuNjI4NDEwODE2MTkyNjI3LC00MzUuNjE5NzUwOTc2NTYyNV19LHsibWVzaCI6MjUsIm5hbWUiOiIxMDA1NCBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOlsyNTYuNDQ2MTY2OTkyMTg3NSw2Ljk5ODUxMTc5MTIyOTI0OCwtNDM3LjgzOTY2MDY0NDUzMTI1XX0seyJtZXNoIjoxNywibmFtZSI6IjEwMDU2IE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzI2OC4zNjk5NjQ1OTk2MDk0LDguNDM2OTkyNjQ1MjYzNjcyLC00MzYuMjI3Mjk0OTIxODc1XX0seyJtZXNoIjoyNCwibmFtZSI6IjEwMDM4IE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzE4NC40Njg0NjAwODMwMDc4LDQuMDM0NDk1ODMwNTM1ODg5LC00MzQuMjcxMTE4MTY0MDYyNV19LHsibWVzaCI6MjMsIm5hbWUiOiIxMDA0MCBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOlsxOTIuNTEyNDk2OTQ4MjQyMiw2Ljg5Njc5MDk4MTI5MjcyNSwtNDM0LjIwNDUyODgwODU5Mzc1XX0seyJtZXNoIjoyNiwibmFtZSI6IjEwMDAyIE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzEyLjA3MTIzMjc5NTcxNTMzMiw1Ljg0MDA0MjExNDI1NzgxMjUsLTQzNS45MDI3NzA5OTYwOTM3NV19LHsibWVzaCI6MjIsIm5hbWUiOiIxMDAwNCBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOlsxOC40NTk2ODQzNzE5NDgyNDIsOC4wMzM2MjA4MzQzNTA1ODYsLTQzNC4zNTYzODQyNzczNDM3NV19LHsibWVzaCI6MjEsIm5hbWUiOiIxMDAwNiBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOlsyNi45MTIwMTU5MTQ5MTY5OTIsNS43MzEzOTMzMzcyNDk3NTYsLTQzNS4xMzQ2NDM1NTQ2ODc1XX0seyJtZXNoIjoyMCwibmFtZSI6IjEwMDA4IE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzM2Ljk4NTUwNDE1MDM5MDYyNSw1LjIxMjQ4Mzg4MjkwNDA1MywtNDMzLjE4NjAzNTE1NjI1XX0seyJtZXNoIjoxOSwibmFtZSI6IjEwMDEwIE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzQ4Ljk3NzM4NjQ3NDYwOTM3NSw2LjU2NzY1NTA4NjUxNzMzNCwtNDM1LjU3Njc4MjIyNjU2MjVdfSx7Im1lc2giOjE4LCJuYW1lIjoiMTAwMTIgTWlkZGxldG93biIsInRyYW5zbGF0aW9uIjpbNTcuMzg2OTMyMzczMDQ2ODc1LDUuNjI4NDEwODE2MTkyNjI3LC00MzUuNjE5NzUwOTc2NTYyNV19LHsibWVzaCI6MjUsIm5hbWUiOiIxMDAxNCBNaWRkbGV0b3duIiwidHJhbnNsYXRpb24iOls2OC43MjQ2OTMyOTgzMzk4NCw2Ljk5ODUxMTc5MTIyOTI0OCwtNDM3LjgzOTY2MDY0NDUzMTI1XX0seyJtZXNoIjoxNywibmFtZSI6IjEwMDE2IE1pZGRsZXRvd24iLCJ0cmFuc2xhdGlvbiI6WzgwLjY0ODQ5MDkwNTc2MTcyLDguNDM2OTkyNjQ1MjYzNjcyLC00MzYuMjI3Mjk0OTIxODc1XX0seyJtZXNoIjoyNiwibmFtZSI6IjEwMDMxIEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxNTAuNDMwNTI2NzMzMzk4NDQsNS44NDAwNDIxMTQyNTc4MTI1LC00NTUuNjI0OTA4NDQ3MjY1Nl19LHsibWVzaCI6MjIsIm5hbWUiOiIxMDAyOSBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTQ0LjA0MjAzNzk2Mzg2NzIsOC4wMzM2MjA4MzQzNTA1ODYsLTQ1Ny4xNzEyOTUxNjYwMTU2XX0seyJtZXNoIjoyMSwibmFtZSI6IjEwMDI3IEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxMzUuNTg5NzM2OTM4NDc2NTYsNS43MzEzOTMzMzcyNDk3NTYsLTQ1Ni4zOTMwMzU4ODg2NzE5XX0seyJtZXNoIjoyMCwibmFtZSI6IjEwMDI1IEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxMjUuNTE2MjIwMDkyNzczNDQsNS4yMTI0ODM4ODI5MDQwNTMsLTQ1OC4zNDE2NDQyODcxMDk0XX0seyJtZXNoIjoxOSwibmFtZSI6IjEwMDIzIEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxMTMuNTI0MzQ1Mzk3OTQ5MjIsNi41Njc2NTUwODY1MTczMzQsLTQ1NS45NTA4OTcyMTY3OTY5XX0seyJtZXNoIjoxOCwibmFtZSI6IjEwMDIxIEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxMDUuMTE0ODE0NzU4MzAwNzgsNS42Mjg0MTA4MTYxOTI2MjcsLTQ1NS45MDc5Mjg0NjY3OTY5XX0seyJtZXNoIjoyNSwibmFtZSI6IjEwMDE5IEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOls5My43NzcwMzA5NDQ4MjQyMiw2Ljk5ODUxMTc5MTIyOTI0OCwtNDUzLjY4ODAxODc5ODgyODFdfSx7Im1lc2giOjE3LCJuYW1lIjoiMTAwMTcgQXJjaGFpZGUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzgxLjg1MzIxODA3ODYxMzI4LDguNDM2OTkyNjQ1MjYzNjcyLC00NTUuMzAwMzg0NTIxNDg0NF19LHsibWVzaCI6MjQsIm5hbWUiOiIxMDAzNSBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTY1Ljc1NDc0NTQ4MzM5ODQ0LDQuMDM0NDk1ODMwNTM1ODg5LC00NTcuMjU2NTYxMjc5Mjk2OV19LHsibWVzaCI6MjMsIm5hbWUiOiIxMDAzMyBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTU3LjcxMDcwODYxODE2NDA2LDYuODk2NzkwOTgxMjkyNzI1LC00NTcuMzIzMTUwNjM0NzY1Nl19LHsibWVzaCI6MjEsIm5hbWUiOiIxMDA2NyBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMzIzLjMxMTIxODI2MTcxODc1LDUuNzMxMzkzMzM3MjQ5NzU2LC00NTYuMzkzMDM1ODg4NjcxOV19LHsibWVzaCI6MjAsIm5hbWUiOiIxMDA2NSBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMzEzLjIzNzczMTkzMzU5Mzc1LDUuMjEyNDgzODgyOTA0MDUzLC00NTguMzQxNjQ0Mjg3MTA5NF19LHsibWVzaCI6MTksIm5hbWUiOiIxMDA2MyBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMzAxLjI0NTg0OTYwOTM3NSw2LjU2NzY1NTA4NjUxNzMzNCwtNDU1Ljk1MDg5NzIxNjc5NjldfSx7Im1lc2giOjE4LCJuYW1lIjoiMTAwNjEgQXJjaGFpZGUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzI5Mi44MzYzMDM3MTA5Mzc1LDUuNjI4NDEwODE2MTkyNjI3LC00NTUuOTA3OTI4NDY2Nzk2OV19LHsibWVzaCI6MjUsIm5hbWUiOiIxMDA1OSBBcmNoYWlkZSIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMjgxLjQ5ODUwNDYzODY3MTksNi45OTg1MTE3OTEyMjkyNDgsLTQ1My42ODgwMTg3OTg4MjgxXX0seyJtZXNoIjoxNywibmFtZSI6IjEwMDUzIEFyY2hhaWRlIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsyNTEuMDc3NDg0MTMwODU5MzgsOC40MzY5OTI2NDUyNjM2NzIsLTQ1NS4zMDAzODQ1MjE0ODQ0XX0seyJtZXNoIjoyNiwibmFtZSI6IlN0YWNrIDEwMDQyIiwidHJhbnNsYXRpb24iOlsxOTkuNzkyNjc4ODMzMDA3OCw1Ljg0MDA0MjExNDI1NzgxMjUsLTM5Mi40NTk0NzI2NTYyNV19LHsibWVzaCI6MjIsIm5hbWUiOiJTdGFjayAxMDA0NCIsInRyYW5zbGF0aW9uIjpbMjA2LjE4MTE2NzYwMjUzOTA2LDguMDMzNjIwODM0MzUwNTg2LC0zOTAuOTEzMDg1OTM3NV19LHsibWVzaCI6MjEsIm5hbWUiOiJTdGFjayAxMDA0NiIsInRyYW5zbGF0aW9uIjpbMjE0LjYzMzQ2ODYyNzkyOTcsNS43MzEzOTMzMzcyNDk3NTYsLTM5MS42OTEzNDUyMTQ4NDM3NV19LHsibWVzaCI6MjAsIm5hbWUiOiJTdGFjayAxMDA0OCIsInRyYW5zbGF0aW9uIjpbMjI0LjcwNjk4NTQ3MzYzMjgsNS4yMTI0ODM4ODI5MDQwNTMsLTM4OS43NDI3MzY4MTY0MDYyNV19LHsibWVzaCI6MTksIm5hbWUiOiJTdGFjayAxMDA1MCIsInRyYW5zbGF0aW9uIjpbMjM2LjY5ODg1MjUzOTA2MjUsNi41Njc2NTUwODY1MTczMzQsLTM5Mi4xMzM0ODM4ODY3MTg3NV19LHsibWVzaCI6MTgsIm5hbWUiOiJTdGFjayAxMDA1MiIsInRyYW5zbGF0aW9uIjpbMjQ1LjEwODM4MzE3ODcxMDk0LDUuNjI4NDEwODE2MTkyNjI3LC0zOTIuMTc2NDUyNjM2NzE4NzVdfSx7Im1lc2giOjI1LCJuYW1lIjoiU3RhY2sgMTAwNTQiLCJ0cmFuc2xhdGlvbiI6WzI1Ni40NDYxNjY5OTIxODc1LDYuOTk4NTExNzkxMjI5MjQ4LC0zOTQuMzk2MzYyMzA0Njg3NV19LHsibWVzaCI6MjQsIm5hbWUiOiJTdGFjayAxMDAzOCIsInRyYW5zbGF0aW9uIjpbMTg0LjQ2ODQ2MDA4MzAwNzgsNC4wMzQ0OTU4MzA1MzU4ODksLTM5MC44Mjc4MTk4MjQyMTg3NV19LHsibWVzaCI6MjMsIm5hbWUiOiJTdGFjayAxMDA0MCIsInRyYW5zbGF0aW9uIjpbMTkyLjUxMjQ5Njk0ODI0MjIsNi44OTY3OTA5ODEyOTI3MjUsLTM5MC43NjEyMzA0Njg3NV19LHsibWVzaCI6MjYsIm5hbWUiOiJTdGFjayAxMDAwMiIsInRyYW5zbGF0aW9uIjpbMTIuMDcxMjMyNzk1NzE1MzMyLDUuODQwMDQyMTE0MjU3ODEyNSwtMzkyLjQ1OTQ3MjY1NjI1XX0seyJtZXNoIjoyMiwibmFtZSI6IlN0YWNrIDEwMDA0IiwidHJhbnNsYXRpb24iOlsxOC40NTk2ODQzNzE5NDgyNDIsOC4wMzM2MjA4MzQzNTA1ODYsLTM5MC45MTMwODU5Mzc1XX0seyJtZXNoIjoyMSwibmFtZSI6IlN0YWNrIDEwMDA2IiwidHJhbnNsYXRpb24iOlsyNi45MTIwMTU5MTQ5MTY5OTIsNS43MzEzOTMzMzcyNDk3NTYsLTM5MS42OTEzNDUyMTQ4NDM3NV19LHsibWVzaCI6MjAsIm5hbWUiOiJTdGFjayAxMDAwOCIsInRyYW5zbGF0aW9uIjpbMzYuOTg1NTA0MTUwMzkwNjI1LDUuMjEyNDgzODgyOTA0MDUzLC0zODkuNzQyNzM2ODE2NDA2MjVdfSx7Im1lc2giOjE5LCJuYW1lIjoiU3RhY2sgMTAwMTAiLCJ0cmFuc2xhdGlvbiI6WzQ4Ljk3NzM4NjQ3NDYwOTM3NSw2LjU2NzY1NTA4NjUxNzMzNCwtMzkyLjEzMzQ4Mzg4NjcxODc1XX0seyJtZXNoIjoxOCwibmFtZSI6IlN0YWNrIDEwMDEyIiwidHJhbnNsYXRpb24iOls1Ny4zODY5MzIzNzMwNDY4NzUsNS42Mjg0MTA4MTYxOTI2MjcsLTM5Mi4xNzY0NTI2MzY3MTg3NV19LHsibWVzaCI6MjUsIm5hbWUiOiJTdGFjayAxMDAxNCIsInRyYW5zbGF0aW9uIjpbNjguNzI0NjkzMjk4MzM5ODQsNi45OTg1MTE3OTEyMjkyNDgsLTM5NC4zOTYzNjIzMDQ2ODc1XX0seyJtZXNoIjoxNywibmFtZSI6IlN0YWNrIDEwMDE2IiwidHJhbnNsYXRpb24iOls4MC42NDg0OTA5MDU3NjE3Miw4LjQzNjk5MjY0NTI2MzY3MiwtMzkyLjc4Mzk5NjU4MjAzMTI1XX0seyJtZXNoIjoyNiwibmFtZSI6IjEwMDMxIE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzE1MC40MzA1MjY3MzMzOTg0NCw1Ljg0MDA0MjExNDI1NzgxMjUsLTQxMi4xODE2MTAxMDc0MjE5XX0seyJtZXNoIjoyMiwibmFtZSI6IjEwMDM1IE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzE2Ni4xMzAwNjU5MTc5Njg3NSw4LjAzMzYyMDgzNDM1MDU4NiwtNDEzLjcyNzk5NjgyNjE3MTldfSx7Im1lc2giOjIxLCJuYW1lIjoiMTAwMzcgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTc1LjUyMTgyMDA2ODM1OTM4LDUuNzMxMzkzMzM3MjQ5NzU2LC00MTIuOTQ5NzM3NTQ4ODI4MV19LHsibWVzaCI6MjAsIm5hbWUiOiIxMDAyNSBNaWRkbGV0b3duIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxMjUuNTE2MjIwMDkyNzczNDQsNS4yMTI0ODM4ODI5MDQwNTMsLTQxNC44OTgzNDU5NDcyNjU2XX0seyJtZXNoIjoxOSwibmFtZSI6IjEwMDIzIE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzExMy41MjQzNDUzOTc5NDkyMiw2LjU2NzY1NTA4NjUxNzMzNCwtNDEyLjUwNzU5ODg3Njk1MzFdfSx7Im1lc2giOjE4LCJuYW1lIjoiMTAwMjEgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTA1LjExNDgxNDc1ODMwMDc4LDUuNjI4NDEwODE2MTkyNjI3LC00MTIuNDY0NjMwMTI2OTUzMV19LHsibWVzaCI6MjUsIm5hbWUiOiIxMDAxOSBNaWRkbGV0b3duIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOls5My43NzcwMzA5NDQ4MjQyMiw2Ljk5ODUxMTc5MTIyOTI0OCwtNDEwLjI0NDcyMDQ1ODk4NDRdfSx7Im1lc2giOjE3LCJuYW1lIjoiMTAwMTcgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbODEuODUzMjE4MDc4NjEzMjgsOC40MzY5OTI2NDUyNjM2NzIsLTQxMS44NTcwODYxODE2NDA2XX0seyJtZXNoIjoyNCwibmFtZSI6IjEwMDI5IE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzE0NC4xNDg5ODY4MTY0MDYyNSw0LjAzNDQ5NTgzMDUzNTg4OSwtNDEzLjgxMzI2MjkzOTQ1MzFdfSx7Im1lc2giOjIzLCJuYW1lIjoiMTAwMjcgTWlkZGxldG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbMTM1Ljg3OTg4MjgxMjUsNi44OTY3OTA5ODEyOTI3MjUsLTQxMy44Nzk4NTIyOTQ5MjE5XX0seyJtZXNoIjoxNywibmFtZSI6IjEwMDU3IE1pZGRsZXRvd24iLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzI2OS41NzQ3MDcwMzEyNSw4LjQzNjk5MjY0NTI2MzY3MiwtNDExLjg1NzA4NjE4MTY0MDZdfSx7Im1lc2giOjI0LCJuYW1lIjoiMTAwMzggVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwtMC4yODIwOTg2MjExMjk5ODk2LDAsMC45NTkzODU0NTQ2NTQ2OTM2XSwidHJhbnNsYXRpb24iOlsxODEuNzI4MzAyMDAxOTUzMTIsNC4wMzQ0OTU4MzA1MzU4ODksLTMxMy4yMDE5MDQyOTY4NzVdfSx7Im1lc2giOjI2LCJuYW1lIjoiMTAwMDIgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwtMC4wNDEyMDIyMzk2OTIyMTExNSwwLDAuOTk5MTUwODEyNjI1ODg1XSwidHJhbnNsYXRpb24iOlsxMS4zMzE3MTM2NzY0NTI2MzcsNS44NDAwNDIxMTQyNTc4MTI1LC0zNTcuNzEzNTMxNDk0MTQwNl19LHsibWVzaCI6MjIsIm5hbWUiOiIxMDAwNCBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjA0MTIwMjIzOTY5MjIxMTE1LDAsMC45OTkxNTA4MTI2MjU4ODVdLCJ0cmFuc2xhdGlvbiI6WzE3LjU3MTE0OTgyNjA0OTgwNSw4LjAzMzYyMDgzNDM1MDU4NiwtMzU1LjY0NjM5MjgyMjI2NTZdfSx7Im1lc2giOjIxLCJuYW1lIjoiMTAwMDYgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwtMC4wNDEyMDIyMzk2OTIyMTExNSwwLDAuOTk5MTUwODEyNjI1ODg1XSwidHJhbnNsYXRpb24iOlsyNi4wNTg4NjA3Nzg4MDg1OTQsNS43MzEzOTMzMzcyNDk3NTYsLTM1NS43MjYwNzQyMTg3NV19LHsibWVzaCI6MjAsIm5hbWUiOiIxMDAwOCBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjA0MTIwMjIzOTY5MjIxMTE1LDAsMC45OTkxNTA4MTI2MjU4ODVdLCJ0cmFuc2xhdGlvbiI6WzM1LjkzNzcwOTgwODM0OTYxLDUuMjEyNDgzODgyOTA0MDUzLC0zNTIuOTU0NjgxMzk2NDg0NF19LHsibWVzaCI6MTksIm5hbWUiOiIxMDAxMCBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjA0MTIwMjIzOTY5MjIxMTE1LDAsMC45OTkxNTA4MTI2MjU4ODVdLCJ0cmFuc2xhdGlvbiI6WzQ4LjA4NTcyMDA2MjI1NTg2LDYuNTY3NjU1MDg2NTE3MzM0LC0zNTQuMzQ5OTc1NTg1OTM3NV19LHsibWVzaCI6MTgsIm5hbWUiOiIxMDAxMiBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjA4NjE3MzAyMDMwMzI0OTM2LDAsMC45OTYyODAxOTMzMjg4NTc0XSwidHJhbnNsYXRpb24iOls1Ny43MDYxOTIwMTY2MDE1Niw1LjYyODQxMDgxNjE5MjYyNywtMzUyLjk1MzEyNV19LHsibWVzaCI6MjUsIm5hbWUiOiIxMDAxNCBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjA4NjE3MzAyMDMwMzI0OTM2LDAsMC45OTYyODAxOTMzMjg4NTc0XSwidHJhbnNsYXRpb24iOls2OS4yNTY3MzY3NTUzNzExLDYuOTk4NTExNzkxMjI5MjQ4LC0zNTMuMTkzMzI4ODU3NDIxOV19LHsibWVzaCI6MTcsIm5hbWUiOiIxMDAxNiBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLC0wLjA4NjE3MzAyMDMwMzI0OTM2LDAsMC45OTYyODAxOTMzMjg4NTc0XSwidHJhbnNsYXRpb24iOls4MC43MjY2MDA2NDY5NzI2Niw4LjQzNjk5MjY0NTI2MzY3MiwtMzQ5LjU1NzQ5NTExNzE4NzVdfSx7Im1lc2giOjI2LCJuYW1lIjoiU3RhY2sgMTAwMzEiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzE1MC40MzA1MjY3MzMzOTg0NCw1Ljg0MDA0MjExNDI1NzgxMjUsLTM3My4yNzM0MDY5ODI0MjE5XX0seyJtZXNoIjoyMiwibmFtZSI6IlN0YWNrIDEwMDI5Iiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxNDQuMDQyMDM3OTYzODY3Miw4LjAzMzYyMDgzNDM1MDU4NiwtMzc0LjgxOTc5MzcwMTE3MTldfSx7Im1lc2giOjIxLCJuYW1lIjoiU3RhY2sgMTAwMjciLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzEzNS41ODk3MzY5Mzg0NzY1Niw1LjczMTM5MzMzNzI0OTc1NiwtMzc0LjA0MTUzNDQyMzgyODFdfSx7Im1lc2giOjIwLCJuYW1lIjoiU3RhY2sgMTAwMjUiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzEyNS41MTYyMjAwOTI3NzM0NCw1LjIxMjQ4Mzg4MjkwNDA1MywtMzc1Ljk5MDE0MjgyMjI2NTZdfSx7Im1lc2giOjE5LCJuYW1lIjoiU3RhY2sgMTAwMjMiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzExMy41MjQzNDUzOTc5NDkyMiw2LjU2NzY1NTA4NjUxNzMzNCwtMzczLjU5OTM5NTc1MTk1MzFdfSx7Im1lc2giOjE4LCJuYW1lIjoiU3RhY2sgMTAwMjEiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzEwNS4xMTQ4MTQ3NTgzMDA3OCw1LjYyODQxMDgxNjE5MjYyNywtMzczLjU1NjQyNzAwMTk1MzFdfSx7Im1lc2giOjI1LCJuYW1lIjoiU3RhY2sgMTAwMTkiLCJyb3RhdGlvbiI6WzAsLTEsMCw0Ljg4NzYyMDU0ODI4ODM5NmUtMDddLCJ0cmFuc2xhdGlvbiI6WzkzLjc3NzAzMDk0NDgyNDIyLDYuOTk4NTExNzkxMjI5MjQ4LC0zNzEuMzM2NTE3MzMzOTg0NF19LHsibWVzaCI6MTcsIm5hbWUiOiJTdGFjayAxMDAxNyIsInJvdGF0aW9uIjpbMCwtMSwwLDQuODg3NjIwNTQ4Mjg4Mzk2ZS0wN10sInRyYW5zbGF0aW9uIjpbODEuODUzMjE4MDc4NjEzMjgsOC40MzY5OTI2NDUyNjM2NzIsLTM3Mi45NDg4ODMwNTY2NDA2XX0seyJtZXNoIjoyNCwibmFtZSI6IlN0YWNrIDEwMDM1Iiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxNjUuNzU0NzQ1NDgzMzk4NDQsNC4wMzQ0OTU4MzA1MzU4ODksLTM3NC45MDUwNTk4MTQ0NTMxXX0seyJtZXNoIjoyMywibmFtZSI6IlN0YWNrIDEwMDMzIiwicm90YXRpb24iOlswLC0xLDAsNC44ODc2MjA1NDgyODgzOTZlLTA3XSwidHJhbnNsYXRpb24iOlsxNTcuNzEwNzA4NjE4MTY0MDYsNi44OTY3OTA5ODEyOTI3MjUsLTM3NC45NzE2NDkxNjk5MjE5XX0seyJtZXNoIjoxNywibmFtZSI6IkxhcyBQYW5jaGFuaWEiLCJyb3RhdGlvbiI6WzAsMC4zODcxNzg5ODcyNjQ2MzMyLDAsMC45MjIwMDQ1ODA0OTc3NDE3XSwidHJhbnNsYXRpb24iOlsxOTIuMDg2MzgwMDA0ODgyOCw4LjQzNjk5MjY0NTI2MzY3MiwtMzIyLjEzNTA0MDI4MzIwMzFdfSx7Im1lc2giOjI2LCJuYW1lIjoiMTAwMzEgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwwLjk3OTY3MjkwODc4Mjk1OSwwLDAuMjAwNjAxNjIyNDYyMjcyNjRdLCJ0cmFuc2xhdGlvbiI6WzE1MS4wNjYwMDk1MjE0ODQzOCw1Ljg0MDA0MjExNDI1NzgxMjUsLTI5Ni41ODc3OTkwNzIyNjU2XX0seyJtZXNoIjoyMiwibmFtZSI6IjEwMDI5IFZpZXcgUG9pbnQiLCJyb3RhdGlvbiI6WzAsMC45Nzk2NzI5MDg3ODI5NTksMCwwLjIwMDYwMTYyMjQ2MjI3MjY0XSwidHJhbnNsYXRpb24iOlsxNDUuNzk5NDk5NTExNzE4NzUsOC4wMzM2MjA4MzQzNTA1ODYsLTMwMC41MjA3MjE0MzU1NDY5XX0seyJtZXNoIjoyMSwibmFtZSI6IjEwMDI3IFZpZXcgUG9pbnQiLCJyb3RhdGlvbiI6WzAsMC45Nzk2NzI5MDg3ODI5NTksMCwwLjIwMDYwMTYyMjQ2MjI3MjY0XSwidHJhbnNsYXRpb24iOlsxMzcuNzIxNTQyMzU4Mzk4NDQsNS43MzEzOTMzMzcyNDk3NTYsLTMwMy4xMjcyNTgzMDA3ODEyNV19LHsibWVzaCI6MjAsIm5hbWUiOiIxMDAyNSBWaWV3IFBvaW50Iiwicm90YXRpb24iOlswLDAuOTg5OTQxNTk2OTg0ODYzMywwLDAuMTQxNDc3MjEyMzA5ODM3MzRdLCJ0cmFuc2xhdGlvbiI6WzEyNy4zOTA4NTM4ODE4MzU5NCw1LjIxMjQ4Mzg4MjkwNDA1MywtMzA4LjcxMDA4MzAwNzgxMjVdfSx7Im1lc2giOjE5LCJuYW1lIjoiMTAwMjMgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwwLjk4OTk0MTU5Njk4NDg2MzMsMCwwLjE0MTQ3NzIxMjMwOTgzNzM0XSwidHJhbnNsYXRpb24iOlsxMTUuMjA5MzczNDc0MTIxMSw2LjU2NzY1NTA4NjUxNzMzNCwtMzA5Ljc3NDA3ODM2OTE0MDZdfSx7Im1lc2giOjE4LCJuYW1lIjoiMTAwMjEgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwwLjk4OTk0MTU5Njk4NDg2MzMsMCwwLjE0MTQ3NzIxMjMwOTgzNzM0XSwidHJhbnNsYXRpb24iOlsxMDcuMTI0NDUwNjgzNTkzNzUsNS42Mjg0MTA4MTYxOTI2MjcsLTMxMi4wODg0MDk0MjM4MjgxXX0seyJtZXNoIjoyNSwibmFtZSI6IjEwMDE5IFZpZXcgUG9pbnQiLCJyb3RhdGlvbiI6WzAsMC45ODk5NDE1OTY5ODQ4NjMzLDAsMC4xNDE0NzcyMTIzMDk4MzczNF0sInRyYW5zbGF0aW9uIjpbOTUuNjE4NzI4NjM3Njk1MzEsNi45OTg1MTE3OTEyMjkyNDgsLTMxMy4xMzMxNzg3MTA5Mzc1XX0seyJtZXNoIjoxNywibmFtZSI6IjEwMDE3IFZpZXcgUG9pbnQiLCJyb3RhdGlvbiI6WzAsMC45OTc3MjM4Nzc0Mjk5NjIyLDAsMC4wNjc0MzI2NzE3ODUzNTQ2MV0sInRyYW5zbGF0aW9uIjpbODMuODM5NDE2NTAzOTA2MjUsOC40MzY5OTI2NDUyNjM2NzIsLTMxOS4wMzQ3NTk1MjE0ODQ0XX0seyJtZXNoIjoyNCwibmFtZSI6IjEwMDM1IFZpZXcgUG9pbnQiLCJyb3RhdGlvbiI6WzAsMC45Nzk2NzI5MDg3ODI5NTksMCwwLjIwMDYwMTYyMjQ2MjI3MjY0XSwidHJhbnNsYXRpb24iOlsxNjUuNzk4MjE3NzczNDM3NSw0LjAzNDQ5NTgzMDUzNTg4OSwtMjkyLjA2NDk3MTkyMzgyODFdfSx7Im1lc2giOjIzLCJuYW1lIjoiMTAwMzMgVmlldyBQb2ludCIsInJvdGF0aW9uIjpbMCwwLjk3OTY3MjkwODc4Mjk1OSwwLDAuMjAwNjAxNjIyNDYyMjcyNjRdLCJ0cmFuc2xhdGlvbiI6WzE1OC40Mjc3NDk2MzM3ODkwNiw2Ljg5Njc5MDk4MTI5MjcyNSwtMjk1LjI4NzkwMjgzMjAzMTI1XX0seyJtZXNoIjoxOCwibmFtZSI6Ik51IEJheSIsInJvdGF0aW9uIjpbMCwtMC4wNzQ4OTExNDk5OTc3MTExOCwwLDAuOTk3MTkxNzI3MTYxNDA3NV0sInRyYW5zbGF0aW9uIjpbMTcuNTY1OTE3OTY4NzUsNS42Mjg0MTA4MTYxOTI2MjcsLTI4My41NzkxMzIwODAwNzgxXX0seyJtZXNoIjoyNSwibmFtZSI6Ik11IEJheSIsInJvdGF0aW9uIjpbMCwtMC4wNzQ4OTExNDk5OTc3MTExOCwwLDAuOTk3MTkxNzI3MTYxNDA3NV0sInRyYW5zbGF0aW9uIjpbMjkuMTA4MDYyNzQ0MTQwNjI1LDYuOTk4NTExNzkxMjI5MjQ4LC0yODQuMDgwNzE4OTk0MTQwNl19LHsibWVzaCI6MTcsIm5hbWUiOiJMYW1iYWRhIEJheSIsInJvdGF0aW9uIjpbMCwtMC4wNzQ4OTExNDk5OTc3MTExOCwwLDAuOTk3MTkxNzI3MTYxNDA3NV0sInRyYW5zbGF0aW9uIjpbNDAuNjU3MjkxNDEyMzUzNTE2LDguNDM2OTkyNjQ1MjYzNjcyLC0yODAuNzA1NDQ0MzM1OTM3NV19LHsibWVzaCI6MzMsIm5hbWUiOiJUaGUgSG91c2Ugb2YgU2VjcmV0cyIsInJvdGF0aW9uIjpbMCwtMC4yMDMyOTk0NjI3OTUyNTc1NywwLDAuOTc5MTE2NjE4NjMzMjcwM10sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy0xNDcuMDM5MTM4NzkzOTQ1Myw0LjIxODc4NzY3MDEzNTQ5OCwyOTYuMDYyNTMwNTE3NTc4MV19LHsibWVzaCI6MzQsIm5hbWUiOiJNYWZmZWkgMSIsInJvdGF0aW9uIjpbMCwwLjE1Njk3MzM3Njg3MDE1NTMzLDAsMC45ODc2MDI4Mjk5MzMxNjY1XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOls4MS42MDQwMTE1MzU2NDQ1Myw0LjIxODc4NzY3MDEzNTQ5OCwzMTUuNjUwOTM5OTQxNDA2MjVdfSx7Im1lc2giOjM1LCJuYW1lIjoiTG9ja3dvb2QgTWFubm9yIiwicm90YXRpb24iOlswLC0wLjEyNDI1NjE1NjM4NDk0NDkyLDAsMC45OTIyNTAxNDQ0ODE2NTg5XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOlstODEuNzk1NjY5NTU1NjY0MDYsNC4yMTg3ODc2NzAxMzU0OTgsMzEyLjQzNzk4ODI4MTI1XX0seyJtZXNoIjozNiwibmFtZSI6IlBpb25lZXIgMTAiLCJyb3RhdGlvbiI6WzAsMC4yMTcwNTk5NTUwMDA4NzczOCwwLDAuOTc2MTU4MzIwOTAzNzc4MV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzE0My4xMDcxNDcyMTY3OTY4OCw0LjIxODc4NzY3MDEzNTQ5OCwyODkuNjA5NzcxNzI4NTE1Nl19LHsibWVzaCI6MzcsIm5hbWUiOiJUaGUgQmV0YSIsInJvdGF0aW9uIjpbMCwtMC4wNDI2MzYwMTgyNDY0MTIyOCwwLDAuOTk5MDkwNjcxNTM5MzA2Nl0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy02NS4xODMxMjgzNTY5MzM2LDQuMjE4Nzg3NjcwMTM1NDk4LDMxNi44Njc3OTc4NTE1NjI1XX0seyJtZXNoIjozOCwibmFtZSI6IkRhcnVuaWEiLCJyb3RhdGlvbiI6WzAsMC4yMTcwNTk5NTUwMDA4NzczOCwwLDAuOTc2MTU4MzIwOTAzNzc4MV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzE1NS40Mjc4ODY5NjI4OTA2Miw0LjIxODc4NzY3MDEzNTQ5OCwyODUuMjExMzAzNzEwOTM3NV19LHsibWVzaCI6MzksIm5hbWUiOiJUaGUgSG91c2Ugb2YgR3JpZmZpbiIsInJvdGF0aW9uIjpbMCwtMC4yMDMyOTk0NjI3OTUyNTc1NywwLDAuOTc5MTE2NjE4NjMzMjcwM10sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy0xMzcuNDk2NDc1MjE5NzI2NTYsNC4yMTg3ODc2NzAxMzU0OTgsMjk4LjQ4MzgyNTY4MzU5Mzc1XX0seyJtZXNoIjo0MCwibmFtZSI6IlRoZSBCbGFjayBQZWFybCBTdGF0aW9uIiwicm90YXRpb24iOlswLDAuMTU2OTczMzc2ODcwMTU1MzMsMCwwLjk4NzYwMjgyOTkzMzE2NjVdLCJzY2FsZSI6WzEuMDk5OTk5OTA0NjMyNTY4NCwxLjEwMDAwMDAyMzg0MTg1OCwxLjA5OTk5OTkwNDYzMjU2ODRdLCJ0cmFuc2xhdGlvbiI6WzkwLjM1MzU5OTU0ODMzOTg0LDQuMjE4Nzg3NjcwMTM1NDk4LDMxMS4xMzc3ODY4NjUyMzQ0XX0seyJtZXNoIjo0MSwibmFtZSI6IlBvcnRhbCBUTDEyIiwicm90YXRpb24iOlswLC0wLjEyNDI1NjE1NjM4NDk0NDkyLDAsMC45OTIyNTAxNDQ0ODE2NTg5XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOlstMTE0LjAzODM2ODIyNTA5NzY2LDQuMjE4Nzg3NjcwMTM1NDk4LDMwNC45Mjc3MDM4NTc0MjE5XX0seyJtZXNoIjo0MiwibmFtZSI6IlRoZSBHaGV0dG8iLCJyb3RhdGlvbiI6WzAsMC4xNTY5NzMzNzY4NzAxNTUzMywwLDAuOTg3NjAyODI5OTMzMTY2NV0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbMTExLjE5ODY1NDE3NDgwNDY5LDQuMjE4Nzg3NjcwMTM1NDk4LDMwMi42ODkzOTIwODk4NDM3NV19LHsibWVzaCI6NDMsIm5hbWUiOiJMYXZlbmRlciBIb3VzZSIsInJvdGF0aW9uIjpbMCwtMC4xMjQyNTYxNTYzODQ5NDQ5MiwwLDAuOTkyMjUwMTQ0NDgxNjU4OV0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbLTkwLjQxMzI2MTQxMzU3NDIyLDQuMjE4Nzg3NjcwMTM1NDk4LDMxMi43OTg1MjI5NDkyMTg3NV19LHsibWVzaCI6NDQsIm5hbWUiOiJQaG9lbml4IExhbmRpbmciLCJyb3RhdGlvbiI6WzAsMC4yMTcwNTk5NTUwMDA4NzczOCwwLDAuOTc2MTU4MzIwOTAzNzc4MV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzEzNi42NzE3Mzc2NzA4OTg0NCw0LjIxODc4NzY3MDEzNTQ5OCwyOTUuMzUyMzg2NDc0NjA5NF19LHsibWVzaCI6NDUsIm5hbWUiOiJHYXJsaW5nIGhvdXNlIiwicm90YXRpb24iOlswLC0wLjEyNDI1NjE1NjM4NDk0NDkyLDAsMC45OTIyNTAxNDQ0ODE2NTg5XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOlstMTAxLjg5ODAxMDI1MzkwNjI1LDQuMjE4Nzg3NjcwMTM1NDk4LDMwOC40ODg2NDc0NjA5Mzc1XX0seyJtZXNoIjo0NiwibmFtZSI6IlRoZSBCdXJyb3ciLCJyb3RhdGlvbiI6WzAsMC4xNTY5NzMzNzY4NzAxNTUzMywwLDAuOTg3NjAyODI5OTMzMTY2NV0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbMTIzLjM2MDkwMDg3ODkwNjI1LDQuMjE4Nzg3NjcwMTM1NDk4LDI5OS4yMDM5Nzk0OTIxODc1XX0seyJtZXNoIjo0NywibmFtZSI6Ik11bHRpaXZlcnNlIiwicm90YXRpb24iOlswLC0wLjIwMzI5OTQ2Mjc5NTI1NzU3LDAsMC45NzkxMTY2MTg2MzMyNzAzXSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbLTEyNi4zODU5NTU4MTA1NDY4OCw0LjIxODc4NzY3MDEzNTQ5OCwzMDEuMDU3NzY5Nzc1MzkwNl19LHsibWVzaCI6NDgsIm5hbWUiOiJNaXJrd29vZCBQbGFjZSIsInJvdGF0aW9uIjpbMCwwLjE1Njk3MzM3Njg3MDE1NTMzLDAsMC45ODc2MDI4Mjk5MzMxNjY1XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOlsxMDAuMzc4MzQ5MzA0MTk5MjIsNC4yMTg3ODc2NzAxMzU0OTgsMzA1LjY5OTU1NDQ0MzM1OTRdfSx7Im1lc2giOjQ5LCJuYW1lIjoiU3BhY2UgY2VudHJlIiwidHJhbnNsYXRpb24iOlstMTc1LjA0MzczMTY4OTQ1MzEyLDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0MDEuMDUxODE4ODQ3NjU2MjVdfSx7Im1lc2giOjUwLCJuYW1lIjoiVGhlIFVuZGVyd29ybGQiLCJ0cmFuc2xhdGlvbiI6WzE4OS4yMzE1MjE2MDY0NDUzLDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0ODguNjgyNDM0MDgyMDMxMjVdfSx7Im1lc2giOjUxLCJuYW1lIjoiVGhlIExlZnRvcml1bSIsInRyYW5zbGF0aW9uIjpbMTIzLjk2Nzc0MjkxOTkyMTg4LDMuOTI1Nzg5ODMzMDY4ODQ3NywzOTYuMDA1NDYyNjQ2NDg0NF19LHsibWVzaCI6NTIsIm5hbWUiOiJBcmZnYXJkIiwidHJhbnNsYXRpb24iOlstMjIzLjQyNjE3Nzk3ODUxNTYyLDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0ODMuNjM2MTA4Mzk4NDM3NV19LHsibWVzaCI6NTMsIm5hbWUiOiJNZWdhIENvcnAiLCJ0cmFuc2xhdGlvbiI6WzE3My43NTkwNjM3MjA3MDMxMiwzLjkyNTc4OTgzMzA2ODg0NzcsMzgxLjIzNjI2NzA4OTg0Mzc1XX0seyJtZXNoIjo1NCwibmFtZSI6IlRoZSBPYXNpcyIsInRyYW5zbGF0aW9uIjpbLTE3My42MzQ3OTYxNDI1NzgxMiwzLjkyNTc4OTgzMzA2ODg0NzcsNDY4Ljg2Njg4MjMyNDIxODc1XX0seyJtZXNoIjo1NSwibmFtZSI6Ik5lcHR1bmUgU3RhdGlvbiIsInRyYW5zbGF0aW9uIjpbMjE5Ljg4Nzg0NzkwMDM5MDYyLDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0MDEuOTkxOTczODc2OTUzMV19LHsibWVzaCI6NTYsIm5hbWUiOiJXZXN0ZXJvcyBQYXJrIiwidHJhbnNsYXRpb24iOlstMTI3LjUwNjAwNDMzMzQ5NjEsMy45MjU3ODk4MzMwNjg4NDc3LDQ4OS42MjI1NTg1OTM3NV19LHsibWVzaCI6NTcsIm5hbWUiOiJHbGl0enZpbGxlIiwidHJhbnNsYXRpb24iOlstMTQ4Ljk4MjU0Mzk0NTMxMjUsMy45MjU3ODk4MzMwNjg4NDc3LDQwNC4wNDc5MTI1OTc2NTYyNV19LHsibWVzaCI6MzAsIm5hbWUiOiJDaHJvbm9wb2xpcyIsInRyYW5zbGF0aW9uIjpbMjE1LjI5MjgwMDkwMzMyMDMsMy45MjU3ODk4MzMwNjg4NDc3LDQ5MS42Nzg1Mjc4MzIwMzEyNV19LHsibWVzaCI6NTgsIm5hbWUiOiJFbG9uJ3MgUGxhY2UiLCJ0cmFuc2xhdGlvbiI6Wy0xMjEuMjY3NDAyNjQ4OTI1NzgsMy45MjU3ODk4MzMwNjg4NDc3LDM5OS42OTI3Nzk1NDEwMTU2XX0seyJtZXNoIjo1OSwibmFtZSI6Ik9zd2FsZCdzIiwidHJhbnNsYXRpb24iOlsyMzYuOTI2ODM0MTA2NDQ1MywzLjkyNTc4OTgzMzA2ODg0NzcsNDg3LjMyMzM2NDI1NzgxMjVdfSx7Im1lc2giOjYwLCJuYW1lIjoiTmVvIFNlb3VsIiwidHJhbnNsYXRpb24iOlstOTEuMTcyMzcwOTEwNjQ0NTMsMy45MjU3ODk4MzMwNjg4NDc3LDM5OS4zMzc2MTU5NjY3OTY5XX0seyJtZXNoIjo2MSwibmFtZSI6IktpcnJpbiBUb3dlciIsInRyYW5zbGF0aW9uIjpbMjYzLjg1OTU1ODEwNTQ2ODc1LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0ODYuOTY4MjYxNzE4NzVdfSx7Im1lc2giOjYyLCJuYW1lIjoiTmliaXJ1IFRvd2VyIiwidHJhbnNsYXRpb24iOlstNjUuMzIzMDEzMzA1NjY0MDYsMy45MjU3ODk4MzMwNjg4NDc3LDM5Ny40MTY3Nzg1NjQ0NTMxXX0seyJtZXNoIjo2MywibmFtZSI6IkdlbWluaSBUb3dlciIsInRyYW5zbGF0aW9uIjpbMjg1LjkzODY1OTY2Nzk2ODc1LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0ODUuMDQ3MzYzMjgxMjVdfSx7Im1lc2giOjMxLCJuYW1lIjoiSmFydmlzIFRvd2VyIiwidHJhbnNsYXRpb24iOlstMzIuMzk0MzY3MjE4MDE3NTgsMy45MjU3ODk4MzMwNjg4NDc3LDM5Ni4zNzIxOTIzODI4MTI1XX0seyJtZXNoIjo2NCwibmFtZSI6IkdvdGhhbSBUb3dlciIsInRyYW5zbGF0aW9uIjpbMzEzLjM5NDIyNjA3NDIxODc1LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0ODQuMDAyODA3NjE3MTg3NV19LHsibWVzaCI6NjUsIm5hbWUiOiJTYWdpdHRhcml1cyBBIiwidHJhbnNsYXRpb24iOlszMS44MzY1Mjg3NzgwNzYxNzIsMy45MjU3ODk4MzMwNjg4NDc3LDM5NS4yNTgxNDgxOTMzNTk0XX0seyJtZXNoIjo2NiwibmFtZSI6IlRpdGFudXMiLCJ0cmFuc2xhdGlvbiI6WzM0OC4yNjA1NTkwODIwMzEyNSwzLjkyNTc4OTgzMzA2ODg0NzcsNDgyLjg4ODc5Mzk0NTMxMjVdfSx7Im1lc2giOjY3LCJuYW1lIjoiQXBvbGxvIDMxIiwidHJhbnNsYXRpb24iOls2OC4xNjMxOTI3NDkwMjM0NCwzLjkyNTc4OTgzMzA2ODg0NzcsMzk5LjgzNDY1NTc2MTcxODc1XX0seyJtZXNoIjo2OCwibmFtZSI6Ik5ldGhlciBGb3J0cmVzcyAxNyIsInRyYW5zbGF0aW9uIjpbNDMzLjY3Mjc5MDUyNzM0Mzc1LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0ODcuNDY1MjcwOTk2MDkzNzVdfSx7Im1lc2giOjY5LCJuYW1lIjoiVGhlIFRvd2VyIG9mIEJhYmVsIiwidHJhbnNsYXRpb24iOls5NC4yNzk2MzI1NjgzNTkzOCwzLjkyNTc4OTgzMzA2ODg0NzcsMzk5LjgwNjQ4ODAzNzEwOTRdfSx7Im1lc2giOjI5LCJuYW1lIjoiVGhlIGxpZ2h0aG91c2UiLCJ0cmFuc2xhdGlvbiI6WzQ2MS43NzQxMDg4ODY3MTg3NSwzLjkyNTc4OTgzMzA2ODg0NzcsNDg3LjQzNzEzMzc4OTA2MjVdfSx7Im1lc2giOjcwLCJuYW1lIjoiVXRvcGlhIiwic2NhbGUiOlsxMC4wNjA0MzgxNTYxMjc5MywxMC4wNjA0MzgxNTYxMjc5MywxMC4wNjA0MzgxNTYxMjc5M10sInRyYW5zbGF0aW9uIjpbLTM4My4zMTUxODU1NDY4NzUsMy45MjU3ODk4MzMwNjg4NDc3LDQwNC44MDg2ODUzMDI3MzQ0XX0seyJtZXNoIjo3MSwibmFtZSI6IldhbmRhbGFuZCIsInNjYWxlIjpbOS43ODE4MDc4OTk0NzUwOTgsOS43ODE4MDc4OTk0NzUwOTgsOS43ODE4MDc4OTk0NzUwOThdLCJ0cmFuc2xhdGlvbiI6Wy0yNzkuMjM4NzM5MDEzNjcxOSwxMC4xODQ3OTcyODY5ODczMDUsNDAyLjEyMzUwNDYzODY3MTldfSx7Im1lc2giOjcyLCJuYW1lIjoiRmlyZWZseSBTdGF0aW9uIiwicm90YXRpb24iOlswLDAuMDE0Mzc0OTcyMzIxMDkzMDgyLDAsMC45OTk4OTY3MDUxNTA2MDQyXSwic2NhbGUiOls2LjM0NzAxODI0MTg4MjMyNCwzLjE3OTM1OTQzNjAzNTE1NjIsNi4zNDcwMTgyNDE4ODIzMjRdLCJ0cmFuc2xhdGlvbiI6WzQwLjE2NDE3Njk0MDkxNzk3LDcuMDYyOTUzNDcyMTM3NDUxLDMxOC43NDQ1Njc4NzEwOTM3NV19LHsibWVzaCI6NzMsIm5hbWUiOiJSaWRnZWxhbmQgVG93ZXIiLCJzY2FsZSI6WzQuMDA2MzI2MTk4NTc3ODgxLDQuMDA2MzI2MTk4NTc3ODgxLDQuMDA2MzI2MTk4NTc3ODgxXSwidHJhbnNsYXRpb24iOlstMjQ3Ljg2MjE1MjA5OTYwOTM4LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0MDYuOTA5NjM3NDUxMTcxOV19LHsibWVzaCI6NzQsIm5hbWUiOiJGcm9vcHlsYW5kIFdvcmxkIiwicm90YXRpb24iOlswLDAuMDE0Mzc0OTcwNDU4NDQ3OTMzLDAsMC45OTk4OTY3MDUxNTA2MDQyXSwic2NhbGUiOls0Ljc0ODE3NTYyMTAzMjcxNSw0Ljc0ODE3NTYyMTAzMjcxNSw0Ljc0ODE3NTYyMTAzMjcxNV0sInRyYW5zbGF0aW9uIjpbMjQuNTYxMTg3NzQ0MTQwNjI1LDguNjQ2OTMwNjk0NTgwMDc4LDMxOS4yMDk4MDgzNDk2MDk0XX0seyJtZXNoIjo3NSwibmFtZSI6IkNyYW5lIEhvdXNlIiwicm90YXRpb24iOlswLDAuMzYzNDY3NzgyNzM1ODI0NiwwLDAuOTMxNjA2NzY5NTYxNzY3Nl0sInNjYWxlIjpbNC44NzQyNzk5NzU4OTExMTMsNC44NzQyNzk5NzU4OTExMTMsNC44NzQyNzk5NzU4OTExMTNdLCJ0cmFuc2xhdGlvbiI6WzIyMi41MDQyNTcyMDIxNDg0NCw4Ljc4MjQwMDEzMTIyNTU4NiwyNDEuMTk3OTA2NDk0MTQwNjJdfSx7Im1lc2giOjc2LCJuYW1lIjoiVGhlIEFscGhhYmV0cml1bSIsInNjYWxlIjpbOC4zNTgyNDc3NTY5NTgwMDgsOC4zNTgyNDc3NTY5NTgwMDgsOC4zNTgyNDc3NTY5NTgwMDhdLCJ0cmFuc2xhdGlvbiI6Wy0yMDEuMTgzNzc2ODU1NDY4NzUsMTYuMTc2MDc0OTgxNjg5NDUzLDQwMi4yMjU5NTIxNDg0Mzc1XX0seyJtZXNoIjo3NywibmFtZSI6IlNlY3JldCBIaWRlb3V0Iiwic2NhbGUiOlsxMi4xODM3MjQ0MDMzODEzNDgsMTIuMTgzNzI0NDAzMzgxMzQ4LDEyLjE4MzcyNDQwMzM4MTM0OF0sInRyYW5zbGF0aW9uIjpbMjUuNjc3ODI0MDIwMzg1NzQyLDE5LjY0NjI4NDEwMzM5MzU1NSw0ODYuMTcwNTMyMjI2NTYyNV19LHsibWVzaCI6NzgsIm5hbWUiOiJDcm93biBQb2ludCIsInNjYWxlIjpbMTAuMDYwNDM4MTU2MTI3OTMsMTAuMDYwNDM4MTU2MTI3OTMsMTAuMDYwNDM4MTU2MTI3OTNdLCJ0cmFuc2xhdGlvbiI6WzExNi42NTIwNTM4MzMwMDc4MSwzLjkyNTc4OTgzMzA2ODg0NzcsNDkyLjQzOTMzMTA1NDY4NzVdfSx7Im1lc2giOjI4LCJuYW1lIjoiQ2VyZXMgUGxhbmV0YXJpdW0iLCJzY2FsZSI6WzkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4XSwidHJhbnNsYXRpb24iOls2OC4wMDk0NzU3MDgwMDc4MSwxMC4xODQ3OTcyODY5ODczMDUsNDg5Ljc1NDE1MDM5MDYyNV19LHsibWVzaCI6NzksIm5hbWUiOiJUaGUgQXBleCIsInJvdGF0aW9uIjpbMCwtMC4yOTMxNzYyOTMzNzMxMDc5LDAsMC45NTYwNTgzODI5ODc5NzYxXSwic2NhbGUiOls2LjM0NzAxNzc2NTA0NTE2NiwzLjE3OTM1OTQzNjAzNTE1NjIsNi4zNDcwMTc3NjUwNDUxNjZdLCJ0cmFuc2xhdGlvbiI6Wy0xNzkuNjQxMTQzNzk4ODI4MTIsNy4wNjI5NTM0NzIxMzc0NTEsMjczLjI4Mzg3NDUxMTcxODc1XX0seyJtZXNoIjo4MCwibmFtZSI6IktydW1wZiBUb3dlciIsInNjYWxlIjpbNC4wMDYzMjYxOTg1Nzc4ODEsNC4wMDYzMjYxOTg1Nzc4ODEsNC4wMDYzMjYxOTg1Nzc4ODFdLCJ0cmFuc2xhdGlvbiI6Wzk5LjM4NjA2MjYyMjA3MDMxLDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0OTQuNTQwMjgzMjAzMTI1XX0seyJtZXNoIjo4MSwibmFtZSI6IkJlc3BpbiBQbGFjZSIsInJvdGF0aW9uIjpbMCwtMC4zMzM4MDE4NjU1Nzc2OTc3NSwwLDAuOTQyNjQzMjg0Nzk3NjY4NV0sInNjYWxlIjpbNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTVdLCJ0cmFuc2xhdGlvbiI6Wy0yMTQuNTY4MzU5Mzc1LDguNjQ2OTMwNjk0NTgwMDc4LDI1MS41NjYxMzE1OTE3OTY4OF19LHsibWVzaCI6ODIsIm5hbWUiOiJUaGUgQXJrIiwicm90YXRpb24iOlswLDAuMDE0Mzc1MjgwNTg4ODY1MjgsMCwwLjk5OTg5NjcwNTE1MDYwNDJdLCJzY2FsZSI6WzEuMDk5OTk5OTA0NjMyNTY4NCwxLjEwMDAwMDAyMzg0MTg1OCwxLjA5OTk5OTkwNDYzMjU2ODRdLCJ0cmFuc2xhdGlvbiI6WzU2LjEyMDY2MjY4OTIwODk4NCw0LjIxODc4NzY3MDEzNTQ5OCwzMTguNjMxOTg4NTI1MzkwNl19LHsibWVzaCI6ODMsIm5hbWUiOiJDeWdudXMgWC0xIiwicm90YXRpb24iOlswLDAuMjE3MDU5OTU1MDAwODc3MzgsMCwwLjk3NjE1ODMyMDkwMzc3ODFdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsxNjkuODIyODQ1NDU4OTg0MzgsNC4yMTg3ODc2NzAxMzU0OTgsMjc0LjY3NTc1MDczMjQyMTldfSx7Im1lc2giOjg0LCJuYW1lIjoiQW5kcm9tZWRhIExhbmQiLCJyb3RhdGlvbiI6WzAsLTAuMDQyNjM2Mjc1MjkxNDQyODcsMCwwLjk5OTA5MDY3MTUzOTMwNjZdLCJzY2FsZSI6WzQuODc0Mjc5OTc1ODkxMTEzLDQuODc0Mjc5OTc1ODkxMTEzLDQuODc0Mjc5OTc1ODkxMTEzXSwidHJhbnNsYXRpb24iOlstMTguMDIxOTUxNjc1NDE1MDQsOC43ODI0MDAxMzEyMjU1ODYsMzIyLjI5NzE0OTY1ODIwMzFdfSx7Im1lc2giOjg1LCJuYW1lIjoiVmFsbGVzIE1hcmluZXJpcyIsInNjYWxlIjpbOC4zNTgyNDc3NTY5NTgwMDgsOC4zNTgyNDc3NTY5NTgwMDgsOC4zNTgyNDc3NTY5NTgwMDhdLCJ0cmFuc2xhdGlvbiI6WzE2My4wOTE2MjkwMjgzMjAzLDE2LjE3NjA3NDk4MTY4OTQ1Myw0ODkuODU2NTY3MzgyODEyNV19LHsibWVzaCI6ODYsIm5hbWUiOiJQb3dlciBQbGFudCIsInJvdGF0aW9uIjpbMCwwLjAxNDM3NTI4MDU4ODg2NTI4LDAsMC45OTk4OTY3MDUxNTA2MDQyXSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOls2OC40NzQwOTA1NzYxNzE4OCw0LjIxODc4NzY3MDEzNTQ5OCwzMTcuNTI3NTU3MzczMDQ2OV19LHsibWVzaCI6ODcsIm5hbWUiOiJQb3J0YWwgWjExIiwicm90YXRpb24iOlswLC0wLjI5MzE3NTY5NzMyNjY2MDE2LDAsMC45NTYwNTg2MjE0MDY1NTUyXSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbLTE2OC40ODc0ODc3OTI5Njg3NSw0LjIxODc4NzY3MDEzNTQ5OCwyODIuMzk3MjE2Nzk2ODc1XX0seyJtZXNoIjo4OCwibmFtZSI6Iktvb3BhIEJhc2UiLCJyb3RhdGlvbiI6WzAsLTAuMDQyNjM2MDE4MjQ2NDEyMjgsMCwwLjk5OTA5MDY3MTUzOTMwNjZdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlstNDcuNDUwNDI0MTk0MzM1OTQsNC4yMTg3ODc2NzAxMzU0OTgsMzE0LjkyODgzMzAwNzgxMjVdfSx7Im1lc2giOjg5LCJuYW1lIjoiUG9ydGFsIFpYNSIsInJvdGF0aW9uIjpbMCwtMC4yMDMyOTk0NjI3OTUyNTc1NywwLDAuOTc5MTE2NjE4NjMzMjcwM10sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy0xNTYuODU2MDQ4NTgzOTg0MzgsNC4yMTg3ODc2NzAxMzU0OTgsMjg4LjM0MjQ5ODc3OTI5NjldfSx7Im1lc2giOjI3LCJuYW1lIjoiVGhlIEJhc2VtZW50Iiwic2NhbGUiOls5LjE0MTU5ODcwMTQ3NzA1LDkuMTQxNTk4NzAxNDc3MDUsOS4xNDE1OTg3MDE0NzcwNV0sInRyYW5zbGF0aW9uIjpbLTIyNS45NzY4OTgxOTMzNTkzOCw1LjIzNzIyNjk2MzA0MzIxMyw0MDEuOTc4OTczMzg4NjcxOV19LHsibWVzaCI6OTAsIm5hbWUiOiJEcmFnb25zdG9uZSBIZWlnaHRzIiwic2NhbGUiOls5LjE0MTU5ODcwMTQ3NzA1LDkuMTQxNTk4NzAxNDc3MDUsOS4xNDE1OTg3MDE0NzcwNV0sInRyYW5zbGF0aW9uIjpbMTM4LjI5ODQxNjEzNzY5NTMsNS4yMzcyMjY5NjMwNDMyMTMsNDg5LjYwOTYxOTE0MDYyNV19LHsibWVzaCI6OTEsIm5hbWUiOiJGYWxjb24gMjIxIiwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMzcxLjI3MzU5MDA4Nzg5MDYsNC4yMTg3ODc2NzAxMzU0OTgsNDA2LjQwMDUxMjY5NTMxMjVdfSx7Im1lc2giOjkyLCJuYW1lIjoiQm9vdHkgQmF5Iiwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbLTMwLjM2Mzg1MzQ1NDU4OTg0NCw0LjIxODc4NzY3MDEzNTQ5OCw0OTQuMDMxMTI3OTI5Njg3NV19LHsibWVzaCI6OTMsIm5hbWUiOiJJbnRlcnN0ZWxsYXIgU3RhdGlvbiIsInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI1OC4zMDM4MzMwMDc4MTI1LDQuMjE4Nzg3NjcwMTM1NDk4LDM5Mi4zODAwNjU5MTc5Njg3NV19LHsibWVzaCI6OTQsIm5hbWUiOiJDb29wZXIgU3RhdGlvbiIsInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy04OS4wODk5Mjc2NzMzMzk4NCw0LjIxODc4NzY3MDEzNTQ5OCw0ODAuMDEwNjgxMTUyMzQzNzVdfSx7Im1lc2giOjk1LCJuYW1lIjoiQmxvY2sgWDEiLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlszNDguNTc0MDM1NjQ0NTMxMjUsNC4yMTg3ODc2NzAxMzU0OTgsNDAyLjg2ODI4NjEzMjgxMjVdfSx7Im1lc2giOjk2LCJuYW1lIjoiQXJlbmEgb2YgSnVzdGljZSIsInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy01My4wNjM1NjA0ODU4Mzk4NDQsNC4yMTg3ODc2NzAxMzU0OTgsNDkwLjQ5ODkwMTM2NzE4NzVdfSx7Im1lc2giOjM0LCJuYW1lIjoiUG9ydGFsIEpLMSIsInJvdGF0aW9uIjpbMCwtMC45ODYyMTEzNTk1MDA4ODUsMCwwLjE2NTQ5MDYyNzI4ODgxODM2XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMTE4LjY5NTQ2NTA4Nzg5MDYyLDQuMjE4Nzg3NjcwMTM1NDk4LDI2Mi43NTEwMDcwODAwNzgxXX0seyJtZXNoIjozNiwibmFtZSI6Ikh5cnVsZSBTdGF0aW9uIiwicm90YXRpb24iOlswLC0wLjk5ODIxNTEzODkxMjIwMDksMCwwLjA1OTcyMDczOTcyMjI1MTg5XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOls1NS41MDIxODIwMDY4MzU5NCw0LjIxODc4NzY3MDEzNTQ5OCwyODYuMTg2MDM1MTU2MjVdfSx7Im1lc2giOjM4LCJuYW1lIjoiQ3JhaWdzdmlsbGUiLCJyb3RhdGlvbiI6WzAsLTAuOTk4MjE1MTM4OTEyMjAwOSwwLDAuMDU5NzIwNzM5NzIyMjUxODldLCJzY2FsZSI6WzEuMDk5OTk5OTA0NjMyNTY4NCwxLjEwMDAwMDAyMzg0MTg1OCwxLjA5OTk5OTkwNDYzMjU2ODRdLCJ0cmFuc2xhdGlvbiI6WzQyLjQyMzg3NzcxNjA2NDQ1LDQuMjE4Nzg3NjcwMTM1NDk4LDI4Ni41MTA0OTgwNDY4NzVdfSx7Im1lc2giOjQwLCJuYW1lIjoiSWFuaSBDaGFvcyIsInJvdGF0aW9uIjpbMCwtMC45ODYyMTEzNTk1MDA4ODUsMCwwLjE2NTQ5MDYyNzI4ODgxODM2XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMTEwLjAyNTA3MDE5MDQyOTY5LDQuMjE4Nzg3NjcwMTM1NDk4LDI2Ny40MTQ0NTkyMjg1MTU2XX0seyJtZXNoIjo0MiwibmFtZSI6IkF0bGFzIFBsYWNlIiwicm90YXRpb24iOlswLC0wLjk4NjIxMTM1OTUwMDg4NSwwLDAuMTY1NDkwNjI3Mjg4ODE4MzZdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOls4OS4zMjg5MTA4Mjc2MzY3Miw0LjIxODc4NzY3MDEzNTQ5OCwyNzYuMjIxMzQzOTk0MTQwNl19LHsibWVzaCI6NDQsIm5hbWUiOiJTb2xhY2UiLCJyb3RhdGlvbiI6WzAsLTAuOTk4MjE1MTM4OTEyMjAwOSwwLDAuMDU5NzIwNzM5NzIyMjUxODldLCJzY2FsZSI6WzEuMDk5OTk5OTA0NjMyNTY4NCwxLjEwMDAwMDAyMzg0MTg1OCwxLjA5OTk5OTkwNDYzMjU2ODRdLCJ0cmFuc2xhdGlvbiI6WzYzLjQxMDc2NjYwMTU2MjUsNC4yMTg3ODc2NzAxMzU0OTgsMjgyLjc0NDIzMjE3NzczNDRdfSx7Im1lc2giOjQ2LCJuYW1lIjoiQmxpZ2h0Z3JvdW5kIENlbnRyYWwiLCJyb3RhdGlvbiI6WzAsLTAuOTg2MjExMzU5NTAwODg1LDAsMC4xNjU0OTA2MjcyODg4MTgzNl0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wzc3LjIyODYyMjQzNjUyMzQ0LDQuMjE4Nzg3NjcwMTM1NDk4LDI3OS45MTYxMzc2OTUzMTI1XX0seyJtZXNoIjo0OCwibmFtZSI6IkJ1dGxlcidzIFJvb20iLCJyb3RhdGlvbiI6WzAsLTAuOTg2MjExMzU5NTAwODg1LDAsMC4xNjU0OTA2MjcyODg4MTgzNl0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzEwMC4wOTU2NDk3MTkyMzgyOCw0LjIxODc4NzY3MDEzNTQ5OCwyNzMuMDI0ODcxODI2MTcxOV19LHsibWVzaCI6NzIsIm5hbWUiOiJGYWJsZSBTdGF0aW9uIiwicm90YXRpb24iOlswLC0wLjk2ODUwNzUyODMwNTA1MzcsMCwwLjI0ODk4NDI0NzQ0NjA2MDE4XSwic2NhbGUiOls2LjM0NzAxNzc2NTA0NTE2NiwzLjE3OTM1OTQzNjAzNTE1NjIsNi4zNDcwMTc3NjUwNDUxNjZdLCJ0cmFuc2xhdGlvbiI6WzE1NS43NTY3NDQzODQ3NjU2Miw3LjA2Mjk1MzQ3MjEzNzQ1MSwyNDkuMDA0OTg5NjI0MDIzNDRdfSx7Im1lc2giOjc0LCJuYW1lIjoiQXJrIFN0YXRpb24iLCJyb3RhdGlvbiI6WzAsLTAuOTM3MTE2MzI0OTAxNTgwOCwwLDAuMzQ5MDE3NDQxMjcyNzM1Nl0sInNjYWxlIjpbNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTVdLCJ0cmFuc2xhdGlvbiI6WzE5MC40NDQ5OTIwNjU0Mjk3LDguNjQ2OTMwNjk0NTgwMDc4LDIyMy4yOTc0ODUzNTE1NjI1XX0seyJtZXNoIjo4MiwibmFtZSI6IlBvcnRhbCBUNCIsInJvdGF0aW9uIjpbMCwtMC45Njg1MDc0MDkwOTU3NjQyLDAsMC4yNDg5ODQ2NDk3Nzc0MTI0MV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzE0MS42MTQ2MzkyODIyMjY1Niw0LjIxODc4NzY3MDEzNTQ5OCwyNTYuMzk1NzUxOTUzMTI1XX0seyJtZXNoIjo4MywibmFtZSI6IlNtdWdnbGVyJ3MgaGlkZW91dCIsInJvdGF0aW9uIjpbMCwtMC45OTgyMTUxMzg5MTIyMDA5LDAsMC4wNTk3MjA3Mzk3MjIyNTE4OV0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbMjUuNDU1OTkzNjUyMzQzNzUsNC4yMTg3ODc2NzAxMzU0OTgsMjkyLjAxNTQxMTM3Njk1MzFdfSx7Im1lc2giOjg2LCJuYW1lIjoiQXRoZW5hIEJ1aWxkaW5nIiwicm90YXRpb24iOlswLC0wLjk2ODUwNzQwOTA5NTc2NDIsMCwwLjI0ODk4NDY0OTc3NzQxMjQxXSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMTMxLjEzMDY5MTUyODMyMDMsNC4yMTg3ODc2NzAxMzU0OTgsMjYzLjAyMjQ2MDkzNzVdfSx7Im1lc2giOjU5LCJuYW1lIjoiVXRvcGlsaXMiLCJ0cmFuc2xhdGlvbiI6Wy00MzUuMjk1OTU5NDcyNjU2MjUsMy45MjU3ODk4MzMwNjg4NDc3LDQ4Ny4zMjMzNjQyNTc4MTI1XX0seyJtZXNoIjo2MSwibmFtZSI6IlRoZSBLZWVwIiwidHJhbnNsYXRpb24iOlstMzQ4LjIxNDc1MjE5NzI2NTYsMy45MjU3ODk4MzMwNjg4NDc3LDQ4Ni45NjgyNjE3MTg3NV19LHsibWVzaCI6NjMsIm5hbWUiOiJXb25kZXJsYW5kIiwidHJhbnNsYXRpb24iOlstMzI2LjEzNTY1MDYzNDc2NTYsMy45MjU3ODk4MzMwNjg4NDc3LDQ4NS4wNDczNjMyODEyNV19LHsibWVzaCI6NjQsIm5hbWUiOiJUaGUgT21lZ2EiLCJ0cmFuc2xhdGlvbiI6Wy0yOTguNjgwMDg0MjI4NTE1NiwzLjkyNTc4OTgzMzA2ODg0NzcsNDg0LjAwMjgwNzYxNzE4NzVdfSx7Im1lc2giOjY2LCJuYW1lIjoiVHlyZWxsIGJ1aWxkaW5nIiwidHJhbnNsYXRpb24iOlstMjYzLjgxMzc1MTIyMDcwMzEsMy45MjU3ODk4MzMwNjg4NDc3LDQ4Mi44ODg3OTM5NDUzMTI1XX0seyJtZXNoIjo1MCwibmFtZSI6IlRoZSBTb2wgQnVpbGRpbmciLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlsxODcuODI1Mzc4NDE3OTY4NzUsMy45MjU3ODk4MzMwNjg4NDc3LDQ0Ni40Mzg4MTIyNTU4NTk0XX0seyJtZXNoIjozMCwibmFtZSI6IlRoZSBVcHNpZGUgRG93biIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzE2MS43NjQxMTQzNzk4ODI4LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0NDMuNDQyNzE4NTA1ODU5NF19LHsibWVzaCI6NTksIm5hbWUiOiJUaGUgTmV3dG9uIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMTQwLjEzMDA4MTE3Njc1NzgsMy45MjU3ODk4MzMwNjg4NDc3LDQ0Ny43OTc4ODIwODAwNzgxXX0seyJtZXNoIjo2MSwibmFtZSI6Ik5vcm1hIFRvd2VyIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbMTEzLjE5NzM1NzE3NzczNDM4LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0NDguMTUyOTg0NjE5MTQwNl19LHsibWVzaCI6NjMsIm5hbWUiOiJXYXlsYW5kIENlbnRyYWwiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOls5MS4xMTgyNTU2MTUyMzQzOCwzLjkyNTc4OTgzMzA2ODg0NzcsNDUwLjA3Mzg4MzA1NjY0MDZdfSx7Im1lc2giOjY0LCJuYW1lIjoiR2FsYWN0aWMgVG93ZXIiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOls2My42NjI2ODkyMDg5ODQzNzUsMy45MjU3ODk4MzMwNjg4NDc3LDQ1MS4xMTg0Mzg3MjA3MDMxXX0seyJtZXNoIjo2NiwibmFtZSI6IkVuZG9yZSBQNyIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6WzI4Ljc5NjM1NjIwMTE3MTg3NSwzLjkyNTc4OTgzMzA2ODg0NzcsNDUyLjIzMjQ1MjM5MjU3ODFdfSx7Im1lc2giOjY4LCJuYW1lIjoiRXVyb3BhIFRvd2VyIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTU5LjE0NDYxNTE3MzMzOTg0NCwzLjkyNTc4OTgzMzA2ODg0NzcsNDQ3LjY1NjAwNTg1OTM3NV19LHsibWVzaCI6MjksIm5hbWUiOiJUaGUgT3ZlcmhhbmcgV2F0Y2ggVG93ZXIiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlstMjUuNzA2NzEyNzIyNzc4MzIsMy45MjU3ODk4MzMwNjg4NDc3LDQ0Ny42ODQxNDMwNjY0MDYyNV19LHsibWVzaCI6NzcsIm5hbWUiOiJPZiBDb3Vyc2UgSSBTdGlsbCBMaWtlIFlvdSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2OTkxNTM4MDEyNWUtMDddLCJzY2FsZSI6WzEyLjE4MzcyNDQwMzM4MTM0OCwxMi4xODM3MjQ0MDMzODEzNDgsMTIuMTgzNzI0NDAzMzgxMzQ4XSwidHJhbnNsYXRpb24iOls0MDYuMzEyMzc3OTI5Njg3NSwxOS42NDYyODQxMDMzOTM1NTUsNDQ4Ljk1MDY4MzU5Mzc1XX0seyJtZXNoIjo3OCwibmFtZSI6IkVzY2FwZSBDbyIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2OTkxNTM4MDEyNWUtMDddLCJzY2FsZSI6WzEwLjA2MDQzODE1NjEyNzkzLDEwLjA2MDQzODE1NjEyNzkzLDEwLjA2MDQzODE1NjEyNzkzXSwidHJhbnNsYXRpb24iOlsyNjAuNDA0ODQ2MTkxNDA2MjUsMy45MjU3ODk4MzMwNjg4NDc3LDQ0Mi42ODE5MTUyODMyMDMxXX0seyJtZXNoIjoyOCwibmFtZSI6IlZ1bGNhbiBDZW50cmFsIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInNjYWxlIjpbOS43ODE4MDc4OTk0NzUwOTgsOS43ODE4MDc4OTk0NzUwOTgsOS43ODE4MDc4OTk0NzUwOThdLCJ0cmFuc2xhdGlvbiI6WzMwOS4wNDc0MjQzMTY0MDYyNSwxMC4xODQ3OTcyODY5ODczMDUsNDQ1LjM2NzA5NTk0NzI2NTZdfSx7Im1lc2giOjgwLCJuYW1lIjoiRG9ybmlvIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInNjYWxlIjpbNC4wMDYzMjYxOTg1Nzc4ODEsNC4wMDYzMjYxOTg1Nzc4ODEsNC4wMDYzMjYxOTg1Nzc4ODFdLCJ0cmFuc2xhdGlvbiI6WzI3Ny42NzA4Mzc0MDIzNDM3NSwzLjkyNTc4OTgzMzA2ODg0NzcsNDQwLjU4MDk2MzEzNDc2NTZdfSx7Im1lc2giOjg1LCJuYW1lIjoiRmFudGFzeSBXb3JsZCIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2OTkxNTM4MDEyNWUtMDddLCJzY2FsZSI6WzguMzU4MjQ3NzU2OTU4MDA4LDguMzU4MjQ3NzU2OTU4MDA4LDguMzU4MjQ3NzU2OTU4MDA4XSwidHJhbnNsYXRpb24iOlsyMTMuOTY1MjcwOTk2MDkzNzUsMTYuMTc2MDc0OTgxNjg5NDUzLDQ0NS4yNjQ2Nzg5NTUwNzgxXX0seyJtZXNoIjo5MCwibmFtZSI6IkNsYXJpc3NhJ3MgR3JhbmQgUGxhY2UiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwic2NhbGUiOls5LjE0MTU5ODcwMTQ3NzA1LDkuMTQxNTk4NzAxNDc3MDUsOS4xNDE1OTg3MDE0NzcwNV0sInRyYW5zbGF0aW9uIjpbMjM4Ljc1ODQ4Mzg4NjcxODc1LDUuMjM3MjI2OTYzMDQzMjEzLDQ0NS41MTE2MjcxOTcyNjU2XX0seyJtZXNoIjo1NiwibmFtZSI6IlRoZSBMZWZ0b3ZlcnMiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlstMjY5Ljg4NDg4NzY5NTMxMjUsMy45MjU3ODk4MzMwNjg4NDc3LDQ0Ny4wMzUwMzQxNzk2ODc1XX0seyJtZXNoIjo5MiwibmFtZSI6IkJsb2NrIFQxMiIsInJvdGF0aW9uIjpbMCwtMSwwLDEuMTkyNDg4MDYzODUwMzA1NWUtMDhdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlstMzI0LjIzNzU3OTM0NTcwMzEsNC4yMTg3ODc2NzAxMzU0OTgsNDUxLjcxMjgyOTU4OTg0Mzc1XX0seyJtZXNoIjo5NCwibmFtZSI6IkNvbW1hbmQgQ2VudGVyIiwicm90YXRpb24iOlswLC0xLDAsMS4xOTI0ODgwNjM4NTAzMDU1ZS0wOF0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy00MTIuNDM3NzQ0MTQwNjI1LDQuMjE4Nzg3NjcwMTM1NDk4LDQ1Ni42NDY5MTE2MjEwOTM3NV19LHsibWVzaCI6OTYsIm5hbWUiOiJUaGUgQXN0ZXJpYSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuMTkyNDg4MDYzODUwMzA1NWUtMDhdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlstMzAxLjQyMzczNjU3MjI2NTYsNC4yMTg3ODc2NzAxMzU0OTgsNDQ2LjE1ODY5MTQwNjI1XX0seyJtZXNoIjo2MSwibmFtZSI6IlRoZSBDaXRhZGVsIiwicm90YXRpb24iOlswLC0xLDAsMS42MjkyMDY4NDk0Mjk0NjU0ZS0wN10sInRyYW5zbGF0aW9uIjpbLTIyMy43NDU4MTkwOTE3OTY4OCwzLjkyNTc4OTgzMzA2ODg0NzcsNDQ5LjY4OTMzMTA1NDY4NzVdfSx7Im1lc2giOjYzLCJuYW1lIjoiWm9ua28ncyBIb3VzZSIsInJvdGF0aW9uIjpbMCwtMSwwLDEuNjI5MjA2ODQ5NDI5NDY1NGUtMDddLCJ0cmFuc2xhdGlvbiI6Wy0xNDcuMDg0MDQ1NDEwMTU2MjUsMy45MjU3ODk4MzMwNjg4NDc3LDQ1MS42MTAyMjk0OTIxODc1XX0seyJtZXNoIjo2NCwibmFtZSI6Ik9yYWNsZSA5Iiwicm90YXRpb24iOlswLC0wLjcwNzEwNjU5MDI3MDk5NjEsMCwwLjcwNzEwNjk0Nzg5ODg2NDddLCJ0cmFuc2xhdGlvbiI6Wy0xMTkuODM4MDczNzMwNDY4NzUsMy45MjU3ODk4MzMwNjg4NDc3LDQ1Mi42NTQ3ODUxNTYyNV19LHsibWVzaCI6NDksIm5hbWUiOiJRdWFudHVtIFpvbmUiLCJyb3RhdGlvbiI6WzAsLTAuOTg5OTAxOTU5ODk2MDg3NiwwLDAuMTQxNzUzOTg2NDc3ODUxODddLCJ0cmFuc2xhdGlvbiI6WzE0MS4xNTYzMTEwMzUxNTYyNSwzLjkyNTc4OTgzMzA2ODg0NzcsMzQ1LjIyNzM1NTk1NzAzMTI1XX0seyJtZXNoIjo1NywibmFtZSI6IkdhbGxpZnJleSIsInJvdGF0aW9uIjpbMCwtMC45ODQ0OTY5NTExMDMyMTA0LDAsMC4xNzU0MDE3MzIzMjU1NTM5XSwidHJhbnNsYXRpb24iOlsxNjUuNjI2MjIwNzAzMTI1LDMuOTI1Nzg5ODMzMDY4ODQ3NywzMzQuNjkwMjE2MDY0NDUzMV19LHsibWVzaCI6NTgsIm5hbWUiOiJEaXN0cmljdCA5IFN0YXRpb24iLCJyb3RhdGlvbiI6WzAsLTAuOTc3MzY1ODUxNDAyMjgyNywwLDAuMjExNTU2NTM4OTM5NDc2XSwidHJhbnNsYXRpb24iOlsxODcuNTY5NDU4MDA3ODEyNSwzLjkyNTc4OTgzMzA2ODg0NzcsMzI2LjM0MjIyNDEyMTA5Mzc1XX0seyJtZXNoIjo2MCwibmFtZSI6IlNreWZhbGwgVG93ZXIiLCJyb3RhdGlvbiI6WzAsLTAuOTU3MzAxMDgwMjI2ODk4MiwwLDAuMjg5MDkyNzQ5MzU3MjIzNV0sInRyYW5zbGF0aW9uIjpbMjEwLjg5Njc0Mzc3NDQxNDA2LDMuOTI1Nzg5ODMzMDY4ODQ3NywzMTMuNjg3NjUyNTg3ODkwNl19LHsibWVzaCI6NjIsIm5hbWUiOiJOaW1idXMgVG93ZXIiLCJyb3RhdGlvbiI6WzAsMC4zODIyNTQ5ODc5NTUwOTM0LDAsMC45MjQwNTY4ODc2MjY2NDhdLCJ0cmFuc2xhdGlvbiI6WzI1MC4wNzc0MjMwOTU3MDMxMiwzLjkyNTc4OTgzMzA2ODg0NzcsMjg5Ljg2MzA2NzYyNjk1MzFdfSx7Im1lc2giOjMxLCJuYW1lIjoiRGVsZmlubyBQbGF6YSIsInJvdGF0aW9uIjpbMCwwLjM3MDI0MTg1MDYxNDU0NzczLDAsMC45Mjg5MzU0MDg1OTIyMjQxXSwidHJhbnNsYXRpb24iOlsyODMuODU1ODA0NDQzMzU5NCwzLjkyNTc4OTgzMzA2ODg0NzcsMzE3LjA5Mzg0MTU1MjczNDRdfSx7Im1lc2giOjMyLCJuYW1lIjoiQWxleGFuZHJpYSIsInJvdGF0aW9uIjpbMCwtMC40MTY5ODgxMzQzODQxNTUzLDAsMC45MDg5MTE4ODM4MzEwMjQyXSwic2NhbGUiOlsxMi4xODM3MjQ0MDMzODEzNDgsMTIuMTgzNzI0NDAzMzgxMzQ4LDEyLjE4MzcyNDQwMzM4MTM0OF0sInRyYW5zbGF0aW9uIjpbMzA3LjMzMjE4MzgzNzg5MDYsMTkuNjQ2Mjg0MTAzMzkzNTU1LDM0Ny42MTYyNzE5NzI2NTYyNV19LHsibWVzaCI6NzAsIm5hbWUiOiJDYW5keSBMYW5kIiwicm90YXRpb24iOlswLC0wLjQyMDMxMjA3NjgwNzAyMjEsMCwwLjkwNzM3OTYyNzIyNzc4MzJdLCJzY2FsZSI6WzEwLjA2MDQzODE1NjEyNzkzLDEwLjA2MDQzODE1NjEyNzkzLDEwLjA2MDQzODE1NjEyNzkzXSwidHJhbnNsYXRpb24iOlszMjYuMjI0NjM5ODkyNTc4MSwzLjkyNTc4OTgzMzA2ODg0NzcsMzc3LjYwMzQ1NDU4OTg0Mzc1XX0seyJtZXNoIjo3MSwibmFtZSI6Ik9yaW9uJ3MgU3BhY2UiLCJyb3RhdGlvbiI6WzAsLTAuOTk5MTc1NjA4MTU4MTExNiwwLDAuMDQwNTk4OTU4NzMwNjk3NjNdLCJzY2FsZSI6WzkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4XSwidHJhbnNsYXRpb24iOlszNi41NTMzOTgxMzIzMjQyMiwxMC4xODQ3OTcyODY5ODczMDUsMzYzLjcxMzY1MzU2NDQ1MzFdfSx7Im1lc2giOjczLCJuYW1lIjoiU3RhZHRrcm9uZSBUb3dlciIsInJvdGF0aW9uIjpbMCwtMC45OTkxNzU1NDg1NTM0NjY4LDAsMC4wNDA1OTg5NTUwMDU0MDczM10sInNjYWxlIjpbNC4wMDYzMjY2NzU0MTUwMzksNC4wMDYzMjYxOTg1Nzc4ODEsNC4wMDYzMjY2NzU0MTUwMzldLCJ0cmFuc2xhdGlvbiI6WzY5LjgyNDQ3ODE0OTQxNDA2LDMuOTI1Nzg5ODMzMDY4ODQ3NywzNTguNjk1MDk4ODc2OTUzMV19LHsibWVzaCI6NzYsIm5hbWUiOiJUaGUgQXRsYW50aXMiLCJyb3RhdGlvbiI6WzAsLTAuOTkzODQ3OTY2MTk0MTUyOCwwLDAuMTEwNzUzNDc2NjE5NzIwNDZdLCJzY2FsZSI6WzguMzU4MjQ3NzU2OTU4MDA4LDguMzU4MjQ3NzU2OTU4MDA4LDguMzU4MjQ3NzU2OTU4MDA4XSwidHJhbnNsYXRpb24iOlsxMTMuOTU2OTU0OTU2MDU0NjksMTYuMTc2MDc0OTgxNjg5NDUzLDM1MS40NDcwMjE0ODQzNzVdfSx7Im1lc2giOjI3LCJuYW1lIjoiSW5jZXB0aW9uIiwicm90YXRpb24iOlswLC0wLjk5OTE3NTYwODE1ODExMTYsMCwwLjA0MDU5ODk1ODczMDY5NzYzXSwic2NhbGUiOls5LjE0MTU5ODcwMTQ3NzA1LDkuMTQxNTk4NzAxNDc3MDUsOS4xNDE1OTg3MDE0NzcwNV0sInRyYW5zbGF0aW9uIjpbODkuNDI2NzM0OTI0MzE2NCw1LjIzNzIyNjk2MzA0MzIxMywzNTYuNjMyODEyNV19LHsibWVzaCI6NTEsIm5hbWUiOiJQbGFuZXQgRWxvbiIsInJvdGF0aW9uIjpbMCwwLjQxMjI5NjQxNDM3NTMwNTIsMCwwLjkxMTA0OTc4MzIyOTgyNzldLCJ0cmFuc2xhdGlvbiI6Wy0zMjAuODQ0OTQwMTg1NTQ2OSwzLjkyNTc4OTgzMzA2ODg0NzcsMzU0Ljg2MjU0ODgyODEyNV19LHsibWVzaCI6NTMsIm5hbWUiOiJPbHltcHVzIiwidHJhbnNsYXRpb24iOlstMTc5LjkyNjE0NzQ2MDkzNzUsMy45MjU3ODk4MzMwNjg4NDc3LDMzOC45OTI4NTg4ODY3MTg3NV19LHsibWVzaCI6NTUsIm5hbWUiOiJCaXRjb2luaXVtIiwidHJhbnNsYXRpb24iOlstODQuMTQ4Njc0MDExMjMwNDcsMy45MjU3ODk4MzMwNjg4NDc3LDM1OS43NDg1NjU2NzM4MjgxXX0seyJtZXNoIjo2NSwibmFtZSI6IlRoZSBXYXRjaCBUb3dlciIsInJvdGF0aW9uIjpbMCwwLjQxMjI5NjQxNDM3NTMwNTIsMCwwLjkxMTA0OTc4MzIyOTgyNzldLCJ0cmFuc2xhdGlvbiI6Wy0yNTkuNDc0NzMxNDQ1MzEyNSwzLjkyNTc4OTgzMzA2ODg0NzcsMjg2LjE0MjY2OTY3NzczNDRdfSx7Im1lc2giOjY3LCJuYW1lIjoiRG9nZSBIb3VzZSIsInJvdGF0aW9uIjpbMCwwLjQxMjI5NjQxNDM3NTMwNTIsMCwwLjkxMTA0OTc4MzIyOTgyNzldLCJ0cmFuc2xhdGlvbiI6Wy0yODYuODg5MjIxMTkxNDA2MjUsMy45MjU3ODk4MzMwNjg4NDc3LDMxMC40MTIyOTI0ODA0Njg3NV19LHsibWVzaCI6NjksIm5hbWUiOiJUaGUgUmFmdCBUb3dlciIsInJvdGF0aW9uIjpbMCwwLjQxMjI5NjQxNDM3NTMwNTIsMCwwLjkxMTA0OTc4MzIyOTgyNzldLCJ0cmFuc2xhdGlvbiI6Wy0zMDQuMTA1NTYwMzAyNzM0NCwzLjkyNTc4OTgzMzA2ODg0NzcsMzMwLjA1MDY4OTY5NzI2NTZdfSx7Im1lc2giOjkxLCJuYW1lIjoiQWxkZXJhYW4gQnVpbGRpbmciLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlstMjcuODg4MTU0OTgzNTIwNTA4LDQuMjE4Nzg3NjcwMTM1NDk4LDM2NC4xNTcxMDQ0OTIxODc1XX0seyJtZXNoIjo5MywibmFtZSI6IkRyZWFtbGFuZCIsInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy0xNDAuODU3OTEwMTU2MjUsNC4yMTg3ODc2NzAxMzU0OTgsMzUwLjEzNjY1NzcxNDg0Mzc1XX0seyJtZXNoIjo5NSwibmFtZSI6IkFuZG8gTGFuZCIsInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy01MC41ODc3MDc1MTk1MzEyNSw0LjIxODc4NzY3MDEzNTQ5OCwzNjAuNjI0ODc3OTI5Njg3NV19LHsibWVzaCI6NTUsIm5hbWUiOiJQbGFuZXRhcml1bSIsInJvdGF0aW9uIjpbMCwwLjQyMDU3MTgzMzg0ODk1MzI1LDAsMC45MDcyNTkyMjU4NDUzMzY5XSwidHJhbnNsYXRpb24iOlstMjQ1LjUyMDQ0Njc3NzM0Mzc1LDMuOTI1Nzg5ODMzMDY4ODQ3NywzNjAuMjEyMTI3Njg1NTQ2OV19LHsibWVzaCI6ODEsIm5hbWUiOiJCbG9jayA3Iiwicm90YXRpb24iOlswLC0wLjMzMzgwMTg2NTU3NzY5Nzc1LDAsMC45NDI2NDMyODQ3OTc2Njg1XSwic2NhbGUiOls0Ljc0ODE3NTYyMTAzMjcxNSw0Ljc0ODE3NTYyMTAzMjcxNSw0Ljc0ODE3NTYyMTAzMjcxNV0sInRyYW5zbGF0aW9uIjpbLTIyNS43NDYzNTMxNDk0MTQwNiw4LjY0NjkzMDY5NDU4MDA3OCwyNDIuNjAwNDYzODY3MTg3NV19LHsibWVzaCI6MzMsIm5hbWUiOiJNb29uIEJhc2UiLCJyb3RhdGlvbiI6WzAsMC45OTE2ODgzNzA3MDQ2NTA5LDAsMC4xMjg2NjMwMTgzNDU4MzI4Ml0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy01OC41MDg3OTY2OTE4OTQ1Myw0LjIxODc4NzY3MDEzNTQ5OCwyNzcuNTA0OTEzMzMwMDc4MV19LHsibWVzaCI6MzUsIm5hbWUiOiJHbGl0Y2ggV29ybGQiLCJyb3RhdGlvbiI6WzAsMC45ODMzNTk1NzUyNzE2MDY0LDAsMC4xODE2Njk5NjUzODYzOTA2OV0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbLTEyNC4xNzUwNTY0NTc1MTk1Myw0LjIxODc4NzY3MDEzNTQ5OCwyNTkuNjI3OTI5Njg3NV19LHsibWVzaCI6MzcsIm5hbWUiOiJIeWRyYSBCYXNlIiwicm90YXRpb24iOlswLDAuOTY0MjI3NDk3NTc3NjY3MiwwLDAuMjY1MDc2MTAwODI2MjYzNF0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6Wy0xMzguNTM5MjQ1NjA1NDY4NzUsNC4yMTg3ODc2NzAxMzU0OTgsMjUxLjU2NjMxNDY5NzI2NTYyXX0seyJtZXNoIjozOSwibmFtZSI6IlRoZSBIb3VzZSBvZiBNeXN0ZXJ5Iiwicm90YXRpb24iOlswLDAuOTkxNjg4MzcwNzA0NjUwOSwwLDAuMTI4NjYzMDE4MzQ1ODMyODJdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlstNjguMzA3NTAyNzQ2NTgyMDMsNC4yMTg3ODc2NzAxMzU0OTgsMjc2LjU1MDYyODY2MjEwOTRdfSx7Im1lc2giOjQxLCJuYW1lIjoiTWF3cnRoIFZhbGxpcyIsInJvdGF0aW9uIjpbMCwwLjk4MzM1OTU3NTI3MTYwNjQsMCwwLjE4MTY2OTk2NTM4NjM5MDY5XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOlstOTMuMDIwNjgzMjg4NTc0MjIsNC4yMTg3ODc2NzAxMzU0OTgsMjcwLjgyNjIwMjM5MjU3ODFdfSx7Im1lc2giOjQzLCJuYW1lIjoiS25vd2hlcmUiLCJyb3RhdGlvbiI6WzAsMC45ODMzNTk1NzUyNzE2MDY0LDAsMC4xODE2Njk5NjUzODYzOTA2OV0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbLTExNS41NzM3Njg2MTU3MjI2Niw0LjIxODc4NzY3MDEzNTQ5OCwyNjAuMjY5MDQyOTY4NzVdfSx7Im1lc2giOjQ1LCJuYW1lIjoiSG9uZXlkdWtlcyBIb3RlbCIsInJvdGF0aW9uIjpbMCwwLjk4MzM1OTU3NTI3MTYwNjQsMCwwLjE4MTY2OTk2NTM4NjM5MDY5XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOlstMTA0LjY2NjIzNjg3NzQ0MTQsNC4yMTg3ODc2NzAxMzU0OTgsMjY1Ljg4MTU2MTI3OTI5NjldfSx7Im1lc2giOjQ3LCJuYW1lIjoiTWFycyBTdGF0aW9uIiwicm90YXRpb24iOlswLDAuOTkxNjg4MzcwNzA0NjUwOSwwLDAuMTI4NjYzMDE4MzQ1ODMyODJdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlstNzkuNjc5MTM4MTgzNTkzNzUsNC4yMTg3ODc2NzAxMzU0OTgsMjc1LjY4MjAwNjgzNTkzNzVdfSx7Im1lc2giOjc5LCJuYW1lIjoiRG9tYmF5Iiwicm90YXRpb24iOlswLDAuOTk4MjI2Mjg0OTgwNzczOSwwLDAuMDU5NTMzNzMwMTQ5MjY5MTA0XSwic2NhbGUiOls2LjM0NzAxNzc2NTA0NTE2NiwzLjE3OTM1OTQzNjAzNTE1NjIsNi4zNDcwMTc3NjUwNDUxNjZdLCJ0cmFuc2xhdGlvbiI6Wy0xOS4xMDk0MDc0MjQ5MjY3NTgsNy4wNjI5NTM0NzIxMzc0NTEsMjg3LjA4Mzc0MDIzNDM3NV19LHsibWVzaCI6ODQsIm5hbWUiOiJCZWFjb24gU3RhdGlvbiIsInJvdGF0aW9uIjpbMCwwLjk0ODY5MTEyOTY4NDQ0ODIsMCwwLjMxNjIwNDM5ODg3MDQ2ODE0XSwic2NhbGUiOls0Ljg3NDI3OTk3NTg5MTExMyw0Ljg3NDI3OTk3NTg5MTExMyw0Ljg3NDI3OTk3NTg5MTExM10sInRyYW5zbGF0aW9uIjpbLTE5NC41NDU2MDg1MjA1MDc4LDguNzgyNDAwMTMxMjI1NTg2LDIxNC4wMDk2NDM1NTQ2ODc1XX0seyJtZXNoIjo4NywibmFtZSI6IkVjaG8gQmFzZSIsInJvdGF0aW9uIjpbMCwwLjk5ODIyNjQwNDE5MDA2MzUsMCwwLjA1OTUzMjY5MDc5MzI3NTgzXSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbLTMzLjE5OTAyMDM4NTc0MjE5LDQuMjE4Nzg3NjcwMTM1NDk4LDI4NC4wOTM3ODA1MTc1NzgxXX0seyJtZXNoIjo4OCwibmFtZSI6IkNlbGVzdGUgQnVpbGRpbmciLCJyb3RhdGlvbiI6WzAsMC45NjQyMjc0OTc1Nzc2NjcyLDAsMC4yNjUwNzYxMDA4MjYyNjM0XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbLTE1NS4zNDI0MDcyMjY1NjI1LDQuMjE4Nzg3NjcwMTM1NDk4LDI0NS41Nzc4MTk4MjQyMTg3NV19LHsibWVzaCI6ODksIm5hbWUiOiJHYW1vcmEgVDEyIiwicm90YXRpb24iOlswLC0wLjk5OTQ0NzE2NjkxOTcwODMsMCwwLjAzMzI0NjYwMjg2MzA3MzM1XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbLTQ2LjI2MTczNzgyMzQ4NjMzLDQuMjE4Nzg3NjcwMTM1NDk4LDI4NC4xMzg3MDIzOTI1NzgxXX0seyJtZXNoIjo4MSwibmFtZSI6IkhvdXNlIG9mIEhhZ3JpZCIsInJvdGF0aW9uIjpbMCwwLjY4NDkxMDcxNDYyNjMxMjMsMCwwLjcyODYyNzAyNjA4MTA4NTJdLCJzY2FsZSI6WzQuNzQ4MTc1NjIxMDMyNzE1LDQuNzQ4MTc1NjIxMDMyNzE1LDQuNzQ4MTc1NjIxMDMyNzE1XSwidHJhbnNsYXRpb24iOlstMjAuNTMzNDA5MTE4NjUyMzQ0LDguNjQ2OTMwNjk0NTgwMDc4LDMwNC45MjUyOTI5Njg3NV19LHsibWVzaCI6NDksIm5hbWUiOiJHcm9vdCdzIFBsYWNlIiwicm90YXRpb24iOlswLC0wLjc3NDEyMDMzMDgxMDU0NjksMCwwLjYzMzAzODQ2MTIwODM0MzVdLCJ0cmFuc2xhdGlvbiI6WzExOS40MTY5ODQ1NTgxMDU0NywzLjkyNTc4OTgzMzA2ODg0NzcsMjQuODczODk5NDU5ODM4ODY3XX0seyJtZXNoIjo1MSwibmFtZSI6Ikhvb3RlcnZpbGxlIiwicm90YXRpb24iOlswLC0wLjk2ODQzNzQzMzI0Mjc5NzksMCwwLjI0OTI1NjczMDA3OTY1MDg4XSwidHJhbnNsYXRpb24iOlszNS42NjcyMDk2MjUyNDQxNCwzLjkyNTc4OTgzMzA2ODg0NzcsNjkuODIxMTI4ODQ1MjE0ODRdfSx7Im1lc2giOjUzLCJuYW1lIjoiQXJjYWRpYSIsInRyYW5zbGF0aW9uIjpbMjAuNzExOTEwMjQ3ODAyNzM0LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMTkuNjU0ODkzODc1MTIyMDddfSx7Im1lc2giOjU1LCJuYW1lIjoiRW5uaXMtQnJvd24gQnVpbGRpbmciLCJyb3RhdGlvbiI6WzAsLTAuODYwMjY3ODc3NTc4NzM1NCwwLDAuNTA5ODQyMjE2OTY4NTM2NF0sInRyYW5zbGF0aW9uIjpbNjguODkxODgzODUwMDk3NjYsMy45MjU3ODk4MzMwNjg4NDc3LDMzLjEwMTMxNDU0NDY3NzczNF19LHsibWVzaCI6NTcsIm5hbWUiOiJDeWJlcnRyb24gUGxhemEiLCJyb3RhdGlvbiI6WzAsLTAuNDk3Nzg2NzkwMTMyNTIyNiwwLDAuODY3Mjk5NDM3NTIyODg4Ml0sInRyYW5zbGF0aW9uIjpbMTAzLjc3MzEzMjMyNDIxODc1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtNjEuMjAzMzg4MjE0MTExMzNdfSx7Im1lc2giOjU4LCJuYW1lIjoiVHdlbHZlIE9ha3MgVG93ZXIiLCJyb3RhdGlvbiI6WzAsLTAuOTEzNTMxNTQxODI0MzQwOCwwLDAuNDA2NzY3OTk0MTY1NDIwNTNdLCJ0cmFuc2xhdGlvbiI6WzkwLjk5OTAyMzQzNzUsMy45MjU3ODk4MzMwNjg4NDc3LDgxLjI5NzU3NjkwNDI5Njg4XX0seyJtZXNoIjo2MCwibmFtZSI6IkhvZ3NtZWFkZSBUb3dlciIsInJvdGF0aW9uIjpbMCwtMC45NTM1NTQwOTM4Mzc3MzgsMCwwLjMwMTIyMTgxNzczMTg1NzNdLCJ0cmFuc2xhdGlvbiI6WzcwLjg3MDQxNDczMzg4NjcyLDMuOTI1Nzg5ODMzMDY4ODQ3NywxMDAuMzU2Njg5NDUzMTI1XX0seyJtZXNoIjo2MiwibmFtZSI6IkNvc21vcG9saXMiLCJyb3RhdGlvbiI6WzAsMC4xODA4Nzk4NjExMTY0MDkzLDAsMC45ODM1MDUxODk0MTg3OTI3XSwidHJhbnNsYXRpb24iOls0OS43MzQ0NjY1NTI3MzQzNzUsMy45MjU3ODk4MzMwNjg4NDc3LDExMi42NzMzODU2MjAxMTcxOV19LHsibWVzaCI6NjUsIm5hbWUiOiJJbmZpbml0eSBXb3JsZCIsInJvdGF0aW9uIjpbMCwwLjA0NDA2ODE0Mjc3MTcyMDg4NiwwLDAuOTk5MDI4NTAzODk0ODA1OV0sInRyYW5zbGF0aW9uIjpbLTguODM2MjA4MzQzNTA1ODYsMy45MjU3ODk4MzMwNjg4NDc3LC03OS45NjkzMjk4MzM5ODQzOF19LHsibWVzaCI6NjcsIm5hbWUiOiJUaGUgS25pZ2h0cyBUb3dlciIsInJvdGF0aW9uIjpbMCwtMC40OTY2Mzg1MzY0NTMyNDcwNywwLDAuODY3OTU3NDcyODAxMjA4NV0sInRyYW5zbGF0aW9uIjpbNzAuNjM1MjYxNTM1NjQ0NTMsMy45MjU3ODk4MzMwNjg4NDc3LC0zMS40ODE5MTA3MDU1NjY0MDZdfSx7Im1lc2giOjY5LCJuYW1lIjoiU3RlbGxhciB0b3dlciIsInJvdGF0aW9uIjpbMCwtMC42NzE1NjcwODI0MDUwOTAzLDAsMC43NDA5NDM3Mjk4Nzc0NzE5XSwidHJhbnNsYXRpb24iOls3Ny41ODE4MzI4ODU3NDIxOSwzLjkyNTc4OTgzMzA2ODg0NzcsLTQuNzM4ODk2MzY5OTM0MDgyXX0seyJtZXNoIjozMiwibmFtZSI6IlRoZSBGb3JnZSIsInJvdGF0aW9uIjpbMCwtMC4yMTM5MzY0MzMxOTYwNjc4LDAsMC45NzY4NDc1ODkwMTU5NjA3XSwic2NhbGUiOlsxMi4xODM3MjQ0MDMzODEzNDgsMTIuMTgzNzI0NDAzMzgxMzQ4LDEyLjE4MzcyNDQwMzM4MTM0OF0sInRyYW5zbGF0aW9uIjpbNTMuMjg5NTY2MDQwMDM5MDYsMTkuNjQ2Mjg2MDEwNzQyMTg4LC0xMTIuNzc4OTY4ODExMDM1MTZdfSx7Im1lc2giOjcxLCJuYW1lIjoiR3Jhdml0eSBDZW50cmUiLCJyb3RhdGlvbiI6WzAsLTAuMzY4NjE4MzA5NDk3ODMzMjUsMCwwLjkyOTU4MDg2NzI5MDQ5NjhdLCJzY2FsZSI6WzkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4XSwidHJhbnNsYXRpb24iOls4NS42MTI5MjI2Njg0NTcwMywxMC4xODQ3OTcyODY5ODczMDUsLTg2Ljk1MDUwMDQ4ODI4MTI1XX0seyJtZXNoIjo3MywibmFtZSI6Ik15c3RlcmlhIiwicm90YXRpb24iOlswLC0wLjg4NTA0MTc3MzMxOTI0NDQsMCwwLjQ2NTUxMTYyMDA0NDcwODI1XSwic2NhbGUiOls0LjAwNjMyNjE5ODU3Nzg4MSw0LjAwNjMyNjE5ODU3Nzg4MSw0LjAwNjMyNjE5ODU3Nzg4MV0sInRyYW5zbGF0aW9uIjpbOTguMzk1MTU2ODYwMzUxNTYsMy45MjU3ODk4MzMwNjg4NDc3LDYxLjY4Mzg4NzQ4MTY4OTQ1XX0seyJtZXNoIjo3NiwibmFtZSI6IkRhcmsgTGFuZCBGb3J0cmVzcyIsInJvdGF0aW9uIjpbMCwtMC42NTU3OTc4MzkxNjQ3MzM5LDAsMC43NTQ5MzY1NzU4ODk1ODc0XSwic2NhbGUiOls4LjM1ODI0Nzc1Njk1ODAwOCw4LjM1ODI0Nzc1Njk1ODAwOCw4LjM1ODI0Nzc1Njk1ODAwOF0sInRyYW5zbGF0aW9uIjpbMTE4LjMzODkxMjk2Mzg2NzE5LDE2LjE3NjA3NDk4MTY4OTQ1MywtMTkuNjE3NDI0MDExMjMwNDddfSx7Im1lc2giOjI3LCJuYW1lIjoiQXJlbmEgV29ybGQiLCJyb3RhdGlvbiI6WzAsLTAuNTc1MjAzODk1NTY4ODQ3NywwLDAuODE4MDEwMDMyMTc2OTcxNF0sInNjYWxlIjpbOS4xNDE1OTg3MDE0NzcwNSw5LjE0MTU5ODcwMTQ3NzA1LDkuMTQxNTk4NzAxNDc3MDVdLCJ0cmFuc2xhdGlvbiI6WzExMi40MTgwMTQ1MjYzNjcxOSw1LjIzNzIyNjk2MzA0MzIxMywtNDEuMzA3MTg2MTI2NzA4OTg0XX0seyJtZXNoIjo5MSwibmFtZSI6Ik1hcnNwb3N0Iiwicm90YXRpb24iOlswLC0wLjEwNDIzODAyNTg0NDA5NzE0LDAsMC45OTQ1NTIzNzM4ODYxMDg0XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMjEuNjc5Mjk0NTg2MTgxNjQsNC4yMTg3ODc2NzAxMzU0OTgsLTExNS4zMzc2MjM1OTYxOTE0XX0seyJtZXNoIjo5MywibmFtZSI6IkkgVG9sZCBZb3UgU28iLCJyb3RhdGlvbiI6WzAsMC45NzQ4ODg5MjA3ODM5OTY2LDAsMC4yMjI2OTE4NDg4NzQwOTIxXSwic2NhbGUiOlswLjg3NDkzNTI2OTM1NTc3MzksMC44NzQ5MzUzMjg5NjA0MTg3LDAuODc0OTM1MjY5MzU1NzczOV0sInRyYW5zbGF0aW9uIjpbMzQuNTMwMTgxODg0NzY1NjI1LDQuMjE4Nzg3NjcwMTM1NDk4LC02OS42NTExMzgzMDU2NjQwNl19LHsibWVzaCI6OTUsIm5hbWUiOiJQYWxhY2UgQXJjYWRlIiwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMTA3LjE2NDI2ODQ5MzY1MjM0LDQuMjE4Nzg3NjcwMTM1NDk4LDQ4LjUxNzA0MDI1MjY4NTU1XX0seyJtZXNoIjo1MywibmFtZSI6IkNvbW1hbmQgVG93ZXIiLCJyb3RhdGlvbiI6WzAsLTEsMCwxLjYyOTIwNjg0OTQyOTQ2NTRlLTA3XSwidHJhbnNsYXRpb24iOlstMTkuMzExNjEzMDgyODg1NzQyLDMuOTI1Nzg5ODMzMDY4ODQ3NywxNy43MTgzODk1MTExMDg0XX0seyJtZXNoIjo0OSwibmFtZSI6Ik9iZXJvbiIsInJvdGF0aW9uIjpbMCwwLjY0MDE1NzQwMTU2MTczNzEsMCwwLjc2ODI0Mzc4OTY3Mjg1MTZdLCJ0cmFuc2xhdGlvbiI6Wy03NS4zOTY2ODI3MzkyNTc4MSwzLjkyNTc4OTgzMzA2ODg0NzcsLTE5LjcyNDIwMTIwMjM5MjU3OF19LHsibWVzaCI6NTEsIm5hbWUiOiJSYXp6Z2FyZCIsInJvdGF0aW9uIjpbMCwwLjQzNjA2MzY3NzA3MjUyNSwwLDAuODk5OTE1ODE0Mzk5NzE5Ml0sInRyYW5zbGF0aW9uIjpbLTkzLjM5Nzg1MDAzNjYyMTEsMy45MjU3ODk4MzMwNjg4NDc3LC04MS4xNTQzMjczOTI1NzgxMl19LHsibWVzaCI6NTUsIm5hbWUiOiJTa3lyaW0gUmVzb3J0Iiwicm90YXRpb24iOlswLDAuNTgzMTM2OTc1NzY1MjI4MywwLDAuODEyMzczODc2NTcxNjU1M10sInRyYW5zbGF0aW9uIjpbLTEwOS4zNzg5MzY3Njc1NzgxMiwzLjkyNTc4OTgzMzA2ODg0NzcsLTQ4LjExMjY5Mzc4NjYyMTA5NF19LHsibWVzaCI6NTcsIm5hbWUiOiJDYXBpdGFsIEhpbGwgSG90ZWwiLCJyb3RhdGlvbiI6WzAsMC44NzQ2MDcwMjY1NzY5OTU4LDAsMC40ODQ4MzI1ODQ4NTc5NDA3XSwidHJhbnNsYXRpb24iOlstMTAxLjkwNjg3NTYxMDM1MTU2LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw2NC4yNjI3NzkyMzU4Mzk4NF19LHsibWVzaCI6NTgsIm5hbWUiOiJUaGUgSXJvbiBUb3dlciIsInJvdGF0aW9uIjpbMCwwLjI3MjY3NjQwODI5MDg2MzA0LDAsMC45NjIxMDU4MTA2NDIyNDI0XSwidHJhbnNsYXRpb24iOlstMzcuNDE3OTg0MDA4Nzg5MDYsMy45MjU3ODk4MzMwNjg4NDc3LC02Ny41MTMwOTk2NzA0MTAxNl19LHsibWVzaCI6NjAsIm5hbWUiOiJQZWFjaCBUcmVlcyBUb3dlciIsInJvdGF0aW9uIjpbMCwwLjI4NDIzMjY0NjIyNjg4MjkzLDAsMC45NTg3NTUzMTQzNTAxMjgyXSwidHJhbnNsYXRpb24iOlstNjguNDkyMTk1MTI5Mzk0NTMsMy45MjU3ODk4MzMwNjg4NDc3LC0xMDIuMjc2MjUyNzQ2NTgyMDNdfSx7Im1lc2giOjYyLCJuYW1lIjoiVHJhbnF1aWxpdHkiLCJyb3RhdGlvbiI6WzAsLTAuOTg2NTYzNjIyOTUxNTA3NiwwLDAuMTYzMzc3NjQyNjMxNTMwNzZdLCJ0cmFuc2xhdGlvbiI6Wy00OS42Mjk0NTE3NTE3MDg5ODQsMy45MjU3ODk4MzMwNjg4NDc3LC0xMTIuODk3Mjc3ODMyMDMxMjVdfSx7Im1lc2giOjMxLCJuYW1lIjoiTG9va291dCBUb3dlciIsInJvdGF0aW9uIjpbMCwwLjA2MjI4NDc2MDE3NzEzNTQ3LDAsMC45OTgwNTg0OTc5MDU3MzEyXSwidHJhbnNsYXRpb24iOlstMjUuMDUzNzI2MTk2Mjg5MDYyLDMuOTI1Nzg5ODMzMDY4ODQ3NywtMTIwLjA0NjM2MzgzMDU2NjRdfSx7Im1lc2giOjY1LCJuYW1lIjoiU3BvcnRzIFBsYW5ldCIsInJvdGF0aW9uIjpbMCwwLjc3ODcyOTQ5ODM4NjM4MzEsMCwwLjYyNzM1OTg2NzA5NTk0NzNdLCJ0cmFuc2xhdGlvbiI6Wy0xMjEuNzk5MTYzODE4MzU5MzgsMy45MjU3ODk4MzMwNjg4NDc3LDI0LjYzOTY1OTg4MTU5MTc5N119LHsibWVzaCI6NjcsIm5hbWUiOiJHcmV5d2F0ZXIgV2F0Y2ggVG93ZXIiLCJyb3RhdGlvbiI6WzAsMC45NzUwMzgxNzA4MTQ1MTQyLDAsMC4yMjIwMzcyNDA4NjI4NDYzN10sInRyYW5zbGF0aW9uIjpbLTU5LjI0NTMzMDgxMDU0Njg3NSwzLjkyNTc4OTgzMzA2ODg0NzcsMTA3LjcwNjMxNDA4NjkxNDA2XX0seyJtZXNoIjo2OSwibmFtZSI6Ik1pZHdheSIsInJvdGF0aW9uIjpbMCwwLjc0NzExMTQzOTcwNDg5NSwwLDAuNjY0Njk4ODk4NzkyMjY2OF0sInRyYW5zbGF0aW9uIjpbLTc3LjQ4MTEyNDg3NzkyOTY5LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw2LjE3MDM0NDM1MjcyMjE2OF19LHsibWVzaCI6MzIsIm5hbWUiOiJNODEiLCJyb3RhdGlvbiI6WzAsMC44NjkyMDA3NjYwODY1Nzg0LDAsMC40OTQ0NTkzNjA4Mzc5MzY0XSwic2NhbGUiOlsxMi4xODM3MjQ0MDMzODEzNDgsMTIuMTgzNzI0NDAzMzgxMzQ4LDEyLjE4MzcyNDQwMzM4MTM0OF0sInRyYW5zbGF0aW9uIjpbLTY4LjEwMDM5NTIwMjYzNjcyLDE5LjY0NjI4NDEwMzM5MzU1NSwzNS43MTA3ODg3MjY4MDY2NF19LHsibWVzaCI6NzAsIm5hbWUiOiJBbmRvcmlhIEhvdXNlIiwicm90YXRpb24iOlswLDAuOTg5ODczMjMwNDU3MzA1OSwwLDAuMTQxOTU0Mzc3MjkzNTg2NzNdLCJzY2FsZSI6WzEwLjA2MDQzODE1NjEyNzkzLDEwLjA2MDQzODE1NjEyNzkzLDEwLjA2MDQzODE1NjEyNzkzXSwidHJhbnNsYXRpb24iOlstMzEuMDM4OTUxODczNzc5Mjk3LDMuOTI1Nzg5ODMzMDY4ODQ3NywxMTQuMTAwMzc5OTQzODQ3NjZdfSx7Im1lc2giOjcxLCJuYW1lIjoiQW5kcm9tZWRhIiwicm90YXRpb24iOlswLDAuOTY5MzU0MTUyNjc5NDQzNCwwLDAuMjQ1NjY3NTAyMjg0MDVdLCJzY2FsZSI6WzkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4XSwidHJhbnNsYXRpb24iOlstMzIuNDY0NDk2NjEyNTQ4ODMsMTAuMTg0Nzk3Mjg2OTg3MzA1LDcwLjg4ODU2NTA2MzQ3NjU2XX0seyJtZXNoIjo3MywibmFtZSI6IkNhbGxpc3RvIiwicm90YXRpb24iOlswLDAuNjY3NjMzNTkzMDgyNDI4LDAsMC43NDQ0OTAwMjc0Mjc2NzMzXSwic2NhbGUiOls0LjAwNjMyNjE5ODU3Nzg4MSw0LjAwNjMyNjE5ODU3Nzg4MSw0LjAwNjMyNjE5ODU3Nzg4MV0sInRyYW5zbGF0aW9uIjpbLTExMy44Mjk4ODczOTAxMzY3MiwzLjkyNTc4OTgzMzA2ODg0NzcsLTE2LjM5NjIxMTYyNDE0NTUwOF19LHsibWVzaCI6NzYsIm5hbWUiOiJIb25leWR1a2VzIiwicm90YXRpb24iOlswLC0wLjk5OTEwMjUzMjg2MzYxNjksMCwwLjA0MjM1NjQ5NDgxNDE1NzQ4Nl0sInNjYWxlIjpbOC4zNTgyNDc3NTY5NTgwMDgsOC4zNTgyNDc3NTY5NTgwMDgsOC4zNTgyNDc3NTY5NTgwMDhdLCJ0cmFuc2xhdGlvbiI6WzIuODkzODQ0MzY2MDczNjA4NCwxNi4xNzYwNzQ5ODE2ODk0NTMsNzkuMTE0NDYzODA2MTUyMzRdfSx7Im1lc2giOjI3LCJuYW1lIjoiVGhlIEZvdXJ0aCBEaW1lbnNpb24iLCJyb3RhdGlvbiI6WzAsMC44MzAwNDA2MzM2Nzg0MzYzLDAsMC41NTc3MDMwMTgxODg0NzY2XSwic2NhbGUiOls5LjE0MTU5Nzc0NzgwMjczNCw5LjE0MTU5ODcwMTQ3NzA1LDkuMTQxNTk3NzQ3ODAyNzM0XSwidHJhbnNsYXRpb24iOlstMTEwLjU2MjYyOTY5OTcwNzAzLDUuMjM3MjI2OTYzMDQzMjEzLDQ2LjA0MzQ0NTU4NzE1ODJdfSx7Im1lc2giOjkzLCJuYW1lIjoiSW50ZXJzdGVsbGFybGFuZCIsInJvdGF0aW9uIjpbMCwtMC4zODM2MzM1NTM5ODE3ODEsMCwwLjkyMzQ4NTM5ODI5MjU0MTVdLCJzY2FsZSI6WzAuODc0OTM1MjY5MzU1NzczOSwwLjg3NDkzNTMyODk2MDQxODcsMC44NzQ5MzUyNjkzNTU3NzM5XSwidHJhbnNsYXRpb24iOlstODguNTEyNjgwMDUzNzEwOTQsNC4yMTg3ODc2NzAxMzU0OTgsODQuNjA0NTIyNzA1MDc4MTJdfSx7Im1lc2giOjk1LCJuYW1lIjoiUmVzZWFyY2ggQmFzZSIsInJvdGF0aW9uIjpbMCwwLjk5OTk5NTUyOTY1MTY0MTgsMCwwLjAwMjk5NTQ3NDk2MjUxNzYxOV0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbLTY2LjUyMTgyNzY5Nzc1MzksNC4yMTg3ODc2NzAxMzU0OTgsLTQzLjMyNjE3MTg3NV19LHsibWVzaCI6NzMsIm5hbWUiOiJDYXByaWNhIiwicm90YXRpb24iOlswLDAuNjY3NjMzNTkzMDgyNDI4LDAsMC43NDQ0OTAwMjc0Mjc2NzMzXSwic2NhbGUiOls0LjAwNjMyNjE5ODU3Nzg4MSw0LjAwNjMyNjE5ODU3Nzg4MSw0LjAwNjMyNjE5ODU3Nzg4MV0sInRyYW5zbGF0aW9uIjpbLTEyNi4yNjA0MTQxMjM1MzUxNiwzLjkyNTc4OTgzMzA2ODg0NzcsLTE3Ljg5Nzg4NjI3NjI0NTExN119LHsibWVzaCI6NzAsIm5hbWUiOiJBbmRvdmVyIFN0YXRpb24iLCJyb3RhdGlvbiI6WzAsMC45OTY4ODk3MTA0MjYzMzA2LDAsMC4wNzg4MDkzMDYwMjU1MDUwN10sInNjYWxlIjpbMTAuMDYwNDM4MTU2MTI3OTMsMTAuMDYwNDM4MTU2MTI3OTMsMTAuMDYwNDM4MTU2MTI3OTNdLCJ0cmFuc2xhdGlvbiI6Wy0xNi4zMjY3NTc0MzEwMzAyNzMsMy45MjU3ODk4MzMwNjg4NDc3LDExNy4xMTQyNTc4MTI1XX0seyJtZXNoIjo5MSwibmFtZSI6IlZhbGhhbGxhIiwicm90YXRpb24iOlswLDAuOTkzODA2NDgxMzYxMzg5MiwwLDAuMTExMTI0MzU5MDcxMjU0NzNdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyOS42MzY5NzYyNDIwNjU0Myw0LjIxODc4NzY3MDEzNTQ5OCwtMTI1LjcxNzIwODg2MjMwNDY5XX0seyJtZXNoIjozMywibmFtZSI6IlJvZ3VlIDIiLCJyb3RhdGlvbiI6WzAsMC41NDg1ODU1OTM3MDA0MDg5LDAsMC44MzYwOTQzNzk0MjUwNDg4XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMjk2LjA2MjU2MTAzNTE1NjI1LDQuMjE4Nzg3NjcwMTM1NDk4LDE0Ny4wMzkxMjM1MzUxNTYyNV19LHsibWVzaCI6MzQsIm5hbWUiOiJCbG9jayBaUDEiLCJyb3RhdGlvbiI6WzAsMC44MDkzMzc3MzUxNzYwODY0LDAsMC41ODczNDM2MzMxNzQ4OTYyXSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMzE1LjY1MDkzOTk0MTQwNjI1LDQuMjE4Nzg3NjcwMTM1NDk4LC04MS42MDQwMzQ0MjM4MjgxMl19LHsibWVzaCI6MzUsIm5hbWUiOiJQYW5kb3JhIENlbnRyYWwiLCJyb3RhdGlvbiI6WzAsMC42MTM3NjQ1MjQ0NTk4Mzg5LDAsMC43ODk0ODkxNTAwNDczMDIyXSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMzEyLjQzNzk4ODI4MTI1LDQuMjE4Nzg3NjcwMTM1NDk4LDgxLjc5NTY1NDI5Njg3NV19LHsibWVzaCI6MzYsIm5hbWUiOiJDYW5pcyBNYWpvciBDZW50cmUiLCJyb3RhdGlvbiI6WzAsMC44NDM3MzI3NzQyNTc2NTk5LDAsMC41MzY3NjM2MDg0NTU2NThdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyODkuNjA5NzcxNzI4NTE1Niw0LjIxODc4NzY3MDEzNTQ5OCwtMTQzLjEwNzE0NzIxNjc5Njg4XX0seyJtZXNoIjozNywibmFtZSI6Ik5ldXRyb24gSG91c2UiLCJyb3RhdGlvbiI6WzAsMC42NzYzMTU2NjUyNDUwNTYyLDAsMC43MzY2MTE5NjIzMTg0MjA0XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMzE2Ljg2Nzc5Nzg1MTU2MjUsNC4yMTg3ODc2NzAxMzU0OTgsNjUuMTgzMTA1NDY4NzVdfSx7Im1lc2giOjM4LCJuYW1lIjoiSGlsbCBIb3VzZSIsInJvdGF0aW9uIjpbMCwwLjg0MzczMjc3NDI1NzY1OTksMCwwLjUzNjc2MzYwODQ1NTY1OF0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI4NS4yMTEzMDM3MTA5Mzc1LDQuMjE4Nzg3NjcwMTM1NDk4LC0xNTUuNDI3OTE3NDgwNDY4NzVdfSx7Im1lc2giOjM5LCJuYW1lIjoiU3BpcmEiLCJyb3RhdGlvbiI6WzAsMC41NDg1ODU1OTM3MDA0MDg5LDAsMC44MzYwOTQzNzk0MjUwNDg4XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMjk4LjQ4MzgyNTY4MzU5Mzc1LDQuMjE4Nzg3NjcwMTM1NDk4LDEzNy40OTY0NTk5NjA5Mzc1XX0seyJtZXNoIjo0MCwibmFtZSI6Iklyb25mb3JnZSBTdGF0aW9uIiwicm90YXRpb24iOlswLDAuODA5MzM3NzM1MTc2MDg2NCwwLDAuNTg3MzQzNjMzMTc0ODk2Ml0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzMxMS4xMzc3ODY4NjUyMzQ0LDQuMjE4Nzg3NjcwMTM1NDk4LC05MC4zNTM2MDcxNzc3MzQzOF19LHsibWVzaCI6NDEsIm5hbWUiOiJOR0MgMzg0MiIsInJvdGF0aW9uIjpbMCwwLjYxMzc2NDUyNDQ1OTgzODksMCwwLjc4OTQ4OTE1MDA0NzMwMjJdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlszMDQuOTI3NzAzODU3NDIxOSw0LjIxODc4NzY3MDEzNTQ5OCwxMTQuMDM4MzYwNTk1NzAzMTJdfSx7Im1lc2giOjQyLCJuYW1lIjoiTWFyaW5lciBCYXkiLCJyb3RhdGlvbiI6WzAsMC44MDkzMzc3MzUxNzYwODY0LDAsMC41ODczNDM2MzMxNzQ4OTYyXSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMzAyLjY4OTM5MjA4OTg0Mzc1LDQuMjE4Nzg3NjcwMTM1NDk4LC0xMTEuMTk4NjY5NDMzNTkzNzVdfSx7Im1lc2giOjQzLCJuYW1lIjoiU29sYW5hJ3MgcGxhY2UiLCJyb3RhdGlvbiI6WzAsMC42MTM3NjQ1MjQ0NTk4Mzg5LDAsMC43ODk0ODkxNTAwNDczMDIyXSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMzEyLjc5ODUyMjk0OTIxODc1LDQuMjE4Nzg3NjcwMTM1NDk4LDkwLjQxMzIzODUyNTM5MDYyXX0seyJtZXNoIjo0NCwibmFtZSI6IkJvbHZhbmdlciIsInJvdGF0aW9uIjpbMCwwLjg0MzczMjc3NDI1NzY1OTksMCwwLjUzNjc2MzYwODQ1NTY1OF0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI5NS4zNTIzODY0NzQ2MDk0LDQuMjE4Nzg3NjcwMTM1NDk4LC0xMzYuNjcxNzUyOTI5Njg3NV19LHsibWVzaCI6NDUsIm5hbWUiOiJDeWJlcnRyb24gU3RhdGlvbiIsInJvdGF0aW9uIjpbMCwwLjYxMzc2NDUyNDQ1OTgzODksMCwwLjc4OTQ4OTE1MDA0NzMwMjJdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlszMDguNDg4NjQ3NDYwOTM3NSw0LjIxODc4NzY3MDEzNTQ5OCwxMDEuODk3OTk0OTk1MTE3MTldfSx7Im1lc2giOjQ2LCJuYW1lIjoiS2FuZSBIb3RlbCIsInJvdGF0aW9uIjpbMCwwLjgwOTMzNzczNTE3NjA4NjQsMCwwLjU4NzM0MzYzMzE3NDg5NjJdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyOTkuMjAzOTc5NDkyMTg3NSw0LjIxODc4NzY3MDEzNTQ5OCwtMTIzLjM2MDkwMDg3ODkwNjI1XX0seyJtZXNoIjo0NywibmFtZSI6IkJhZyBFbmQgTWFuc2lvbiIsInJvdGF0aW9uIjpbMCwwLjU0ODU4NTU5MzcwMDQwODksMCwwLjgzNjA5NDM3OTQyNTA0ODhdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlszMDEuMDU3NzY5Nzc1MzkwNiw0LjIxODc4NzY3MDEzNTQ5OCwxMjYuMzg1OTQwNTUxNzU3ODFdfSx7Im1lc2giOjQ4LCJuYW1lIjoiTWFmZmVpIDIiLCJyb3RhdGlvbiI6WzAsMC44MDkzMzc3MzUxNzYwODY0LDAsMC41ODczNDM2MzMxNzQ4OTYyXSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMzA1LjY5OTU1NDQ0MzM1OTQsNC4yMTg3ODc2NzAxMzU0OTgsLTEwMC4zNzgzNTY5MzM1OTM3NV19LHsibWVzaCI6NDksIm5hbWUiOiJYLTA1Iiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbNDAxLjA1MTg0OTM2NTIzNDQsMy45MjU3ODk4MzMwNjg4NDc3LDE3NS4wNDM3MTY0MzA2NjQwNl19LHsibWVzaCI6NTAsIm5hbWUiOiJUaGUgVmluZXdvb2QgQnVpbGRpbmciLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4Mjg2ODk1NzUyLDAsMC43MDcxMDY4Mjg2ODk1NzUyXSwidHJhbnNsYXRpb24iOls0ODguNjgyNDM0MDgyMDMxMjUsMy45MjU3ODk4MzMwNjg4NDc3LC0xODkuMjMxNTA2MzQ3NjU2MjVdfSx7Im1lc2giOjUxLCJuYW1lIjoiUGFuZG9yYSBMYW5kaW5nIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbMzk2LjAwNTQ2MjY0NjQ4NDQsMy45MjU3ODk4MzMwNjg4NDc3LC0xMjMuOTY3NzQyOTE5OTIxODhdfSx7Im1lc2giOjUyLCJuYW1lIjoiRHJhZ29uc3RvbmUgQ2FwaXRhbCIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzQ4My42MzYwNzc4ODA4NTk0LDMuOTI1Nzg5ODMzMDY4ODQ3NywyMjMuNDI2MTQ3NDYwOTM3NV19LHsibWVzaCI6NTMsIm5hbWUiOiJUaGUgR3JlYXQgRXhwYW5zZSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzM4MS4yMzYyNjcwODk4NDM3NSwzLjkyNTc4OTgzMzA2ODg0NzcsLTE3My43NTkwOTQyMzgyODEyNV19LHsibWVzaCI6NTQsIm5hbWUiOiJNaW5pc3RyeSBvZiBNYWdpYyIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzQ2OC44NjY5MTI4NDE3OTY5LDMuOTI1Nzg5ODMzMDY4ODQ3NywxNzMuNjM0NzY1NjI1XX0seyJtZXNoIjo1NSwibmFtZSI6IlpvcmdzIFBsYWNlIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbNDAxLjk5MTk3Mzg3Njk1MzEsMy45MjU3ODk4MzMwNjg4NDc3LC0yMTkuODg3ODQ3OTAwMzkwNjJdfSx7Im1lc2giOjU2LCJuYW1lIjoiWCBSIFBhbGFjZSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzQ4OS42MjI1MjgwNzYxNzE5LDMuOTI1Nzg5ODMzMDY4ODQ3NywxMjcuNTA1OTgxNDQ1MzEyNV19LHsibWVzaCI6NTcsIm5hbWUiOiJUaGUgQWxwaGEiLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4Mjg2ODk1NzUyLDAsMC43MDcxMDY4Mjg2ODk1NzUyXSwidHJhbnNsYXRpb24iOls0MDQuMDQ3OTEyNTk3NjU2MjUsMy45MjU3ODk4MzMwNjg4NDc3LDE0OC45ODI1Mjg2ODY1MjM0NF19LHsibWVzaCI6NTgsIm5hbWUiOiJMeXJhIEdhbGF4eSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzM5OS42OTI4MTAwNTg1OTM3NSwzLjkyNTc4OTgzMzA2ODg0NzcsMTIxLjI2NzM5NTAxOTUzMTI1XX0seyJtZXNoIjo1OSwibmFtZSI6IlZvbGFudGlzIEJheSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzQ4Ny4zMjMzNjQyNTc4MTI1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMjM2LjkyNjg3OTg4MjgxMjVdfSx7Im1lc2giOjYwLCJuYW1lIjoiUmF2ZW5ob2xtIFRvd2VyIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbMzk5LjMzNzYxNTk2Njc5NjksMy45MjU3ODk4MzMwNjg4NDc3LDkxLjE3MjM2MzI4MTI1XX0seyJtZXNoIjo2MSwibmFtZSI6IlRoZSBDbG92ZXJmaWVsZCIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzQ4Ni45NjgyNjE3MTg3NSwzLjkyNTc4OTgzMzA2ODg0NzcsLTI2My44NTk2MTkxNDA2MjVdfSx7Im1lc2giOjYyLCJuYW1lIjoiTWV0cm9wb2xpcyBTdGF0aW9uIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbMzk3LjQxNjgwOTA4MjAzMTI1LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw2NS4zMjI5OTgwNDY4NzVdfSx7Im1lc2giOjYzLCJuYW1lIjoiVm9nc3BoZXJlIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbNDg1LjA0NzM2MzI4MTI1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMjg1LjkzODcyMDcwMzEyNV19LHsibWVzaCI6MzEsIm5hbWUiOiJTYW50YSBLYXRyaW5hIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbMzk2LjM3MjE5MjM4MjgxMjUsMy45MjU3ODk4MzMwNjg4NDc3LDMyLjM5NDM0ODE0NDUzMTI1XX0seyJtZXNoIjo2NCwibmFtZSI6IkNhcmluYSBUb3dlciIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzQ4NC4wMDI4MDc2MTcxODc1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMzEzLjM5NDI4NzEwOTM3NV19LHsibWVzaCI6NjUsIm5hbWUiOiJUaGUgRW50ZXJwcmlzZSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzM5NS4yNTgxNDgxOTMzNTk0LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMzEuODM2NTQ3ODUxNTYyNV19LHsibWVzaCI6NjYsIm5hbWUiOiJaaWdneWxhbmQiLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4Mjg2ODk1NzUyLDAsMC43MDcxMDY4Mjg2ODk1NzUyXSwidHJhbnNsYXRpb24iOls0ODIuODg4NzkzOTQ1MzEyNSwzLjkyNTc4OTgzMzA2ODg0NzcsLTM0OC4yNjA2MjAxMTcxODc1XX0seyJtZXNoIjo2NywibmFtZSI6Ik9seW1wdXMgSGVpZ2h0cyBUb3dlciIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzM5OS44MzQ2NTU3NjE3MTg3NSwzLjkyNTc4OTgzMzA2ODg0NzcsLTY4LjE2MzIwODAwNzgxMjVdfSx7Im1lc2giOjY4LCJuYW1lIjoiQ2FwaXRhbCBUb3dlciIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzQ4Ny40NjUyNDA0Nzg1MTU2LDMuOTI1Nzg5ODMzMDY4ODQ3NywtNDMzLjY3Mjc5MDUyNzM0Mzc1XX0seyJtZXNoIjo2OSwibmFtZSI6IlNwb2sgVG93ZXIiLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4Mjg2ODk1NzUyLDAsMC43MDcxMDY4Mjg2ODk1NzUyXSwidHJhbnNsYXRpb24iOlszOTkuODA2NDg4MDM3MTA5NCwzLjkyNTc4OTgzMzA2ODg0NzcsLTk0LjI3OTYzMjU2ODM1OTM4XX0seyJtZXNoIjoyOSwibmFtZSI6IkJvb3N0ZXIgVG93ZXIiLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4Mjg2ODk1NzUyLDAsMC43MDcxMDY4Mjg2ODk1NzUyXSwidHJhbnNsYXRpb24iOls0ODcuNDM3MTAzMjcxNDg0NCwzLjkyNTc4OTgzMzA2ODg0NzcsLTQ2MS43NzQxNjk5MjE4NzVdfSx7Im1lc2giOjMyLCJuYW1lIjoiVGhlIEJyYWRidXJ5IEJ1aWxkaW5nIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInNjYWxlIjpbMTIuMTgzNzI0NDAzMzgxMzQ4LDEyLjE4MzcyNDQwMzM4MTM0OCwxMi4xODM3MjQ0MDMzODEzNDhdLCJ0cmFuc2xhdGlvbiI6WzM5OC41Mzk5NzgwMjczNDM3NSwxOS42NDYyODIxOTYwNDQ5MjIsMzU2LjMwNTgxNjY1MDM5MDZdfSx7Im1lc2giOjcwLCJuYW1lIjoiTm92YSBIUSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJzY2FsZSI6WzEwLjA2MDQzODE1NjEyNzkzLDEwLjA2MDQzODE1NjEyNzkzLDEwLjA2MDQzODE1NjEyNzkzXSwidHJhbnNsYXRpb24iOls0MDQuODA4NzE1ODIwMzEyNSwzLjkyNTc4OTgzMzA2ODg0NzcsMzgzLjMxNTE1NTAyOTI5NjldfSx7Im1lc2giOjcxLCJuYW1lIjoiTmV3dHJvcG9saXMgU3RhdGlvbiIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJzY2FsZSI6WzkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4XSwidHJhbnNsYXRpb24iOls0MDIuMTIzNTA0NjM4NjcxOSwxMC4xODQ3OTcyODY5ODczMDUsMjc5LjIzODcwODQ5NjA5Mzc1XX0seyJtZXNoIjo3MiwibmFtZSI6IlNwZWN0b3IiLCJyb3RhdGlvbiI6WzAsMC43MTcxOTgzNzE4ODcyMDcsMCwwLjY5Njg2OTA3NTI5ODMwOTNdLCJzY2FsZSI6WzYuMzQ3MDE4MjQxODgyMzI0LDMuMTc5MzU5NDM2MDM1MTU2Miw2LjM0NzAxODI0MTg4MjMyNF0sInRyYW5zbGF0aW9uIjpbMzE4Ljc0NDU2Nzg3MTA5Mzc1LDcuMDYyOTUzNDcyMTM3NDUxLC00MC4xNjQxODQ1NzAzMTI1XX0seyJtZXNoIjo3MywibmFtZSI6IlNreW5ldCBDb21wb3VuZCIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJzY2FsZSI6WzQuMDA2MzI2MTk4NTc3ODgxLDQuMDA2MzI2MTk4NTc3ODgxLDQuMDA2MzI2MTk4NTc3ODgxXSwidHJhbnNsYXRpb24iOls0MDYuOTA5NjM3NDUxMTcxOSwzLjkyNTc4OTgzMzA2ODg0NzcsMjQ3Ljg2MjEzNjg0MDgyMDNdfSx7Im1lc2giOjc0LCJuYW1lIjoiUGhhbnRvbSBNYW5vciIsInJvdGF0aW9uIjpbMCwwLjcxNzE5ODM3MTg4NzIwNywwLDAuNjk2ODY5MDc1Mjk4MzA5M10sInNjYWxlIjpbNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTVdLCJ0cmFuc2xhdGlvbiI6WzMxOS4yMDk4MDgzNDk2MDk0LDguNjQ2OTMwNjk0NTgwMDc4LC0yNC41NjExODc3NDQxNDA2MjVdfSx7Im1lc2giOjc1LCJuYW1lIjoiU2FuY3RvcnVtIiwicm90YXRpb24iOlswLDAuOTE1NzU1OTg3MTY3MzU4NCwwLDAuNDAxNzM0OTQ4MTU4MjY0MTZdLCJzY2FsZSI6WzQuODc0Mjc5OTc1ODkxMTEzLDQuODc0Mjc5OTc1ODkxMTEzLDQuODc0Mjc5OTc1ODkxMTEzXSwidHJhbnNsYXRpb24iOlsyNDEuMTk3ODkxMjM1MzUxNTYsOC43ODI0MDAxMzEyMjU1ODYsLTIyMi41MDQyNzI0NjA5Mzc1XX0seyJtZXNoIjo3NiwibmFtZSI6IlNwdXRuaWsgMSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJzY2FsZSI6WzguMzU4MjQ3NzU2OTU4MDA4LDguMzU4MjQ3NzU2OTU4MDA4LDguMzU4MjQ3NzU2OTU4MDA4XSwidHJhbnNsYXRpb24iOls0MDIuMjI1OTUyMTQ4NDM3NSwxNi4xNzYwNzMwNzQzNDA4MiwyMDEuMTgzNzYxNTk2Njc5N119LHsibWVzaCI6NzcsIm5hbWUiOiJFYXN0IEhpZ2giLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4Mjg2ODk1NzUyLDAsMC43MDcxMDY4Mjg2ODk1NzUyXSwic2NhbGUiOlsxMi4xODM3MjQ0MDMzODEzNDgsMTIuMTgzNzI0NDAzMzgxMzQ4LDEyLjE4MzcyNDQwMzM4MTM0OF0sInRyYW5zbGF0aW9uIjpbNDg2LjE3MDUzMjIyNjU2MjUsMTkuNjQ2MjgyMTk2MDQ0OTIyLC0yNS42Nzc4NTY0NDUzMTI1XX0seyJtZXNoIjo3OCwibmFtZSI6IlRoZSBDb3JsZW9uZSdzIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInNjYWxlIjpbMTAuMDYwNDM4MTU2MTI3OTMsMTAuMDYwNDM4MTU2MTI3OTMsMTAuMDYwNDM4MTU2MTI3OTNdLCJ0cmFuc2xhdGlvbiI6WzQ5Mi40MzkzMzEwNTQ2ODc1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMTE2LjY1MjA5OTYwOTM3NV19LHsibWVzaCI6MjgsIm5hbWUiOiJEcmFjbyBIb3VzZSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJzY2FsZSI6WzkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4XSwidHJhbnNsYXRpb24iOls0ODkuNzU0MTUwMzkwNjI1LDEwLjE4NDc5NzI4Njk4NzMwNSwtNjguMDA5NTIxNDg0Mzc1XX0seyJtZXNoIjo3OSwibmFtZSI6IkxvY2tvdXQiLCJyb3RhdGlvbiI6WzAsMC40Njg3Mjg1MTI1MjU1NTg0NywwLDAuODgzMzQyMjY2MDgyNzYzN10sInNjYWxlIjpbNi4zNDcwMTgyNDE4ODIzMjQsMy4xNzkzNTk0MzYwMzUxNTYyLDYuMzQ3MDE4MjQxODgyMzI0XSwidHJhbnNsYXRpb24iOlsyNzMuMjgzODc0NTExNzE4NzUsNy4wNjI5NTM0NzIxMzc0NTEsMTc5LjY0MTEyODU0MDAzOTA2XX0seyJtZXNoIjo4MCwibmFtZSI6IlRoZSBSb29tIG9mIFJlcXVpcmVtZW50Iiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInNjYWxlIjpbNC4wMDYzMjYxOTg1Nzc4ODEsNC4wMDYzMjYxOTg1Nzc4ODEsNC4wMDYzMjYxOTg1Nzc4ODFdLCJ0cmFuc2xhdGlvbiI6WzQ5NC41NDAyODMyMDMxMjUsMy45MjU3ODk4MzMwNjg4NDc3LC05OS4zODYxMDgzOTg0Mzc1XX0seyJtZXNoIjo4MSwibmFtZSI6Ikxha2VzaWRlIFJlc29ydCIsInJvdGF0aW9uIjpbMCwwLjQzMDUxNTk3NDc2MDA1NTU0LDAsMC45MDI1ODMwMDMwNDQxMjg0XSwic2NhbGUiOls0Ljc0ODE3NTYyMTAzMjcxNSw0Ljc0ODE3NTYyMTAzMjcxNSw0Ljc0ODE3NTYyMTAzMjcxNV0sInRyYW5zbGF0aW9uIjpbMjUxLjU2NjE2MjEwOTM3NSw4LjY0NjkzMDY5NDU4MDA3OCwyMTQuNTY4MzQ0MTE2MjEwOTRdfSx7Im1lc2giOjgyLCJuYW1lIjoiU2t5bGFiIiwicm90YXRpb24iOlswLDAuNzE3MTk4NzI5NTE1MDc1NywwLDAuNjk2ODY4Nzc3Mjc1MDg1NF0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbMzE4LjYzMTk4ODUyNTM5MDYsNC4yMTg3ODc2NzAxMzU0OTgsLTU2LjEyMDY2NjUwMzkwNjI1XX0seyJtZXNoIjo4MywibmFtZSI6IlJpc2EgV29ybGQiLCJyb3RhdGlvbiI6WzAsMC44NDM3MzI3NzQyNTc2NTk5LDAsMC41MzY3NjM2MDg0NTU2NThdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyNzQuNjc1NzUwNzMyNDIxOSw0LjIxODc4NzY3MDEzNTQ5OCwtMTY5LjgyMjg0NTQ1ODk4NDM4XX0seyJtZXNoIjo4NCwibmFtZSI6IkNydXN0dWxhIENlbnRyYWwiLCJyb3RhdGlvbiI6WzAsMC42NzYzMTU0MjY4MjY0NzcsMCwwLjczNjYxMjIwMDczNjk5OTVdLCJzY2FsZSI6WzQuODc0Mjc5NDk5MDUzOTU1LDQuODc0Mjc5OTc1ODkxMTEzLDQuODc0Mjc5NDk5MDUzOTU1XSwidHJhbnNsYXRpb24iOlszMjIuMjk3MTQ5NjU4MjAzMSw4Ljc4MjQwMDEzMTIyNTU4NiwxOC4wMjE5NDIxMzg2NzE4NzVdfSx7Im1lc2giOjg1LCJuYW1lIjoiWFJQMzg5Iiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInNjYWxlIjpbOC4zNTgyNDc3NTY5NTgwMDgsOC4zNTgyNDc3NTY5NTgwMDgsOC4zNTgyNDc3NTY5NTgwMDhdLCJ0cmFuc2xhdGlvbiI6WzQ4OS44NTY1NjczODI4MTI1LDE2LjE3NjA3MzA3NDM0MDgyLC0xNjMuMDkxNjc0ODA0Njg3NV19LHsibWVzaCI6ODYsIm5hbWUiOiJSaXZlbmRlbGwgSGVpZ2h0cyIsInJvdGF0aW9uIjpbMCwwLjcxNzE5ODcyOTUxNTA3NTcsMCwwLjY5Njg2ODc3NzI3NTA4NTRdLCJzY2FsZSI6WzEuMDk5OTk5OTA0NjMyNTY4NCwxLjEwMDAwMDAyMzg0MTg1OCwxLjA5OTk5OTkwNDYzMjU2ODRdLCJ0cmFuc2xhdGlvbiI6WzMxNy41Mjc1NTczNzMwNDY5LDQuMjE4Nzg3NjcwMTM1NDk4LC02OC40NzQwOTA1NzYxNzE4OF19LHsibWVzaCI6ODcsIm5hbWUiOiJMViAzOCBQbGFjZSIsInJvdGF0aW9uIjpbMCwwLjQ2ODcyOTEwODU3MjAwNjIsMCwwLjg4MzM0MTk2ODA1OTUzOThdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyODIuMzk3MjE2Nzk2ODc1LDQuMjE4Nzg3NjcwMTM1NDk4LDE2OC40ODc0NzI1MzQxNzk3XX0seyJtZXNoIjo4OCwibmFtZSI6Ikp1bmt5J3MiLCJyb3RhdGlvbiI6WzAsMC42NzYzMTU2NjUyNDUwNTYyLDAsMC43MzY2MTE5NjIzMTg0MjA0XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMzE0LjkyODgzMzAwNzgxMjUsNC4yMTg3ODc2NzAxMzU0OTgsNDcuNDUwNDA4OTM1NTQ2ODc1XX0seyJtZXNoIjo4OSwibmFtZSI6IlJpdmVydW4gUGxhY2UiLCJyb3RhdGlvbiI6WzAsMC41NDg1ODU1OTM3MDA0MDg5LDAsMC44MzYwOTQzNzk0MjUwNDg4XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMjg4LjM0MjQ5ODc3OTI5NjksNC4yMTg3ODc2NzAxMzU0OTgsMTU2Ljg1NjAzMzMyNTE5NTNdfSx7Im1lc2giOjI3LCJuYW1lIjoiVGhlIEZveGdsb3ZlIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInNjYWxlIjpbOS4xNDE1OTg3MDE0NzcwNSw5LjE0MTU5ODcwMTQ3NzA1LDkuMTQxNTk4NzAxNDc3MDVdLCJ0cmFuc2xhdGlvbiI6WzQwMS45Nzg5NzMzODg2NzE5LDUuMjM3MjI2OTYzMDQzMjEzLDIyNS45NzY4ODI5MzQ1NzAzXX0seyJtZXNoIjo5MCwibmFtZSI6IlRyb2xsc2VzdW5kIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInNjYWxlIjpbOS4xNDE1OTg3MDE0NzcwNSw5LjE0MTU5ODcwMTQ3NzA1LDkuMTQxNTk4NzAxNDc3MDVdLCJ0cmFuc2xhdGlvbiI6WzQ4OS42MDk2MTkxNDA2MjUsNS4yMzcyMjY5NjMwNDMyMTMsLTEzOC4yOTg0NjE5MTQwNjI1XX0seyJtZXNoIjo5MSwibmFtZSI6IlRob3IgQ29tcG91bmQiLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4ODgyOTQyMiwwLDAuNzA3MTA2NjQ5ODc1NjQwOV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzQwNi40MDA0ODIxNzc3MzQ0LDQuMjE4Nzg3NjcwMTM1NDk4LC0zNzEuMjczNjIwNjA1NDY4NzVdfSx7Im1lc2giOjkyLCJuYW1lIjoiVHJvbiBIb3VzZSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjg4ODI5NDIyLDAsMC43MDcxMDY2NDk4NzU2NDA5XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbNDk0LjAzMTA5NzQxMjEwOTQsNC4yMTg3ODc2NzAxMzU0OTgsMzAuMzYzODMwNTY2NDA2MjVdfSx7Im1lc2giOjkzLCJuYW1lIjoiVGhlIEVjbGlwc2UiLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4ODgyOTQyMiwwLDAuNzA3MTA2NjQ5ODc1NjQwOV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzM5Mi4zODAwNjU5MTc5Njg3NSw0LjIxODc4NzY3MDEzNTQ5OCwtMjU4LjMwMzg5NDA0Mjk2ODc1XX0seyJtZXNoIjo5NCwibmFtZSI6IlZveWFnZSBCYXNlIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODg4Mjk0MjIsMCwwLjcwNzEwNjY0OTg3NTY0MDldLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOls0ODAuMDEwNjUwNjM0NzY1Niw0LjIxODc4NzY3MDEzNTQ5OCw4OS4wODk5MDQ3ODUxNTYyNV19LHsibWVzaCI6OTUsIm5hbWUiOiJUaGUgRm91bmRyeSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjg4ODI5NDIyLDAsMC43MDcxMDY2NDk4NzU2NDA5XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbNDAyLjg2ODI4NjEzMjgxMjUsNC4yMTg3ODc2NzAxMzU0OTgsLTM0OC41NzQwOTY2Nzk2ODc1XX0seyJtZXNoIjo5NiwibmFtZSI6IlRoZSBTdXBlcm5vdmEiLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4ODgyOTQyMiwwLDAuNzA3MTA2NjQ5ODc1NjQwOV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzQ5MC40OTg4NzA4NDk2MDk0LDQuMjE4Nzg3NjcwMTM1NDk4LDUzLjA2MzUzNzU5NzY1NjI1XX0seyJtZXNoIjozNCwibmFtZSI6IktlcGxlciBQbGFjZSIsInJvdGF0aW9uIjpbMCwtMC41ODAzMzY5MjgzNjc2MTQ3LDAsMC44MTQzNzY0NzM0MjY4MTg4XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMjYyLjc1MTAwNzA4MDA3ODEsNC4yMTg3ODc2NzAxMzU0OTgsLTExOC42OTU0NjUwODc4OTA2Ml19LHsibWVzaCI6MzYsIm5hbWUiOiJIaWdoIENsYXJpdHkgTG9kZ2UiLCJyb3RhdGlvbiI6WzAsLTAuNjYzNjE1NTI0NzY4ODI5MywwLDAuNzQ4MDczODE2Mjk5NDM4NV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI4Ni4xODYwMzUxNTYyNSw0LjIxODc4NzY3MDEzNTQ5OCwtNTUuNTAyMTk3MjY1NjI1XX0seyJtZXNoIjozOCwibmFtZSI6IkF2YWxvbiBIb3VzZSIsInJvdGF0aW9uIjpbMCwtMC42NjM2MTU1MjQ3Njg4MjkzLDAsMC43NDgwNzM4MTYyOTk0Mzg1XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMjg2LjUxMDQ5ODA0Njg3NSw0LjIxODc4NzY3MDEzNTQ5OCwtNDIuNDIzODg5MTYwMTU2MjVdfSx7Im1lc2giOjQwLCJuYW1lIjoiSG9sbG93YXkgSG91c2UiLCJyb3RhdGlvbiI6WzAsLTAuNTgwMzM2OTI4MzY3NjE0NywwLDAuODE0Mzc2NDczNDI2ODE4OF0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI2Ny40MTQ0NTkyMjg1MTU2LDQuMjE4Nzg3NjcwMTM1NDk4LC0xMTAuMDI1MDg1NDQ5MjE4NzVdfSx7Im1lc2giOjQyLCJuYW1lIjoiR290aGNvcnAgUGxhemEiLCJyb3RhdGlvbiI6WzAsLTAuNTgwMzM2OTI4MzY3NjE0NywwLDAuODE0Mzc2NDczNDI2ODE4OF0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI3Ni4yMjEzNDM5OTQxNDA2LDQuMjE4Nzg3NjcwMTM1NDk4LC04OS4zMjg5MTg0NTcwMzEyNV19LHsibWVzaCI6NDQsIm5hbWUiOiJKdW5rIHlhcmQiLCJyb3RhdGlvbiI6WzAsLTAuNjYzNjE1NTI0NzY4ODI5MywwLDAuNzQ4MDczODE2Mjk5NDM4NV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI4Mi43NDQyMzIxNzc3MzQ0LDQuMjE4Nzg3NjcwMTM1NDk4LC02My40MTA3NjY2MDE1NjI1XX0seyJtZXNoIjo0NiwibmFtZSI6IkF6ZXJvdGgiLCJyb3RhdGlvbiI6WzAsLTAuNTgwMzM2OTI4MzY3NjE0NywwLDAuODE0Mzc2NDczNDI2ODE4OF0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI3OS45MTYxMzc2OTUzMTI1LDQuMjE4Nzg3NjcwMTM1NDk4LC03Ny4yMjg2Mzc2OTUzMTI1XX0seyJtZXNoIjo0OCwibmFtZSI6IkVhc3Rmb2xkIiwicm90YXRpb24iOlswLC0wLjU4MDMzNjkyODM2NzYxNDcsMCwwLjgxNDM3NjQ3MzQyNjgxODhdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyNzMuMDI0ODcxODI2MTcxOSw0LjIxODc4NzY3MDEzNTQ5OCwtMTAwLjA5NTY3MjYwNzQyMTg4XX0seyJtZXNoIjo3MiwibmFtZSI6IkJyZWFrd29ybGQiLCJyb3RhdGlvbiI6WzAsLTAuNTA4Nzc5ODIzNzgwMDU5OCwwLDAuODYwODk2NzA2NTgxMTE1N10sInNjYWxlIjpbNi4zNDcwMTc3NjUwNDUxNjYsMy4xNzkzNTk0MzYwMzUxNTYyLDYuMzQ3MDE3NzY1MDQ1MTY2XSwidHJhbnNsYXRpb24iOlsyNDkuMDA0OTg5NjI0MDIzNDQsNy4wNjI5NTM0NzIxMzc0NTEsLTE1NS43NTY3NTk2NDM1NTQ3XX0seyJtZXNoIjo3NCwibmFtZSI6IkdyaWZmaW4gUmVzaWRlbmNlIiwicm90YXRpb24iOlswLC0wLjQxNTg0ODU1MzE4MDY5NDYsMCwwLjkwOTQzMzkwMTMwOTk2N10sInNjYWxlIjpbNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTVdLCJ0cmFuc2xhdGlvbiI6WzIyMy4yOTc0NzAwOTI3NzM0NCw4LjY0NjkzMDY5NDU4MDA3OCwtMTkwLjQ0NTAwNzMyNDIxODc1XX0seyJtZXNoIjo4MiwibmFtZSI6Ik5HQyA0ODg5Iiwicm90YXRpb24iOlswLC0wLjUwODc3OTIyNzczMzYxMjEsMCwwLjg2MDg5NzA2NDIwODk4NDRdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyNTYuMzk1NzUxOTUzMTI1LDQuMjE4Nzg3NjcwMTM1NDk4LC0xNDEuNjE0NjU0NTQxMDE1NjJdfSx7Im1lc2giOjgzLCJuYW1lIjoiQXNnYXJkaWFuIExhbmRpbmciLCJyb3RhdGlvbiI6WzAsLTAuNjYzNjE1NTI0NzY4ODI5MywwLDAuNzQ4MDczODE2Mjk5NDM4NV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI5Mi4wMTU0MTEzNzY5NTMxLDQuMjE4Nzg3NjcwMTM1NDk4LC0yNS40NTU5OTM2NTIzNDM3NV19LHsibWVzaCI6ODYsIm5hbWUiOiJUaGUgSWNlYmVyZyBsb3VuZ2UiLCJyb3RhdGlvbiI6WzAsLTAuNTA4Nzc5MjI3NzMzNjEyMSwwLDAuODYwODk3MDY0MjA4OTg0NF0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI2My4wMjI0NjA5Mzc1LDQuMjE4Nzg3NjcwMTM1NDk4LC0xMzEuMTMwNzA2Nzg3MTA5MzhdfSx7Im1lc2giOjU5LCJuYW1lIjoiV2FrYW5kYSBMYW5kIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbNDg3LjMyMzQyNTI5Mjk2ODc1LDMuOTI1Nzg5ODMzMDY4ODQ3Nyw0MzUuMjk1OTI4OTU1MDc4MV19LHsibWVzaCI6NjEsIm5hbWUiOiJUaW1lIFBvcnRhbCIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzQ4Ni45NjgyMzEyMDExNzE5LDMuOTI1Nzg5ODMzMDY4ODQ3NywzNDguMjE0NzIxNjc5Njg3NV19LHsibWVzaCI6NjMsIm5hbWUiOiJUaXRhbmlhIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbNDg1LjA0NzMzMjc2MzY3MTksMy45MjU3ODk4MzMwNjg4NDc3LDMyNi4xMzU2MjAxMTcxODc1XX0seyJtZXNoIjo2NCwibmFtZSI6IlRoZSBNZXR6IEJ1aWxkaW5nIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbNDg0LjAwMjc3NzA5OTYwOTQsMy45MjU3ODk4MzMwNjg4NDc3LDI5OC42ODAwNTM3MTA5Mzc1XX0seyJtZXNoIjo2NiwibmFtZSI6Ik9kaW4ncyBHcmVhdCBIYWxsIiwicm90YXRpb24iOlswLDAuNzA3MTA2ODI4Njg5NTc1MiwwLDAuNzA3MTA2ODI4Njg5NTc1Ml0sInRyYW5zbGF0aW9uIjpbNDgyLjg4ODc2MzQyNzczNDQsMy45MjU3ODk4MzMwNjg4NDc3LDI2My44MTM3MjA3MDMxMjVdfSx7Im1lc2giOjUwLCJuYW1lIjoiVGhlIE9uZSBUaGF0IEdvdCBBd2F5Iiwicm90YXRpb24iOlswLC0wLjcwNzEwNjU5MDI3MDk5NjEsMCwwLjcwNzEwNjk0Nzg5ODg2NDddLCJ0cmFuc2xhdGlvbiI6WzQ0Ni40Mzg4MTIyNTU4NTk0LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMTg3LjgyNTQwODkzNTU0Njg4XX0seyJtZXNoIjozMCwibmFtZSI6IlRoZSBDcmF0ZXIiLCJyb3RhdGlvbiI6WzAsLTAuNzA3MTA2NTkwMjcwOTk2MSwwLDAuNzA3MTA2OTQ3ODk4ODY0N10sInRyYW5zbGF0aW9uIjpbNDQzLjQ0MjY4Nzk4ODI4MTI1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMTYxLjc2NDEyOTYzODY3MTg4XX0seyJtZXNoIjo1OSwibmFtZSI6Ill1bmthaSBIZWlnaHRzIiwicm90YXRpb24iOlswLC0wLjcwNzEwNjU5MDI3MDk5NjEsMCwwLjcwNzEwNjk0Nzg5ODg2NDddLCJ0cmFuc2xhdGlvbiI6WzQ0Ny43OTc4NTE1NjI1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMTQwLjEzMDA5NjQzNTU0Njg4XX0seyJtZXNoIjo2MSwibmFtZSI6IlN0YXJnYXRlIFN0YXRpb24iLCJyb3RhdGlvbiI6WzAsLTAuNzA3MTA2NTkwMjcwOTk2MSwwLDAuNzA3MTA2OTQ3ODk4ODY0N10sInRyYW5zbGF0aW9uIjpbNDQ4LjE1Mjk4NDYxOTE0MDYsMy45MjU3ODk4MzMwNjg4NDc3LC0xMTMuMTk3MzU3MTc3NzM0MzhdfSx7Im1lc2giOjYzLCJuYW1lIjoiWiBSb29tIiwicm90YXRpb24iOlswLC0wLjcwNzEwNjU5MDI3MDk5NjEsMCwwLjcwNzEwNjk0Nzg5ODg2NDddLCJ0cmFuc2xhdGlvbiI6WzQ1MC4wNzM4ODMwNTY2NDA2LDMuOTI1Nzg5ODMzMDY4ODQ3NywtOTEuMTE4MjU1NjE1MjM0MzhdfSx7Im1lc2giOjY0LCJuYW1lIjoiTmEndmkgTG9va291dCBUb3dlciIsInJvdGF0aW9uIjpbMCwtMC43MDcxMDY1OTAyNzA5OTYxLDAsMC43MDcxMDY5NDc4OTg4NjQ3XSwidHJhbnNsYXRpb24iOls0NTEuMTE4NDM4NzIwNzAzMSwzLjkyNTc4OTgzMzA2ODg0NzcsLTYzLjY2MjY4OTIwODk4NDM3NV19LHsibWVzaCI6NjYsIm5hbWUiOiJUaGUgRmVkZXJhdGlvbiIsInJvdGF0aW9uIjpbMCwtMC43MDcxMDY1OTAyNzA5OTYxLDAsMC43MDcxMDY5NDc4OTg4NjQ3XSwidHJhbnNsYXRpb24iOls0NTIuMjMyNDUyMzkyNTc4MSwzLjkyNTc4OTgzMzA2ODg0NzcsLTI4Ljc5NjM4NjcxODc1XX0seyJtZXNoIjo2OCwibmFtZSI6IlRvcnR1Z2EiLCJyb3RhdGlvbiI6WzAsLTAuNzA3MTA2NTkwMjcwOTk2MSwwLDAuNzA3MTA2OTQ3ODk4ODY0N10sInRyYW5zbGF0aW9uIjpbNDQ3LjY1NjAwNTg1OTM3NSwzLjkyNTc4OTgzMzA2ODg0NzcsNTkuMTQ0NTkyMjg1MTU2MjVdfSx7Im1lc2giOjc3LCJuYW1lIjoiVm95YWdlciIsInJvdGF0aW9uIjpbMCwtMC43MDcxMDY1OTAyNzA5OTYxLDAsMC43MDcxMDY5NDc4OTg4NjQ3XSwic2NhbGUiOlsxMi4xODM3MjQ0MDMzODEzNDgsMTIuMTgzNzI0NDAzMzgxMzQ4LDEyLjE4MzcyNDQwMzM4MTM0OF0sInRyYW5zbGF0aW9uIjpbNDQ4Ljk1MDY1MzA3NjE3MTksMTkuNjQ2MjgyMTk2MDQ0OTIyLC00MDYuMzEyMzc3OTI5Njg3NV19LHsibWVzaCI6NzgsIm5hbWUiOiJTZWN0b3IgOSIsInJvdGF0aW9uIjpbMCwtMC43MDcxMDY1OTAyNzA5OTYxLDAsMC43MDcxMDY5NDc4OTg4NjQ3XSwic2NhbGUiOlsxMC4wNjA0MzgxNTYxMjc5MywxMC4wNjA0MzgxNTYxMjc5MywxMC4wNjA0MzgxNTYxMjc5M10sInRyYW5zbGF0aW9uIjpbNDQyLjY4MTkxNTI4MzIwMzEsMy45MjU3ODk4MzMwNjg4NDc3LC0yNjAuNDA0ODc2NzA4OTg0NF19LHsibWVzaCI6ODAsIm5hbWUiOiJUaXRhbml1bSIsInJvdGF0aW9uIjpbMCwtMC43MDcxMDY1OTAyNzA5OTYxLDAsMC43MDcxMDY5NDc4OTg4NjQ3XSwic2NhbGUiOls0LjAwNjMyNjE5ODU3Nzg4MSw0LjAwNjMyNjE5ODU3Nzg4MSw0LjAwNjMyNjE5ODU3Nzg4MV0sInRyYW5zbGF0aW9uIjpbNDQwLjU4MDk2MzEzNDc2NTYsMy45MjU3ODk4MzMwNjg4NDc3LC0yNzcuNjcwODY3OTE5OTIxOV19LHsibWVzaCI6ODUsIm5hbWUiOiJUaGFuYWdhciIsInJvdGF0aW9uIjpbMCwtMC43MDcxMDY1OTAyNzA5OTYxLDAsMC43MDcxMDY5NDc4OTg4NjQ3XSwic2NhbGUiOls4LjM1ODI0Nzc1Njk1ODAwOCw4LjM1ODI0Nzc1Njk1ODAwOCw4LjM1ODI0Nzc1Njk1ODAwOF0sInRyYW5zbGF0aW9uIjpbNDQ1LjI2NDY3ODk1NTA3ODEsMTYuMTc2MDczMDc0MzQwODIsLTIxMy45NjUzMDE1MTM2NzE4OF19LHsibWVzaCI6OTAsIm5hbWUiOiJTdG9ybXdpbmQiLCJyb3RhdGlvbiI6WzAsLTAuNzA3MTA2NTkwMjcwOTk2MSwwLDAuNzA3MTA2OTQ3ODk4ODY0N10sInNjYWxlIjpbOS4xNDE1OTg3MDE0NzcwNSw5LjE0MTU5ODcwMTQ3NzA1LDkuMTQxNTk4NzAxNDc3MDVdLCJ0cmFuc2xhdGlvbiI6WzQ0NS41MTE2MjcxOTcyNjU2LDUuMjM3MjI2OTYzMDQzMjEzLC0yMzguNzU4NTE0NDA0Mjk2ODhdfSx7Im1lc2giOjU2LCJuYW1lIjoiVmlsbGEgVmlsbGVrdWxhIiwicm90YXRpb24iOlswLC0wLjcwNzEwNjU5MDI3MDk5NjEsMCwwLjcwNzEwNjk0Nzg5ODg2NDddLCJ0cmFuc2xhdGlvbiI6WzQ0Ny4wMzUwMzQxNzk2ODc1LDMuOTI1Nzg5ODMzMDY4ODQ3NywyNjkuODg0ODU3MTc3NzM0NF19LHsibWVzaCI6OTIsIm5hbWUiOiJTZWN0b3IgMTciLCJyb3RhdGlvbiI6WzAsLTAuNzA3MTA2NTkwMjcwOTk2MSwwLDAuNzA3MTA3MDY3MTA4MTU0M10sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzQ1MS43MTI4NjAxMDc0MjE5LDQuMjE4Nzg3NjcwMTM1NDk4LDMyNC4yMzc1NDg4MjgxMjVdfSx7Im1lc2giOjk0LCJuYW1lIjoiVmFseXJpYSBTa3lsYW5kIiwicm90YXRpb24iOlswLC0wLjcwNzEwNjU5MDI3MDk5NjEsMCwwLjcwNzEwNzA2NzEwODE1NDNdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOls0NTYuNjQ2OTcyNjU2MjUsNC4yMTg3ODc2NzAxMzU0OTgsNDEyLjQzNzcxMzYyMzA0NjldfSx7Im1lc2giOjk2LCJuYW1lIjoiVG9hZCBTdG9ybWJhc2UiLCJyb3RhdGlvbiI6WzAsLTAuNzA3MTA2NTkwMjcwOTk2MSwwLDAuNzA3MTA3MDY3MTA4MTU0M10sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzQ0Ni4xNTg2NjA4ODg2NzE5LDQuMjE4Nzg3NjcwMTM1NDk4LDMwMS40MjM3MDYwNTQ2ODc1XX0seyJtZXNoIjo2MSwibmFtZSI6IlZlbnVzIFdvcmxkIiwicm90YXRpb24iOlswLC0wLjcwNzEwNjU5MDI3MDk5NjEsMCwwLjcwNzEwNjk0Nzg5ODg2NDddLCJ0cmFuc2xhdGlvbiI6WzQ0OS42ODkzNjE1NzIyNjU2LDMuOTI1Nzg5ODMzMDY4ODQ3NywyMjMuNzQ1ODAzODMzMDA3OF19LHsibWVzaCI6NjMsIm5hbWUiOiJYYXZpZXIncyIsInJvdGF0aW9uIjpbMCwtMC43MDcxMDY1OTAyNzA5OTYxLDAsMC43MDcxMDY5NDc4OTg4NjQ3XSwidHJhbnNsYXRpb24iOls0NTEuNjEwMjI5NDkyMTg3NSwzLjkyNTc4OTgzMzA2ODg0NzcsMTQ3LjA4NDA0NTQxMDE1NjI1XX0seyJtZXNoIjo2NCwibmFtZSI6Ik5lYnVsYSIsInRyYW5zbGF0aW9uIjpbNDUyLjY1NDc4NTE1NjI1LDMuOTI1Nzg5ODMzMDY4ODQ3NywxMTkuODM4MDQzMjEyODkwNjJdfSx7Im1lc2giOjQ5LCJuYW1lIjoiTmFybmlhIFdvbmRlcmxhbmQiLCJyb3RhdGlvbiI6WzAsLTAuNTk5NzMxMDg3Njg0NjMxMywwLDAuODAwMjAxNTk0ODI5NTU5M10sInRyYW5zbGF0aW9uIjpbMzQ1LjIyNzM1NTk1NzAzMTI1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMTQxLjE1NjMxMTAzNTE1NjI1XX0seyJtZXNoIjo1NywibmFtZSI6IlRoZSBQb3J0YWwiLCJyb3RhdGlvbiI6WzAsLTAuNTcyMTE2NjEzMzg4MDYxNSwwLDAuODIwMTcyMjUwMjcwODQzNV0sInRyYW5zbGF0aW9uIjpbMzM0LjY5MDIxNjA2NDQ1MzEsMy45MjU3ODk4MzMwNjg4NDc3LC0xNjUuNjI2MjUxMjIwNzAzMTJdfSx7Im1lc2giOjU4LCJuYW1lIjoiTHlyYSdzIFdvcmxkIiwicm90YXRpb24iOlswLC0wLjU0MTUwODk3MjY0NDgwNTksMCwwLjg0MDY5NDk2MzkzMjAzNzRdLCJ0cmFuc2xhdGlvbiI6WzMyNi4zNDIyMjQxMjEwOTM3NSwzLjkyNTc4OTgzMzA2ODg0NzcsLTE4Ny41Njk0NTgwMDc4MTI1XX0seyJtZXNoIjo2MCwibmFtZSI6Ik1pZGdhcmQgTGFuZGluZyIsInJvdGF0aW9uIjpbMCwtMC40NzI0OTQ0NTMxOTE3NTcyLDAsMC44ODEzMzM2NDkxNTg0Nzc4XSwidHJhbnNsYXRpb24iOlszMTMuNjg3NjUyNTg3ODkwNiwzLjkyNTc4OTgzMzA2ODg0NzcsLTIxMC44OTY3NTkwMzMyMDMxMl19LHsibWVzaCI6NjIsIm5hbWUiOiJKdXBpdGVyIFN0YXRpb24iLCJyb3RhdGlvbiI6WzAsMC45MjM3MDIwNjExNzYzLDAsMC4zODMxMTE2ODU1MTQ0NTAxXSwidHJhbnNsYXRpb24iOlsyODkuODYzMDY3NjI2OTUzMSwzLjkyNTc4OTgzMzA2ODg0NzcsLTI1MC4wNzc0MjMwOTU3MDMxMl19LHsibWVzaCI6MzEsIm5hbWUiOiJUaGUgQ29udGluZW50YWwiLCJyb3RhdGlvbiI6WzAsMC45MTg2NTcwNjQ0Mzc4NjYyLDAsMC4zOTUwNTU4OTAwODMzMTNdLCJ0cmFuc2xhdGlvbiI6WzMxNy4wOTM4NDE1NTI3MzQ0LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMjgzLjg1NTgwNDQ0MzM1OTRdfSx7Im1lc2giOjMyLCJuYW1lIjoiVGhlIEZyZWVkb20gQ2VudHJlIiwicm90YXRpb24iOlswLDAuMzQ3ODQyNjYzNTI2NTM1MDMsMCwwLjkzNzU1Mjk4ODUyOTIwNTNdLCJzY2FsZSI6WzEyLjE4MzcyNDQwMzM4MTM0OCwxMi4xODM3MjQ0MDMzODEzNDgsMTIuMTgzNzI0NDAzMzgxMzQ4XSwidHJhbnNsYXRpb24iOlszNDcuNjE2MjcxOTcyNjU2MjUsMTkuNjQ2MjgyMTk2MDQ0OTIyLC0zMDcuMzMyMjE0MzU1NDY4NzVdfSx7Im1lc2giOjcwLCJuYW1lIjoiVGhlIEhvc3RlbCIsInJvdGF0aW9uIjpbMCwwLjM0NDQwODc4MDMzNjM4LDAsMC45Mzg4MTk4MjU2NDkyNjE1XSwic2NhbGUiOlsxMC4wNjA0MzgxNTYxMjc5MywxMC4wNjA0MzgxNTYxMjc5MywxMC4wNjA0MzgxNTYxMjc5M10sInRyYW5zbGF0aW9uIjpbMzc3LjYwMzQ1NDU4OTg0Mzc1LDMuOTI1Nzg5ODMzMDY4ODQ3NywtMzI2LjIyNDY3MDQxMDE1NjI1XX0seyJtZXNoIjo3MSwibmFtZSI6IkJhY2sgSW4gVGltZSIsInJvdGF0aW9uIjpbMCwtMC42Nzc4MTU4NTQ1NDk0MDgsMCwwLjczNTIzMTY5NzU1OTM1NjddLCJzY2FsZSI6WzkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4LDkuNzgxODA3ODk5NDc1MDk4XSwidHJhbnNsYXRpb24iOlszNjMuNzEzNjUzNTY0NDUzMSwxMC4xODQ3OTcyODY5ODczMDUsLTM2LjU1MzQwNTc2MTcxODc1XX0seyJtZXNoIjo3MywibmFtZSI6IkRhZ2dlcmZhbGwgUGxhY2UiLCJyb3RhdGlvbiI6WzAsLTAuNjc3ODE1OTE0MTU0MDUyNywwLDAuNzM1MjMxNjk3NTU5MzU2N10sInNjYWxlIjpbNC4wMDYzMjY2NzU0MTUwMzksNC4wMDYzMjYxOTg1Nzc4ODEsNC4wMDYzMjY2NzU0MTUwMzldLCJ0cmFuc2xhdGlvbiI6WzM1OC42OTUwNjgzNTkzNzUsMy45MjU3ODk4MzMwNjg4NDc3LC02OS44MjQ0OTM0MDgyMDMxMl19LHsibWVzaCI6NzYsIm5hbWUiOiJTb2xhcmlzIiwicm90YXRpb24iOlswLC0wLjYyNDQ0MTk4MTMxNTYxMjgsMCwwLjc4MTA3MTE4NjA2NTY3MzhdLCJzY2FsZSI6WzguMzU4MjQ3NzU2OTU4MDA4LDguMzU4MjQ3NzU2OTU4MDA4LDguMzU4MjQ3NzU2OTU4MDA4XSwidHJhbnNsYXRpb24iOlszNTEuNDQ3MDIxNDg0Mzc1LDE2LjE3NjA3MzA3NDM0MDgyLC0xMTMuOTU2OTcwMjE0ODQzNzVdfSx7Im1lc2giOjUxLCJuYW1lIjoiUG9sYXJpcyIsInJvdGF0aW9uIjpbMCwwLjkzNTc0NzAyNzM5NzE1NTgsMCwwLjM1MjY3MTkyMTI1MzIwNDM1XSwidHJhbnNsYXRpb24iOlszNTQuODYyNTc5MzQ1NzAzMSwzLjkyNTc4OTgzMzA2ODg0NzcsMzIwLjg0NDkwOTY2Nzk2ODc1XX0seyJtZXNoIjo1MywibmFtZSI6Ik1lZ2Fkb24gU3RhdGlvbiIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjgyODY4OTU3NTIsMCwwLjcwNzEwNjgyODY4OTU3NTJdLCJ0cmFuc2xhdGlvbiI6WzMzOC45OTI4NTg4ODY3MTg3NSwzLjkyNTc4OTgzMzA2ODg0NzcsMTc5LjkyNjEzMjIwMjE0ODQ0XX0seyJtZXNoIjo1NSwibmFtZSI6Ik5hYm9vIENlbnRyYWwiLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4Mjg2ODk1NzUyLDAsMC43MDcxMDY4Mjg2ODk1NzUyXSwidHJhbnNsYXRpb24iOlszNTkuNzQ4NTY1NjczODI4MSwzLjkyNTc4OTgzMzA2ODg0NzcsODQuMTQ4NjUxMTIzMDQ2ODhdfSx7Im1lc2giOjY1LCJuYW1lIjoiUGV3dGVyIFRvd2VyIiwicm90YXRpb24iOlswLDAuOTM1NzQ3MDI3Mzk3MTU1OCwwLDAuMzUyNjcxOTIxMjUzMjA0MzVdLCJ0cmFuc2xhdGlvbiI6WzI4Ni4xNDI3MDAxOTUzMTI1LDMuOTI1Nzg5ODMzMDY4ODQ3NywyNTkuNDc0NzMxNDQ1MzEyNV19LHsibWVzaCI6NjcsIm5hbWUiOiJDbG91ZCBDaXR5IFRvd2VyIiwicm90YXRpb24iOlswLDAuOTM1NzQ3MDI3Mzk3MTU1OCwwLDAuMzUyNjcxOTIxMjUzMjA0MzVdLCJ0cmFuc2xhdGlvbiI6WzMxMC40MTIyOTI0ODA0Njg3NSwzLjkyNTc4OTgzMzA2ODg0NzcsMjg2Ljg4OTIyMTE5MTQwNjI1XX0seyJtZXNoIjo2OSwibmFtZSI6IlNpZWdlIFRvd2VyIiwicm90YXRpb24iOlswLDAuOTM1NzQ3MDI3Mzk3MTU1OCwwLDAuMzUyNjcxOTIxMjUzMjA0MzVdLCJ0cmFuc2xhdGlvbiI6WzMzMC4wNTA2ODk2OTcyNjU2LDMuOTI1Nzg5ODMzMDY4ODQ3NywzMDQuMTA1NTYwMzAyNzM0NF19LHsibWVzaCI6OTEsIm5hbWUiOiJQYWxsZXQgSG91c2UiLCJyb3RhdGlvbiI6WzAsMC43MDcxMDY4ODgyOTQyMiwwLDAuNzA3MTA2NjQ5ODc1NjQwOV0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzM2NC4xNTcxMDQ0OTIxODc1LDQuMjE4Nzg3NjcwMTM1NDk4LDI3Ljg4ODE1MzA3NjE3MTg3NV19LHsibWVzaCI6OTMsIm5hbWUiOiJHYWxhY3RpYyBPdXRwb3N0Iiwicm90YXRpb24iOlswLDAuNzA3MTA2ODg4Mjk0MjIsMCwwLjcwNzEwNjY0OTg3NTY0MDldLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlszNTAuMTM2NjU3NzE0ODQzNzUsNC4yMTg3ODc2NzAxMzU0OTgsMTQwLjg1Nzg5NDg5NzQ2MDk0XX0seyJtZXNoIjo5NSwibmFtZSI6IkJyeWVycyBIb3VzZSIsInJvdGF0aW9uIjpbMCwwLjcwNzEwNjg4ODI5NDIyLDAsMC43MDcxMDY2NDk4NzU2NDA5XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMzYwLjYyNDg3NzkyOTY4NzUsNC4yMTg3ODc2NzAxMzU0OTgsNTAuNTg3NzA3NTE5NTMxMjVdfSx7Im1lc2giOjU1LCJuYW1lIjoiSXJvbiBDb3ZlIEJ1aWxkaW5nIiwicm90YXRpb24iOlswLDAuOTM4OTE4MzUyMTI3MDc1MiwwLDAuMzQ0MTM5OTYzMzg4NDQzXSwidHJhbnNsYXRpb24iOlszNjAuMjEyMDk3MTY3OTY4NzUsMy45MjU3ODk4MzMwNjg4NDc3LDI0NS41MjA0MzE1MTg1NTQ3XX0seyJtZXNoIjo4MSwibmFtZSI6IktyYWtlbiBCYXkiLCJyb3RhdGlvbiI6WzAsMC40MzA1MTU5NzQ3NjAwNTU1NCwwLDAuOTAyNTgzMDAzMDQ0MTI4NF0sInNjYWxlIjpbNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTUsNC43NDgxNzU2MjEwMzI3MTVdLCJ0cmFuc2xhdGlvbiI6WzI0Mi42MDA0NzkxMjU5NzY1Niw4LjY0NjkzMDY5NDU4MDA3OCwyMjUuNzQ2MzM3ODkwNjI1XX0seyJtZXNoIjozMywibmFtZSI6Ikh5Ym9yaWEgUGxhY2UiLCJyb3RhdGlvbiI6WzAsLTAuNzkyMjA3OTU2MzE0MDg2OSwwLDAuNjEwMjUxMzA3NDg3NDg3OF0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbMjc3LjUwNDkxMzMzMDA3ODEsNC4yMTg3ODc2NzAxMzU0OTgsNTguNTA4Nzg5MDYyNV19LHsibWVzaCI6MzUsIm5hbWUiOiJBdXJvcmEgSG91c2UiLCJyb3RhdGlvbiI6WzAsLTAuODIzODAwMDg2OTc1MDk3NywwLDAuNTY2ODgwNDA0OTQ5MTg4Ml0sInNjYWxlIjpbMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NTgsMS4xMDAwMDAwMjM4NDE4NThdLCJ0cmFuc2xhdGlvbiI6WzI1OS42Mjc5Mjk2ODc1LDQuMjE4Nzg3NjcwMTM1NDk4LDEyNC4xNzUwNDg4MjgxMjVdfSx7Im1lc2giOjM3LCJuYW1lIjoiQmxvY2sgWjIiLCJyb3RhdGlvbiI6WzAsLTAuODY5MjQ4NzQ3ODI1NjIyNiwwLDAuNDk0Mzc0OTMwODU4NjEyMDZdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyNTEuNTY2MzE0Njk3MjY1NjIsNC4yMTg3ODc2NzAxMzU0OTgsMTM4LjUzOTIzMDM0NjY3OTddfSx7Im1lc2giOjM5LCJuYW1lIjoiSG91c2Ugb2YgU3RhcmsiLCJyb3RhdGlvbiI6WzAsLTAuNzkyMjA3OTU2MzE0MDg2OSwwLDAuNjEwMjUxMzA3NDg3NDg3OF0sInNjYWxlIjpbMS4wOTk5OTk5MDQ2MzI1Njg0LDEuMTAwMDAwMDIzODQxODU4LDEuMDk5OTk5OTA0NjMyNTY4NF0sInRyYW5zbGF0aW9uIjpbMjc2LjU1MDYyODY2MjEwOTQsNC4yMTg3ODc2NzAxMzU0OTgsNjguMzA3NDk1MTE3MTg3NV19LHsibWVzaCI6NDEsIm5hbWUiOiJUYXplciBMYW5kIiwicm90YXRpb24iOlswLC0wLjgyMzgwMDA4Njk3NTA5NzcsMCwwLjU2Njg4MDQwNDk0OTE4ODJdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyNzAuODI2MjAyMzkyNTc4MSw0LjIxODc4NzY3MDEzNTQ5OCw5My4wMjA2NjA0MDAzOTA2Ml19LHsibWVzaCI6NDMsIm5hbWUiOiJCYXRoIEhvdXNlIiwicm90YXRpb24iOlswLC0wLjgyMzgwMDA4Njk3NTA5NzcsMCwwLjU2Njg4MDQwNDk0OTE4ODJdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyNjAuMjY5MDQyOTY4NzUsNC4yMTg3ODc2NzAxMzU0OTgsMTE1LjU3Mzc2MDk4NjMyODEyXX0seyJtZXNoIjo0NSwibmFtZSI6IkNyZWVsIEhvdXNlIiwicm90YXRpb24iOlswLC0wLjgyMzgwMDA4Njk3NTA5NzcsMCwwLjU2Njg4MDQwNDk0OTE4ODJdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyNjUuODgxNTYxMjc5Mjk2OSw0LjIxODc4NzY3MDEzNTQ5OCwxMDQuNjY2MjI5MjQ4MDQ2ODhdfSx7Im1lc2giOjQ3LCJuYW1lIjoiQXJyYWtpcyIsInJvdGF0aW9uIjpbMCwtMC43OTIyMDc5NTYzMTQwODY5LDAsMC42MTAyNTEzMDc0ODc0ODc4XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOlsyNzUuNjgyMDA2ODM1OTM3NSw0LjIxODc4NzY3MDEzNTQ5OCw3OS42NzkxMjI5MjQ4MDQ2OV19LHsibWVzaCI6NzksIm5hbWUiOiJCcmF2b3MgRW5kIiwicm90YXRpb24iOlswLC0wLjc0Nzk0OTMwMjE5NjUwMjcsMCwwLjY2Mzc1NTk1MzMxMTkyMDJdLCJzY2FsZSI6WzYuMzQ3MDE4NzE4NzE5NDgyLDMuMTc5MzU5NDM2MDM1MTU2Miw2LjM0NzAxODcxODcxOTQ4Ml0sInRyYW5zbGF0aW9uIjpbMjg3LjA4Mzc0MDIzNDM3NSw3LjA2Mjk1MzQ3MjEzNzQ1MSwxOS4xMDk0MDU1MTc1NzgxMjVdfSx7Im1lc2giOjg0LCJuYW1lIjoiQXJrYWRpYSIsInJvdGF0aW9uIjpbMCwtMC44OTQ0MTYxNTM0MzA5Mzg3LDAsMC40NDcyMzU2NzM2NjYwMDAzN10sInNjYWxlIjpbNC44NzQyNzk0OTkwNTM5NTUsNC44NzQyNzk5NzU4OTExMTMsNC44NzQyNzk0OTkwNTM5NTVdLCJ0cmFuc2xhdGlvbiI6WzIxNC4wMDk2NTg4MTM0NzY1Niw4Ljc4MjQwMDEzMTIyNTU4NiwxOTQuNTQ1NTkzMjYxNzE4NzVdfSx7Im1lc2giOjg3LCJuYW1lIjoiUm9hZCBIb3VzZSIsInJvdGF0aW9uIjpbMCwtMC43NDc5NDg0MDgxMjY4MzEsMCwwLjY2Mzc1NjkwNjk4NjIzNjZdLCJzY2FsZSI6WzEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4LDEuMTAwMDAwMDIzODQxODU4XSwidHJhbnNsYXRpb24iOlsyODQuMDkzNzUsNC4yMTg3ODc2NzAxMzU0OTgsMzMuMTk5MDA1MTI2OTUzMTI1XX0seyJtZXNoIjo4OCwibmFtZSI6IkFya2FuaWEgVG9wIiwicm90YXRpb24iOlswLC0wLjg2OTI0ODc0NzgyNTYyMjYsMCwwLjQ5NDM3NDkzMDg1ODYxMjA2XSwic2NhbGUiOlsxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OCwxLjEwMDAwMDAyMzg0MTg1OF0sInRyYW5zbGF0aW9uIjpbMjQ1LjU3NzgxOTgyNDIxODc1LDQuMjE4Nzg3NjcwMTM1NDk4LDE1NS4zNDIzOTE5Njc3NzM0NF19LHsibWVzaCI6ODksIm5hbWUiOiJTYWNvcnJpYSBQbGFjZSIsInJvdGF0aW9uIjpbMCwtMC42ODMyMDY3OTY2NDYxMTgyLDAsMC43MzAyMjQ5NjcwMDI4Njg3XSwic2NhbGUiOlsxLjA5OTk5OTkwNDYzMjU2ODQsMS4xMDAwMDAwMjM4NDE4NTgsMS4wOTk5OTk5MDQ2MzI1Njg0XSwidHJhbnNsYXRpb24iOlsyODQuMTM4NzAyMzkyNTc4MSw0LjIxODc4NzY3MDEzNTQ5OCw0Ni4yNjE3MTg3NV19LHsibWVzaCI6ODEsIm5hbWUiOiJFdGhlciBIb3VzZSIsInJvdGF0aW9uIjpbMCwwLjk5OTUyMjA4OTk1ODE5MDksMCwwLjAzMDkxMjA3ODkxNzAyNjUyXSwic2NhbGUiOls0Ljc0ODE3NTYyMTAzMjcxNSw0Ljc0ODE3NTYyMTAzMjcxNSw0Ljc0ODE3NTYyMTAzMjcxNV0sInRyYW5zbGF0aW9uIjpbMzA0LjkyNTI5Mjk2ODc1LDguNjQ2OTMwNjk0NTgwMDc4LDIwLjUzMzM4NjIzMDQ2ODc1XX1dLCJtYXRlcmlhbHMiOlt7ImRvdWJsZVNpZGVkIjp0cnVlLCJuYW1lIjoiUk9BRCIsIm5vcm1hbFRleHR1cmUiOnsiaW5kZXgiOjB9LCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JUZXh0dXJlIjp7ImluZGV4IjoxfSwibWV0YWxsaWNGYWN0b3IiOjAsInJvdWdobmVzc0ZhY3RvciI6MC4zMDAwMDAwMTE5MjA5Mjg5Nn19LHsiZG91YmxlU2lkZWQiOnRydWUsIm5hbWUiOiJQQVZFTUVOVCIsIm5vcm1hbFRleHR1cmUiOnsiaW5kZXgiOjJ9LCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JUZXh0dXJlIjp7ImluZGV4IjozfSwibWV0YWxsaWNGYWN0b3IiOjAsInJvdWdobmVzc0ZhY3RvciI6MC4yMDAwMDAwMDI5ODAyMzIyNH19LHsiZG91YmxlU2lkZWQiOnRydWUsIm5hbWUiOiJQYXZpbmdTdG9uZSIsIm5vcm1hbFRleHR1cmUiOnsiaW5kZXgiOjR9LCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JUZXh0dXJlIjp7ImluZGV4Ijo1fSwibWV0YWxsaWNGYWN0b3IiOjAsInJvdWdobmVzc0ZhY3RvciI6MC4zMDAwMDAwMTE5MjA5Mjg5Nn19LHsiZG91YmxlU2lkZWQiOnRydWUsIm5hbWUiOiJDT05DUkVURSIsIm5vcm1hbFRleHR1cmUiOnsiaW5kZXgiOjZ9LCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JUZXh0dXJlIjp7ImluZGV4Ijo3fSwibWV0YWxsaWNGYWN0b3IiOjAsInJvdWdobmVzc0ZhY3RvciI6MC40MDAwMDAwMDU5NjA0NjQ1fX0seyJkb3VibGVTaWRlZCI6dHJ1ZSwiZW1pc3NpdmVGYWN0b3IiOlswLjAzNjYyODYwNzE5NDg3MDcxLDEsMV0sIm5hbWUiOiJMRUQiLCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JGYWN0b3IiOlswLDAsMCwxXX19LHsiZG91YmxlU2lkZWQiOnRydWUsIm5hbWUiOiJQQVZFTUVOVC4wMDIiLCJub3JtYWxUZXh0dXJlIjp7ImluZGV4Ijo4fSwicGJyTWV0YWxsaWNSb3VnaG5lc3MiOnsiYmFzZUNvbG9yVGV4dHVyZSI6eyJpbmRleCI6OX0sIm1ldGFsbGljRmFjdG9yIjowLCJyb3VnaG5lc3NGYWN0b3IiOjAuMjAwMDAwMDAyOTgwMjMyMjR9fSx7ImRvdWJsZVNpZGVkIjp0cnVlLCJuYW1lIjoiUGF2aW5nU3RvbmUuMDAxIiwibm9ybWFsVGV4dHVyZSI6eyJpbmRleCI6MTB9LCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JUZXh0dXJlIjp7ImluZGV4IjoxMX0sIm1ldGFsbGljRmFjdG9yIjowLCJyb3VnaG5lc3NGYWN0b3IiOjAuMzAwMDAwMDExOTIwOTI4OTZ9fSx7ImRvdWJsZVNpZGVkIjp0cnVlLCJuYW1lIjoiQ09OQ1JFVEUuMDAxIiwibm9ybWFsVGV4dHVyZSI6eyJpbmRleCI6MTJ9LCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JUZXh0dXJlIjp7ImluZGV4IjoxM30sIm1ldGFsbGljRmFjdG9yIjowLCJyb3VnaG5lc3NGYWN0b3IiOjAuNDAwMDAwMDA1OTYwNDY0NX19LHsiZG91YmxlU2lkZWQiOnRydWUsImVtaXNzaXZlRmFjdG9yIjpbMSwxLDFdLCJlbWlzc2l2ZVRleHR1cmUiOnsiaW5kZXgiOjE0fSwibmFtZSI6IlBST1BTIiwicGJyTWV0YWxsaWNSb3VnaG5lc3MiOnsiYmFzZUNvbG9yVGV4dHVyZSI6eyJpbmRleCI6MTV9LCJtZXRhbGxpY1JvdWdobmVzc1RleHR1cmUiOnsiaW5kZXgiOjE2fX19LHsiZG91YmxlU2lkZWQiOnRydWUsIm5hbWUiOiJHUkFTUyIsInBick1ldGFsbGljUm91Z2huZXNzIjp7ImJhc2VDb2xvclRleHR1cmUiOnsiaW5kZXgiOjE3fSwibWV0YWxsaWNGYWN0b3IiOjAsInJvdWdobmVzc0ZhY3RvciI6MC41fX0seyJkb3VibGVTaWRlZCI6dHJ1ZSwibmFtZSI6IlRSRUUgQkFSSyIsInBick1ldGFsbGljUm91Z2huZXNzIjp7ImJhc2VDb2xvclRleHR1cmUiOnsiaW5kZXgiOjE4fSwibWV0YWxsaWNGYWN0b3IiOjAsInJvdWdobmVzc0ZhY3RvciI6MC41fX0seyJkb3VibGVTaWRlZCI6dHJ1ZSwibmFtZSI6IlRSRUUgTEVBRiIsInBick1ldGFsbGljUm91Z2huZXNzIjp7ImJhc2VDb2xvclRleHR1cmUiOnsiaW5kZXgiOjE5fSwibWV0YWxsaWNGYWN0b3IiOjAsInJvdWdobmVzc0ZhY3RvciI6MC44MDAwMDAwMTE5MjA5Mjl9fSx7ImRvdWJsZVNpZGVkIjp0cnVlLCJuYW1lIjoiSkFQQU4gVVJCQU4gQlVJTERJTkciLCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JUZXh0dXJlIjp7ImluZGV4IjoyMH0sIm1ldGFsbGljUm91Z2huZXNzVGV4dHVyZSI6eyJpbmRleCI6MjF9fX0seyJkb3VibGVTaWRlZCI6dHJ1ZSwiZW1pc3NpdmVGYWN0b3IiOlsxLDEsMV0sImVtaXNzaXZlVGV4dHVyZSI6eyJpbmRleCI6MjJ9LCJuYW1lIjoiSkFQQU4gVVJCQU4gUFJPUFMiLCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JUZXh0dXJlIjp7ImluZGV4IjoyM30sIm1ldGFsbGljUm91Z2huZXNzVGV4dHVyZSI6eyJpbmRleCI6MjR9fX0seyJkb3VibGVTaWRlZCI6dHJ1ZSwibmFtZSI6IkpBUEFOIFVSQkFOIEJVSUxESU5HIFYyIiwicGJyTWV0YWxsaWNSb3VnaG5lc3MiOnsiYmFzZUNvbG9yVGV4dHVyZSI6eyJpbmRleCI6MjV9LCJtZXRhbGxpY1JvdWdobmVzc1RleHR1cmUiOnsiaW5kZXgiOjI2fX19LHsiZG91YmxlU2lkZWQiOnRydWUsImVtaXNzaXZlRmFjdG9yIjpbMSwxLDFdLCJlbWlzc2l2ZVRleHR1cmUiOnsiaW5kZXgiOjI3fSwibmFtZSI6IkpBUEFOIFVSQkFOIFBST1BTIFYyIiwicGJyTWV0YWxsaWNSb3VnaG5lc3MiOnsiYmFzZUNvbG9yVGV4dHVyZSI6eyJpbmRleCI6Mjh9LCJtZXRhbGxpY1JvdWdobmVzc1RleHR1cmUiOnsiaW5kZXgiOjI5fX19LHsiZG91YmxlU2lkZWQiOnRydWUsImVtaXNzaXZlRmFjdG9yIjpbMSwxLDFdLCJlbWlzc2l2ZVRleHR1cmUiOnsiaW5kZXgiOjMwfSwibmFtZSI6IkNZQkVSUFVOSyBCVUlMRElORyIsInBick1ldGFsbGljUm91Z2huZXNzIjp7ImJhc2VDb2xvclRleHR1cmUiOnsiaW5kZXgiOjMxfSwibWV0YWxsaWNSb3VnaG5lc3NUZXh0dXJlIjp7ImluZGV4IjozMn19fSx7ImRvdWJsZVNpZGVkIjp0cnVlLCJlbWlzc2l2ZUZhY3RvciI6WzEsMSwxXSwiZW1pc3NpdmVUZXh0dXJlIjp7ImluZGV4IjozM30sIm5hbWUiOiJDWUJFUlBVTksgQlVJTERJTkcgVjIiLCJwYnJNZXRhbGxpY1JvdWdobmVzcyI6eyJiYXNlQ29sb3JUZXh0dXJlIjp7ImluZGV4IjozNH0sIm1ldGFsbGljUm91Z2huZXNzVGV4dHVyZSI6eyJpbmRleCI6MzV9fX1dLCJtZXNoZXMiOlt7Im5hbWUiOiJDaXJjbGUuMDA1IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjowLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjMsIm1hdGVyaWFsIjowLCJtb2RlIjo0fV19LHsibmFtZSI6IkNpcmNsZS4wMDgiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0LCJOT1JNQUwiOjUsIlRFWENPT1JEXzAiOjZ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjIsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NywibWF0ZXJpYWwiOjEsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6OCwiTk9STUFMIjo5LCJURVhDT09SRF8wIjoxMH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NCwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoxMSwibWF0ZXJpYWwiOjIsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ2lyY2xlLjAwMyIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjEyLCJOT1JNQUwiOjEzLCJURVhDT09SRF8wIjoxNH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NiwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoxNSwibWF0ZXJpYWwiOjMsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MTYsIk5PUk1BTCI6MTcsIlRFWENPT1JEXzAiOjE4fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo4LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjE5LCJtYXRlcmlhbCI6MCwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyMCwiTk9STUFMIjoyMSwiVEVYQ09PUkRfMCI6MjJ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjksImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MjMsIm1hdGVyaWFsIjo0LCJtb2RlIjo0fV19LHsibmFtZSI6IkNpcmNsZS4wMDciLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyNCwiTk9STUFMIjoyNSwiVEVYQ09PUkRfMCI6MjZ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEwLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjI3LCJtYXRlcmlhbCI6NSwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyOCwiTk9STUFMIjoyOSwiVEVYQ09PUkRfMCI6MzB9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjExLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjMxLCJtYXRlcmlhbCI6NiwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA0MiIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjMyLCJOT1JNQUwiOjMzLCJURVhDT09SRF8wIjozNH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTIsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MzUsIm1hdGVyaWFsIjo3LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDAxIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MzYsIk5PUk1BTCI6MzcsIlRFWENPT1JEXzAiOjM4LCJDT0xPUl8wIjozOX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTQsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6MiwiQ09MT1JfMCI6M319fSwiaW5kaWNlcyI6NDAsIm1hdGVyaWFsIjo4LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQxLCJOT1JNQUwiOjQyLCJURVhDT09SRF8wIjo0MywiQ09MT1JfMCI6NDR9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE4LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjIsIkNPTE9SXzAiOjN9fX0sImluZGljZXMiOjQ1LCJtYXRlcmlhbCI6OSwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0NiwiTk9STUFMIjo0NywiVEVYQ09PUkRfMCI6NDgsIkNPTE9SXzAiOjQ5fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoyMCwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyLCJDT0xPUl8wIjozfX19LCJpbmRpY2VzIjo1MCwibWF0ZXJpYWwiOjEwLCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjUxLCJOT1JNQUwiOjUyLCJURVhDT09SRF8wIjo1MywiQ09MT1JfMCI6NTR9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjIyLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjIsIkNPTE9SXzAiOjN9fX0sImluZGljZXMiOjU1LCJtYXRlcmlhbCI6MTEsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNDMiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo1NiwiTk9STUFMIjo1NywiVEVYQ09PUkRfMCI6NTh9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjI0LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjU5LCJtYXRlcmlhbCI6OCwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjAyNyIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjYwLCJOT1JNQUwiOjYxLCJURVhDT09SRF8wIjo2Mn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MjUsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NjMsIm1hdGVyaWFsIjoxMiwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo2NCwiTk9STUFMIjo2NSwiVEVYQ09PUkRfMCI6NjZ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjI4LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjY3LCJtYXRlcmlhbCI6MTMsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNTMiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo2OCwiTk9STUFMIjo2OSwiVEVYQ09PUkRfMCI6NzB9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjMyLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjcxLCJtYXRlcmlhbCI6MTIsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NzIsIk5PUk1BTCI6NzMsIlRFWENPT1JEXzAiOjc0fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjozMywiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo3NSwibWF0ZXJpYWwiOjEzLCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDAyIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NzYsIk5PUk1BTCI6NzcsIlRFWENPT1JEXzAiOjc4fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjozNCwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo3OSwibWF0ZXJpYWwiOjEyLCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjgwLCJOT1JNQUwiOjgxLCJURVhDT09SRF8wIjo4Mn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MzUsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6ODMsIm1hdGVyaWFsIjoxMywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjAwMyIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjg0LCJOT1JNQUwiOjg1LCJURVhDT09SRF8wIjo4Nn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MzYsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6ODcsIm1hdGVyaWFsIjoxMiwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo4OCwiTk9STUFMIjo4OSwiVEVYQ09PUkRfMCI6OTB9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjM3LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjkxLCJtYXRlcmlhbCI6MTMsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNDciLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo5MiwiTk9STUFMIjo5MywiVEVYQ09PUkRfMCI6OTR9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjM4LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjk1LCJtYXRlcmlhbCI6MTIsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6OTYsIk5PUk1BTCI6OTcsIlRFWENPT1JEXzAiOjk4fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjozOSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo5OSwibWF0ZXJpYWwiOjEzLCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDg2IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MTAwLCJOT1JNQUwiOjEwMSwiVEVYQ09PUkRfMCI6MTAyLCJDT0xPUl8wIjoxMDN9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjQwLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjIsIkNPTE9SXzAiOjN9fX0sImluZGljZXMiOjEwNCwibWF0ZXJpYWwiOjEyLCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjEwNSwiTk9STUFMIjoxMDYsIlRFWENPT1JEXzAiOjEwNywiQ09MT1JfMCI6MTA4fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo0MSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyLCJDT0xPUl8wIjozfX19LCJpbmRpY2VzIjoxMDksIm1hdGVyaWFsIjoxMywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjAwNyIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjExMCwiTk9STUFMIjoxMTEsIlRFWENPT1JEXzAiOjExMn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NDIsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MTEzLCJtYXRlcmlhbCI6MTIsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MTE0LCJOT1JNQUwiOjExNSwiVEVYQ09PUkRfMCI6MTE2fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo0MywiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoxMTcsIm1hdGVyaWFsIjoxMywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjAwOCIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjExOCwiTk9STUFMIjoxMTksIlRFWENPT1JEXzAiOjEyMH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NDQsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MTIxLCJtYXRlcmlhbCI6MTIsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MTIyLCJOT1JNQUwiOjEyMywiVEVYQ09PUkRfMCI6MTI0fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo0NSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoxMjUsIm1hdGVyaWFsIjoxMywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjEzNyIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjEyNiwiTk9STUFMIjoxMjcsIlRFWENPT1JEXzAiOjEyOH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NDYsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MTI5LCJtYXRlcmlhbCI6MTIsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MTMwLCJOT1JNQUwiOjEzMSwiVEVYQ09PUkRfMCI6MTMyfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo0NywiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoxMzMsIm1hdGVyaWFsIjoxMywibW9kZSI6NH1dfSx7Im5hbWUiOiJQbGFuZSIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjEzNCwiTk9STUFMIjoxMzUsIlRFWENPT1JEXzAiOjEzNn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NDgsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MTM3LCJtYXRlcmlhbCI6MTIsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MTM4LCJOT1JNQUwiOjEzOSwiVEVYQ09PUkRfMCI6MTQwfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo0OSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoxNDEsIm1hdGVyaWFsIjoxMywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjAyNiIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjE0MiwiTk9STUFMIjoxNDMsIlRFWENPT1JEXzAiOjE0NH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NTAsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MTQ1LCJtYXRlcmlhbCI6MTQsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MTQ2LCJOT1JNQUwiOjE0NywiVEVYQ09PUkRfMCI6MTQ4fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo1MiwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoxNDksIm1hdGVyaWFsIjoxNSwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjAxMyIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjE1MCwiTk9STUFMIjoxNTEsIlRFWENPT1JEXzAiOjE1MiwiQ09MT1JfMCI6MTUzfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo1NSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyLCJDT0xPUl8wIjozfX19LCJpbmRpY2VzIjoxNTQsIm1hdGVyaWFsIjoxNCwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoxNTUsIk5PUk1BTCI6MTU2LCJURVhDT09SRF8wIjoxNTcsIkNPTE9SXzAiOjE1OH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NTYsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6MiwiQ09MT1JfMCI6M319fSwiaW5kaWNlcyI6MTU5LCJtYXRlcmlhbCI6MTUsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMTAiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoxNjAsIk5PUk1BTCI6MTYxLCJURVhDT09SRF8wIjoxNjJ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjU3LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjE2MywibWF0ZXJpYWwiOjE0LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjE2NCwiTk9STUFMIjoxNjUsIlRFWENPT1JEXzAiOjE2Nn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NTgsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MTY3LCJtYXRlcmlhbCI6MTUsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMDkiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoxNjgsIk5PUk1BTCI6MTY5LCJURVhDT09SRF8wIjoxNzB9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjU5LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjE3MSwibWF0ZXJpYWwiOjE0LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjE3MiwiTk9STUFMIjoxNzMsIlRFWENPT1JEXzAiOjE3NH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NjAsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MTc1LCJtYXRlcmlhbCI6MTUsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMDYiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoxNzYsIk5PUk1BTCI6MTc3LCJURVhDT09SRF8wIjoxNzh9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjYxLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjE3OSwibWF0ZXJpYWwiOjE0LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjE4MCwiTk9STUFMIjoxODEsIlRFWENPT1JEXzAiOjE4Mn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NjIsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MTgzLCJtYXRlcmlhbCI6MTUsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMDUiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoxODQsIk5PUk1BTCI6MTg1LCJURVhDT09SRF8wIjoxODZ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjYzLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjE4NywibWF0ZXJpYWwiOjE0LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjE4OCwiTk9STUFMIjoxODksIlRFWENPT1JEXzAiOjE5MH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NjQsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MTkxLCJtYXRlcmlhbCI6MTUsIm1vZGUiOjR9XX0seyJuYW1lIjoiUGxhbmUuMDAxIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MTkyLCJOT1JNQUwiOjE5MywiVEVYQ09PUkRfMCI6MTk0fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo2NSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoxOTUsIm1hdGVyaWFsIjoxNCwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoxOTYsIk5PUk1BTCI6MTk3LCJURVhDT09SRF8wIjoxOTh9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjY2LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjE5OSwibWF0ZXJpYWwiOjE1LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDI4IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MjAwLCJOT1JNQUwiOjIwMSwiVEVYQ09PUkRfMCI6MjAyfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo2NywiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoyMDMsIm1hdGVyaWFsIjoxNCwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyMDQsIk5PUk1BTCI6MjA1LCJURVhDT09SRF8wIjoyMDZ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjY4LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjIwNywibWF0ZXJpYWwiOjE1LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDE0IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MjA4LCJOT1JNQUwiOjIwOSwiVEVYQ09PUkRfMCI6MjEwfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo2OSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoyMTEsIm1hdGVyaWFsIjoxNCwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyMTIsIk5PUk1BTCI6MjEzLCJURVhDT09SRF8wIjoyMTR9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjcwLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjIxNSwibWF0ZXJpYWwiOjE1LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDA0IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MjE2LCJOT1JNQUwiOjIxNywiVEVYQ09PUkRfMCI6MjE4fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo3MSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoyMTksIm1hdGVyaWFsIjoxNCwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyMjAsIk5PUk1BTCI6MjIxLCJURVhDT09SRF8wIjoyMjJ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjcyLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjIyMywibWF0ZXJpYWwiOjE1LCJtb2RlIjo0fV19LHsibmFtZSI6IkN5bGluZGVyLjAxNSIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjIyNCwiTk9STUFMIjoyMjUsIlRFWENPT1JEXzAiOjIyNn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6NzMsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MjI3LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMzUiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyMjgsIk5PUk1BTCI6MjI5LCJURVhDT09SRF8wIjoyMzB9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjc3LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjIzMSwibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fV19LHsibmFtZSI6IkNpcmNsZS4wMDEiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyMzIsIk5PUk1BTCI6MjMzLCJURVhDT09SRF8wIjoyMzQsIkNPTE9SXzAiOjIzNX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6ODAsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6MiwiQ09MT1JfMCI6M319fSwiaW5kaWNlcyI6MjM2LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MjM3LCJOT1JNQUwiOjIzOCwiVEVYQ09PUkRfMCI6MjM5LCJDT0xPUl8wIjoyNDB9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjgxLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjIsIkNPTE9SXzAiOjN9fX0sImluZGljZXMiOjI0MSwibWF0ZXJpYWwiOjgsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNjUiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyNDIsIk5PUk1BTCI6MjQzLCJURVhDT09SRF8wIjoyNDR9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjgyLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjI0NSwibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjI0NiwiTk9STUFMIjoyNDcsIlRFWENPT1JEXzAiOjI0OH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6ODMsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MjQ5LCJtYXRlcmlhbCI6OCwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA3NSIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjI1MCwiTk9STUFMIjoyNTEsIlRFWENPT1JEXzAiOjI1Mn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6ODQsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MjUzLCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNTkiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyNTQsIk5PUk1BTCI6MjU1LCJURVhDT09SRF8wIjoyNTZ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjg1LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjI1NywibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDkwIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MjU4LCJOT1JNQUwiOjI1OSwiVEVYQ09PUkRfMCI6MjYwfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo4NiwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoyNjEsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA4OSIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjI2MiwiTk9STUFMIjoyNjMsIlRFWENPT1JEXzAiOjI2NH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6ODcsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MjY1LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wODgiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyNjYsIk5PUk1BTCI6MjY3LCJURVhDT09SRF8wIjoyNjh9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjg4LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjI2OSwibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDg1IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MjcwLCJOT1JNQUwiOjI3MSwiVEVYQ09PUkRfMCI6MjcyfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo4OSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoyNzMsIm1hdGVyaWFsIjoxNiwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA4NCIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjI3NCwiTk9STUFMIjoyNzUsIlRFWENPT1JEXzAiOjI3Nn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6OTAsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6Mjc3LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wODMiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyNzgsIk5PUk1BTCI6Mjc5LCJURVhDT09SRF8wIjoyODB9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjkxLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjI4MSwibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDgyIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MjgyLCJOT1JNQUwiOjI4MywiVEVYQ09PUkRfMCI6Mjg0fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo5MiwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoyODUsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA4MSIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjI4NiwiTk9STUFMIjoyODcsIlRFWENPT1JEXzAiOjI4OH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6OTMsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6Mjg5LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wODAiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjoyOTAsIk5PUk1BTCI6MjkxLCJURVhDT09SRF8wIjoyOTJ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjk0LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjI5MywibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDc5IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6Mjk0LCJOT1JNQUwiOjI5NSwiVEVYQ09PUkRfMCI6Mjk2fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo5NSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoyOTcsIm1hdGVyaWFsIjoxNiwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA3OCIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjI5OCwiTk9STUFMIjoyOTksIlRFWENPT1JEXzAiOjMwMH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6OTYsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MzAxLCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNzciLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjozMDIsIk5PUk1BTCI6MzAzLCJURVhDT09SRF8wIjozMDR9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjk3LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjMwMSwibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDc2IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MzA1LCJOT1JNQUwiOjMwNiwiVEVYQ09PUkRfMCI6MzA3fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3Ijo5OCwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjozMDgsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA3NCIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjMwOSwiTk9STUFMIjozMTAsIlRFWENPT1JEXzAiOjMxMX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6OTksImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MzEyLCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiUGxhbmUuMDA0IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MzEzLCJOT1JNQUwiOjMxNCwiVEVYQ09PUkRfMCI6MzE1fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMDAsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MzE2LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9XX0seyJuYW1lIjoiUGxhbmUuMDE1IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MzE3LCJOT1JNQUwiOjMxOCwiVEVYQ09PUkRfMCI6MzE5fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMDEsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MzIwLCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNzMiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjozMjEsIk5PUk1BTCI6MzIyLCJURVhDT09SRF8wIjozMjMsIkNPTE9SXzAiOjMyNH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTAyLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjIsIkNPTE9SXzAiOjN9fX0sImluZGljZXMiOjMyNSwibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjMyNiwiTk9STUFMIjozMjcsIlRFWENPT1JEXzAiOjMyOCwiQ09MT1JfMCI6MzI5fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMDMsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6MiwiQ09MT1JfMCI6M319fSwiaW5kaWNlcyI6MzMwLCJtYXRlcmlhbCI6OCwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA3MiIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjMzMSwiTk9STUFMIjozMzIsIlRFWENPT1JEXzAiOjMzMywiQ09MT1JfMCI6MzM0fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMDQsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6MiwiQ09MT1JfMCI6M319fSwiaW5kaWNlcyI6MzM1LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MzM2LCJOT1JNQUwiOjMzNywiVEVYQ09PUkRfMCI6MzM4LCJDT0xPUl8wIjozMzl9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEwNSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyLCJDT0xPUl8wIjozfX19LCJpbmRpY2VzIjozNDAsIm1hdGVyaWFsIjo4LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMTMwIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MzQxLCJOT1JNQUwiOjM0MiwiVEVYQ09PUkRfMCI6MzQzLCJDT0xPUl8wIjozNDR9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEwNiwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyLCJDT0xPUl8wIjozfX19LCJpbmRpY2VzIjozNDUsIm1hdGVyaWFsIjoxNiwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjozNDYsIk5PUk1BTCI6MzQ3LCJURVhDT09SRF8wIjozNDgsIkNPTE9SXzAiOjM0OX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTA3LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjIsIkNPTE9SXzAiOjN9fX0sImluZGljZXMiOjM1MCwibWF0ZXJpYWwiOjgsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNzEiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjozNTEsIk5PUk1BTCI6MzUyLCJURVhDT09SRF8wIjozNTMsIkNPTE9SXzAiOjM1NH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTA4LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjIsIkNPTE9SXzAiOjN9fX0sImluZGljZXMiOjM0NSwibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjM1NSwiTk9STUFMIjozNTYsIlRFWENPT1JEXzAiOjM1NywiQ09MT1JfMCI6MzU4fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMDksImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6MiwiQ09MT1JfMCI6M319fSwiaW5kaWNlcyI6MzUwLCJtYXRlcmlhbCI6OCwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA3MCIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjM1OSwiTk9STUFMIjozNjAsIlRFWENPT1JEXzAiOjM2MX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTEwLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjM2MiwibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDY5IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MzYzLCJOT1JNQUwiOjM2NCwiVEVYQ09PUkRfMCI6MzY1fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMTEsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MzY2LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNjgiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjozNjcsIk5PUk1BTCI6MzY4LCJURVhDT09SRF8wIjozNjl9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjExMiwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjozNzAsIm1hdGVyaWFsIjoxNiwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjozNzEsIk5PUk1BTCI6MzcyLCJURVhDT09SRF8wIjozNzN9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjExMywiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjozNzQsIm1hdGVyaWFsIjo4LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDY3IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6Mzc1LCJOT1JNQUwiOjM3NiwiVEVYQ09PUkRfMCI6Mzc3fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMTQsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6Mzc4LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6Mzc5LCJOT1JNQUwiOjM4MCwiVEVYQ09PUkRfMCI6MzgxfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMTUsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6MzgyLCJtYXRlcmlhbCI6OCwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA2NiIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjM4MywiTk9STUFMIjozODQsIlRFWENPT1JEXzAiOjM4NX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTE2LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjM4NiwibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjM4NywiTk9STUFMIjozODgsIlRFWENPT1JEXzAiOjM4OX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTE3LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjM5MCwibWF0ZXJpYWwiOjgsIm1vZGUiOjR9XX0seyJuYW1lIjoiUGxhbmUuMDA2IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MzkxLCJOT1JNQUwiOjM5MiwiVEVYQ09PUkRfMCI6MzkzfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMTgsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6Mzk0LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiUGxhbmUuMDAzIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6Mzk1LCJOT1JNQUwiOjM5NiwiVEVYQ09PUkRfMCI6Mzk3fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMTksImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6Mzk4LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNjQiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjozOTksIk5PUk1BTCI6NDAwLCJURVhDT09SRF8wIjo0MDF9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEyMCwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo0MDIsIm1hdGVyaWFsIjoxNiwibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0MDMsIk5PUk1BTCI6NDA0LCJURVhDT09SRF8wIjo0MDV9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEyMSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo0MDYsIm1hdGVyaWFsIjo4LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDYzIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NDA3LCJOT1JNQUwiOjQwOCwiVEVYQ09PUkRfMCI6NDA5fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMjIsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NDEwLCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NDExLCJOT1JNQUwiOjQxMiwiVEVYQ09PUkRfMCI6NDEzfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMjMsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NDE0LCJtYXRlcmlhbCI6OCwibW9kZSI6NH1dfSx7Im5hbWUiOiJQbGFuZS4wMjgiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0MTUsIk5PUk1BTCI6NDE2LCJURVhDT09SRF8wIjo0MTcsIkNPTE9SXzAiOjQxOH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTI0LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjIsIkNPTE9SXzAiOjN9fX0sImluZGljZXMiOjQxOSwibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fV19LHsibmFtZSI6IlBsYW5lLjAwMiIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQyMCwiTk9STUFMIjo0MjEsIlRFWENPT1JEXzAiOjQyMiwiQ09MT1JfMCI6NDIzfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMjUsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6MiwiQ09MT1JfMCI6M319fSwiaW5kaWNlcyI6NDI0LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNjIiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0MjUsIk5PUk1BTCI6NDI2LCJURVhDT09SRF8wIjo0Mjd9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEyNiwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo0MjgsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA4NyIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQyOSwiTk9STUFMIjo0MzAsIlRFWENPT1JEXzAiOjQzMX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTI3LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjQzMiwibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQzMywiTk9STUFMIjo0MzQsIlRFWENPT1JEXzAiOjQzNX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTI4LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjQzNiwibWF0ZXJpYWwiOjgsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNjEiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0MzcsIk5PUk1BTCI6NDM4LCJURVhDT09SRF8wIjo0Mzl9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEyOSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo0NDAsIm1hdGVyaWFsIjoxNywibW9kZSI6NH0seyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0NDEsIk5PUk1BTCI6NDQyLCJURVhDT09SRF8wIjo0NDN9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEzMCwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo0NDQsIm1hdGVyaWFsIjo4LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMTA4IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NDQ1LCJOT1JNQUwiOjQ0NiwiVEVYQ09PUkRfMCI6NDQ3fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMzEsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NDQ4LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NDQ5LCJOT1JNQUwiOjQ1MCwiVEVYQ09PUkRfMCI6NDUxfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMzIsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NDUyLCJtYXRlcmlhbCI6OCwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA2MCIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQ1MywiTk9STUFMIjo0NTQsIlRFWENPT1JEXzAiOjQ1NX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTMzLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjQ0OCwibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fSx7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQ1NiwiTk9STUFMIjo0NTcsIlRFWENPT1JEXzAiOjQ1OH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTM0LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjQ1MiwibWF0ZXJpYWwiOjgsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ2lyY2xlLjAwMiIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQ1OSwiTk9STUFMIjo0NjAsIlRFWENPT1JEXzAiOjQ2MSwiQ09MT1JfMCI6NDYyfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMzUsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6MiwiQ09MT1JfMCI6M319fSwiaW5kaWNlcyI6NDYzLCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9LHsiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NDY0LCJOT1JNQUwiOjQ2NSwiVEVYQ09PUkRfMCI6NDY2LCJDT0xPUl8wIjo0Njd9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEzNiwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyLCJDT0xPUl8wIjozfX19LCJpbmRpY2VzIjo0NjgsIm1hdGVyaWFsIjo4LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDU4IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NDY5LCJOT1JNQUwiOjQ3MCwiVEVYQ09PUkRfMCI6NDcxfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxMzcsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NDcyLCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNTciLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0NzMsIk5PUk1BTCI6NDc0LCJURVhDT09SRF8wIjo0NzV9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjEzOCwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoyMzEsIm1hdGVyaWFsIjoxNiwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA1NiIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQ3NiwiTk9STUFMIjo0NzcsIlRFWENPT1JEXzAiOjQ3OH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTM5LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjQ3OSwibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDUwIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NDgwLCJOT1JNQUwiOjQ4MSwiVEVYQ09PUkRfMCI6NDgyfSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxNDAsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NDgzLCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wNDYiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0ODQsIk5PUk1BTCI6NDg1LCJURVhDT09SRF8wIjo0ODZ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE0MSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo0ODcsIm1hdGVyaWFsIjoxNiwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA0NSIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQ4OCwiTk9STUFMIjo0ODksIlRFWENPT1JEXzAiOjQ5MH0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTQyLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjQ5MSwibWF0ZXJpYWwiOjE2LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDQ0IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NDkyLCJOT1JNQUwiOjQ5MywiVEVYQ09PUkRfMCI6NDk0fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxNDMsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NDk1LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMzciLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo0OTYsIk5PUk1BTCI6NDk3LCJURVhDT09SRF8wIjo0OTh9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE0NCwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjoyNTcsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjAzNiIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjQ5OSwiTk9STUFMIjo1MDAsIlRFWENPT1JEXzAiOjUwMX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTQ1LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjQ3MiwibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDM0IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NTAyLCJOT1JNQUwiOjUwMywiVEVYQ09PUkRfMCI6NTA0fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxNDYsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NTA1LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMzMiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo1MDYsIk5PUk1BTCI6NTA3LCJURVhDT09SRF8wIjo1MDh9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE0NywiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo0ODMsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjAzMiIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjUwOSwiTk9STUFMIjo1MTAsIlRFWENPT1JEXzAiOjUxMX0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTQ4LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjQ4NywibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDQwIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NTEyLCJOT1JNQUwiOjUxMywiVEVYQ09PUkRfMCI6NTE0fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxNDksImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NTE1LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMzkiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo1MTYsIk5PUk1BTCI6NTE3LCJURVhDT09SRF8wIjo1MTh9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE1MCwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo1MTksIm1hdGVyaWFsIjoxNiwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjAzMSIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjUyMCwiTk9STUFMIjo1MjEsIlRFWENPT1JEXzAiOjUyMn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTUxLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjUyMywibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDMwIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NTI0LCJOT1JNQUwiOjUyNSwiVEVYQ09PUkRfMCI6NTI2fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxNTIsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NDk1LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMzgiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo1MjcsIk5PUk1BTCI6NTI4LCJURVhDT09SRF8wIjo1Mjl9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE1MywiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo1MzAsIm1hdGVyaWFsIjoxNiwibW9kZSI6NH1dfSx7Im5hbWUiOiJDdWJlLjA0OCIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjUzMSwiTk9STUFMIjo1MzIsIlRFWENPT1JEXzAiOjUzM30sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTU0LCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjJ9fX0sImluZGljZXMiOjUzNCwibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fV19LHsibmFtZSI6IkN1YmUuMDQ5IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NTM1LCJOT1JNQUwiOjUzNiwiVEVYQ09PUkRfMCI6NTM3fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxNTUsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NTE5LCJtYXRlcmlhbCI6MTcsIm1vZGUiOjR9XX0seyJuYW1lIjoiQ3ViZS4wMjkiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo1MzgsIk5PUk1BTCI6NTM5LCJURVhDT09SRF8wIjo1NDB9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE1NiwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo1NDEsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfSx7Im5hbWUiOiJDeWxpbmRlci4wMDEiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo1NDIsIk5PUk1BTCI6NTQzLCJURVhDT09SRF8wIjo1NDR9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE1NywiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo1NDUsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfSx7Im5hbWUiOiJTUzA0IiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NTQ2LCJOT1JNQUwiOjU0NywiVEVYQ09PUkRfMCI6NTQ4fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxNTgsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NTQ5LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiU1MwNC4wMDEiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo1NTAsIk5PUk1BTCI6NTUxLCJURVhDT09SRF8wIjo1NTJ9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE1OSwiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo1NTMsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfSx7Im5hbWUiOiJTUzA1LjAwMSIsInByaW1pdGl2ZXMiOlt7ImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjU1NCwiTk9STUFMIjo1NTUsIlRFWENPT1JEXzAiOjU1NiwiQ09MT1JfMCI6NTU3fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxNjAsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6MiwiQ09MT1JfMCI6M319fSwiaW5kaWNlcyI6NTU4LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiU1MwNS4wMDIiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo1NTksIk5PUk1BTCI6NTYwLCJURVhDT09SRF8wIjo1NjEsIkNPTE9SXzAiOjU2Mn0sImV4dGVuc2lvbnMiOnsiS0hSX2RyYWNvX21lc2hfY29tcHJlc3Npb24iOnsiYnVmZmVyVmlldyI6MTYxLCJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjowLCJOT1JNQUwiOjEsIlRFWENPT1JEXzAiOjIsIkNPTE9SXzAiOjN9fX0sImluZGljZXMiOjU1OCwibWF0ZXJpYWwiOjE3LCJtb2RlIjo0fV19LHsibmFtZSI6IlNTMTIuMDAxIiwicHJpbWl0aXZlcyI6W3siYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6NTYzLCJOT1JNQUwiOjU2NCwiVEVYQ09PUkRfMCI6NTY1fSwiZXh0ZW5zaW9ucyI6eyJLSFJfZHJhY29fbWVzaF9jb21wcmVzc2lvbiI6eyJidWZmZXJWaWV3IjoxNjIsImF0dHJpYnV0ZXMiOnsiUE9TSVRJT04iOjAsIk5PUk1BTCI6MSwiVEVYQ09PUkRfMCI6Mn19fSwiaW5kaWNlcyI6NTY2LCJtYXRlcmlhbCI6MTYsIm1vZGUiOjR9XX0seyJuYW1lIjoiU1MxMi4wMDIiLCJwcmltaXRpdmVzIjpbeyJhdHRyaWJ1dGVzIjp7IlBPU0lUSU9OIjo1NjcsIk5PUk1BTCI6NTY4LCJURVhDT09SRF8wIjo1Njl9LCJleHRlbnNpb25zIjp7IktIUl9kcmFjb19tZXNoX2NvbXByZXNzaW9uIjp7ImJ1ZmZlclZpZXciOjE2MywiYXR0cmlidXRlcyI6eyJQT1NJVElPTiI6MCwiTk9STUFMIjoxLCJURVhDT09SRF8wIjoyfX19LCJpbmRpY2VzIjo1NzAsIm1hdGVyaWFsIjoxNywibW9kZSI6NH1dfV0sInRleHR1cmVzIjpbeyJzYW1wbGVyIjowLCJzb3VyY2UiOjB9LHsic2FtcGxlciI6MCwic291cmNlIjowfSx7InNhbXBsZXIiOjAsInNvdXJjZSI6MX0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjF9LHsic2FtcGxlciI6MCwic291cmNlIjoyfSx7InNhbXBsZXIiOjAsInNvdXJjZSI6Mn0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjN9LHsic2FtcGxlciI6MCwic291cmNlIjozfSx7InNhbXBsZXIiOjAsInNvdXJjZSI6MX0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjF9LHsic2FtcGxlciI6MCwic291cmNlIjoyfSx7InNhbXBsZXIiOjAsInNvdXJjZSI6Mn0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjR9LHsic2FtcGxlciI6MCwic291cmNlIjo0fSx7InNhbXBsZXIiOjAsInNvdXJjZSI6NX0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjZ9LHsic2FtcGxlciI6MCwic291cmNlIjo3fSx7InNhbXBsZXIiOjAsInNvdXJjZSI6OH0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjl9LHsic2FtcGxlciI6MCwic291cmNlIjoxMH0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjExfSx7InNhbXBsZXIiOjAsInNvdXJjZSI6MTJ9LHsic2FtcGxlciI6MCwic291cmNlIjoxM30seyJzYW1wbGVyIjowLCJzb3VyY2UiOjE0fSx7InNhbXBsZXIiOjAsInNvdXJjZSI6MTV9LHsic2FtcGxlciI6MCwic291cmNlIjoxNn0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjEyfSx7InNhbXBsZXIiOjAsInNvdXJjZSI6MTd9LHsic2FtcGxlciI6MCwic291cmNlIjoxOH0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjE1fSx7InNhbXBsZXIiOjAsInNvdXJjZSI6MTl9LHsic2FtcGxlciI6MCwic291cmNlIjoyMH0seyJzYW1wbGVyIjowLCJzb3VyY2UiOjIxfSx7InNhbXBsZXIiOjAsInNvdXJjZSI6MjJ9LHsic2FtcGxlciI6MCwic291cmNlIjoyM30seyJzYW1wbGVyIjowLCJzb3VyY2UiOjIxfV0sImltYWdlcyI6W3siYnVmZmVyVmlldyI6MSwibWltZVR5cGUiOiJpbWFnZS9qcGVnIiwibmFtZSI6IlJPQUQifSx7ImJ1ZmZlclZpZXciOjMsIm1pbWVUeXBlIjoiaW1hZ2UvanBlZyIsIm5hbWUiOiJwYXZlbWVudCJ9LHsiYnVmZmVyVmlldyI6NSwibWltZVR5cGUiOiJpbWFnZS9qcGVnIiwibmFtZSI6IlBhdmluZ1N0b25lIn0seyJidWZmZXJWaWV3Ijo3LCJtaW1lVHlwZSI6ImltYWdlL2pwZWciLCJuYW1lIjoiQ09OQ1JFVEUuanBnIn0seyJidWZmZXJWaWV3IjoxMywibWltZVR5cGUiOiJpbWFnZS9qcGVnIiwibmFtZSI6IkNPTkNSRVRFIn0seyJidWZmZXJWaWV3IjoxNSwibWltZVR5cGUiOiJpbWFnZS9qcGVnIiwibmFtZSI6IlBST1BTIEVNSVNTSU9OLmpwZyJ9LHsiYnVmZmVyVmlldyI6MTYsIm1pbWVUeXBlIjoiaW1hZ2UvanBlZyIsIm5hbWUiOiJQUk9QUy5qcGcifSx7ImJ1ZmZlclZpZXciOjE3LCJtaW1lVHlwZSI6ImltYWdlL3BuZyIsIm5hbWUiOiJQUk9QUyBNRVRBTExJQy1QUk9QUyBST1VHSE5FU1MifSx7ImJ1ZmZlclZpZXciOjE5LCJtaW1lVHlwZSI6ImltYWdlL2pwZWciLCJuYW1lIjoiR1JBU1MifSx7ImJ1ZmZlclZpZXciOjIxLCJtaW1lVHlwZSI6ImltYWdlL2pwZWciLCJuYW1lIjoiQkFSSyJ9LHsiYnVmZmVyVmlldyI6MjMsIm1pbWVUeXBlIjoiaW1hZ2UvanBlZyIsIm5hbWUiOiJMRUFGIn0seyJidWZmZXJWaWV3IjoyNiwibWltZVR5cGUiOiJpbWFnZS9qcGVnIiwibmFtZSI6IkpBUEFOIFVSQkFOIEJVSUxESU5HIE9ORSBURVgifSx7ImJ1ZmZlclZpZXciOjI3LCJtaW1lVHlwZSI6ImltYWdlL3BuZyIsIm5hbWUiOiJKQVBBTiBVUkJBTiBCVUlMRElORyBNRVRBTExJQy1KQVBBTiBVUkJBTiBCVUlMRElORyBST1VHSE5FU1MifSx7ImJ1ZmZlclZpZXciOjI5LCJtaW1lVHlwZSI6ImltYWdlL2pwZWciLCJuYW1lIjoiSkFQQU4gVVJCQU4gUFJPUFMgRU1JSVNJVkUifSx7ImJ1ZmZlclZpZXciOjMwLCJtaW1lVHlwZSI6ImltYWdlL2pwZWciLCJuYW1lIjoiSkFQQU4gVVJCQU4gUFJPUFMifSx7ImJ1ZmZlclZpZXciOjMxLCJtaW1lVHlwZSI6ImltYWdlL3BuZyIsIm5hbWUiOiJKQVBBTiBVUkJBTiBQUk9QUyBNRVRBTExJQy1KQVBBTiBVUkJBTiBQUk9QUyBST1VHSE5FU1MifSx7ImJ1ZmZlclZpZXciOjUxLCJtaW1lVHlwZSI6ImltYWdlL2pwZWciLCJuYW1lIjoiSkFQQU4gVVJCQU4gQlVJTERJTkcgT05FIFRFWCB2MiJ9LHsiYnVmZmVyVmlldyI6NTMsIm1pbWVUeXBlIjoiaW1hZ2UvanBlZyIsIm5hbWUiOiJKQVBBTiBVUkJBTiBQUk9QUyBFTUlJU0lWRSBWMiJ9LHsiYnVmZmVyVmlldyI6NTQsIm1pbWVUeXBlIjoiaW1hZ2UvanBlZyIsIm5hbWUiOiJKQVBBTiBVUkJBTiBQUk9QUyBWMiJ9LHsiYnVmZmVyVmlldyI6NzQsIm1pbWVUeXBlIjoiaW1hZ2UvanBlZyIsIm5hbWUiOiJDWUJFUlBVTksgQlVJTERJTkcgTElHSFQuanBnIn0seyJidWZmZXJWaWV3Ijo3NSwibWltZVR5cGUiOiJpbWFnZS9qcGVnIiwibmFtZSI6IkNZQkVSUFVOSyBCVUlMRElORy5qcGcifSx7ImJ1ZmZlclZpZXciOjc2LCJtaW1lVHlwZSI6ImltYWdlL3BuZyIsIm5hbWUiOiJDWUJFUlBVTksgQlVJTERJTkcgTUVUQUxMSUMtQ1lCRVJQVU5LIEJVSUxESU5HIHJvdWdobmVzcyJ9LHsiYnVmZmVyVmlldyI6NzgsIm1pbWVUeXBlIjoiaW1hZ2UvanBlZyIsIm5hbWUiOiJDWUJFUlBVTksgQlVJTERJTkcgRU1JU1NJVkUgVjIuanBnIn0seyJidWZmZXJWaWV3Ijo3OSwibWltZVR5cGUiOiJpbWFnZS9qcGVnIiwibmFtZSI6IkNZQkVSUFVOSyBCVUlMRElORyBWMi5qcGcifV0sImFjY2Vzc29ycyI6W3siY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjM0NjEsIm1heCI6WzIuOTM1MTc1NDE4ODUzNzU5OCwwLjAwMDU2MDEwMTEyMTY2NDA0NzIsMi45MzUxNDYwOTMzNjg1MzAzXSwibWluIjpbLTIuOTM1MTQ2NTcwMjA1Njg4NSwwLC0yLjkzNTE3NTE4MDQzNTE4MDddLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjM0NjEsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MzQ2MSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo3MzExLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTQ1LCJtYXgiOlsxLjgzMjAwMjk5NzM5ODM3NjUsMC4wMDEwMTY2NjkyMDgxODM4ODQ2LDEuODMxNTI4MDY3NTg4ODA2Ml0sIm1pbiI6Wy0xLjgzMjAwMjk5NzM5ODM3NjUsMCwwLjYyNjE0MDc3MzI5NjM1NjJdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE0NSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNDUsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MjEzLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjY3LCJtYXgiOlsxLjgzMTUyNzk0ODM3OTUxNjYsMC4wMDExNDI0OTkyNjk5MTc2MDczLDEuODMyMDAyNjM5NzcwNTA3OF0sIm1pbiI6Wy0xLjIyNTEzMzE4MDYxODI4NjEsLTEuODM2ODgyNDM4NTEwNjU2NGUtMDUsLTEuODMyMDAyODc4MTg5MDg3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNjcsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjY3LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjM1MSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEzNzQ0LCJtYXgiOlsyLjAwNDEwNTgwNjM1MDcwOCwwLjI0OTM5NDE3ODM5MDUwMjkzLDIuNzM1MDk1NTAwOTQ2MDQ1XSwibWluIjpbLTEuNDc4NTM3NDQwMjk5OTg3OCwtMC4xMTM3MDY5MzE0NzE4MjQ2NSwtMS40Nzg1Mzc0NDAyOTk5ODc4XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMzc0NCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMzc0NCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxNjQ0NiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjMzLCJtYXgiOlswLjA0NDc3Mzc3MjM1ODg5NDM1LDAuMDIwMTQzNTQ5ODg5MzI2MDk2LDEuNDc4NTM3MzIxMDkwNjk4Ml0sIm1pbiI6Wy0xLjQ3ODUzNzQ0MDI5OTk4NzgsMC4wMDMxMTk2ODQyOTAxNDA4NjcyLC0xLjQ3ODUzNzQ0MDI5OTk4NzhdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjMzLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjMzLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjYzLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTI5LCJtYXgiOlsyLjAwMTgxNjk4Nzk5MTMzMywwLjI0OTM5NDE3ODM5MDUwMjkzLDIuNzAzOTA5NjM1NTQzODIzMl0sIm1pbiI6Wy0xLjM3NjAzODY3MDUzOTg1NiwtMC4xMTM3MDY5MzE0NzE4MjQ2NSwtMS4zNzYwMzg2NzA1Mzk4NTZdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEyOSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMjksInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTcxLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODA2NywibWF4IjpbMC45OTM1OTUzMDIxMDQ5NSwwLjAwMzI0ODc0NTgwODM3Nzg2MiwwLjk5MzU5NTMwMjEwNDk1XSwibWluIjpbLTAuOTkzNTk1MzAyMTA0OTUsLTAuMDA2NzU5MDcyNjUzOTQ5MjYxLC0wLjk5MzU5NTM2MTcwOTU5NDddLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjgwNjcsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODA2NywidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxMzcxMywidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjkwLCJtYXgiOlswLjI4MzAxODUyOTQxNTEzMDYsMC4wMDMyNDg3NDU4MDgzNzc4NjIsMC4yODM5MjEzMzExNjcyMjEwN10sIm1pbiI6Wy0wLjI4MzAxODUyOTQxNTEzMDYsMC4wMDMyNDQ0NTAzMTU4MzMwOTE3LC0wLjI4MzkyMTMzMTE2NzIyMTA3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo5MCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo5MCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo5MCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE0Mzc4LCJtYXgiOlsyLjM0MDAwNzMwNTE0NTI2MzcsMC4wMTg1Njg0Mzc1NDY0OTE2MjMsMy4xNTAzNzY1NTgzMDM4MzNdLCJtaW4iOlstMy42ODkxNzY1NTk0NDgyNDIsLTAuMTA1MDQ1ODk5NzQ4ODAyMTksLTIuODkyMTY1NDIyNDM5NTc1XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNDM3OCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNDM3OCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxOTc1MiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE0MTMzMCwibWF4IjpbNDk2LjEzNzg3ODQxNzk2ODc1LDcuMTkwOTM3MDQyMjM2MzI4LDIxNi40ODI4NDkxMjEwOTM3NV0sIm1pbiI6Wy01NDMuMjIzODE1OTE3OTY4OCwtMC4wNzA2OTU2MjM3NTU0NTUwMiwtNjYyLjgyNTc0NDYyODkwNjJdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE0MTMzMCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNDEzMzAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTQxMzMwLCJub3JtYWxpemVkIjp0cnVlLCJ0eXBlIjoiVkVDNCJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNSwiY291bnQiOjE4MTIyNCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjkxMiwibWF4IjpbNDg5Ljg1OTEzMDg1OTM3NSwwLjA1ODE3NjI1NjcxNjI1MTM3LDIxNi45MjgwNzAwNjgzNTkzOF0sIm1pbiI6Wy01NDMuNjY4ODg0Mjc3MzQzOCwwLjAyOTYxNTYxODI4ODUxNywtNjQ2Ljc1MTM0Mjc3MzQzNzVdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjkxMiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo5MTIsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6OTEyLCJub3JtYWxpemVkIjp0cnVlLCJ0eXBlIjoiVkVDNCJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjE3OTQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMjE2NywibWF4IjpbNDkwLjE2NDc5NDkyMTg3NSw2LjAzODcxODIyMzU3MTc3NywyMTguNDU2NDUxNDE2MDE1NjJdLCJtaW4iOlstNTQ1LjE5NzU3MDgwMDc4MTIsLTAuMDAyNjQzMTk3MDc2Mzk1MTU0LC02NDcuMzM1MjY2MTEzMjgxMl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTIxNjcsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTIxNjcsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTIxNjcsIm5vcm1hbGl6ZWQiOnRydWUsInR5cGUiOiJWRUM0In0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTIzODcsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo2ODQwMCwibWF4IjpbNDg0LjE3OTAxNjExMzI4MTI1LDYuMjUxMDQ0NzUwMjEzNjIzLDIxOC43MDcwMzEyNV0sIm1pbiI6Wy01NDUuNDQ3OTk4MDQ2ODc1LDAuODU4ODM1ODE2MzgzMzYxOCwtNjQ0LjcwMjIwOTQ3MjY1NjJdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjY4NDAwLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjY4NDAwLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjY4NDAwLCJub3JtYWxpemVkIjp0cnVlLCJ0eXBlIjoiVkVDNCJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNSwiY291bnQiOjEwMjYwMCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI1MTYsIm1heCI6WzM1MS44MDgxNjY1MDM5MDYyNSwxLjEwNzMzNDEzNjk2Mjg5MDYsMTI5LjcxMDcyMzg3Njk1MzEyXSwibWluIjpbLTEyLjU2Mzg0ODQ5NTQ4MzM5OCwwLjAzNTE5MDQ2MzA2NjEwMTA3NCwtNTI3LjkyNDQzODQ3NjU2MjVdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI1MTYsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjUxNiwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozNzc0LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjQ2MywibWF4IjpbMi4wMzA5ODA4MjU0MjQxOTQzLDQuNzA3Mjg1ODgxMDQyNDgwNSw0LjYzOTYwNDA5MTY0NDI4N10sIm1pbiI6Wy0xLjkyMzk3NTcwNjEwMDQ2MzksLTEuODE2MDYxOTczNTcxNzc3MywtMy45NDA4MTgwNzEzNjUzNTY0XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNDYzLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI0NjMsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NDAxMSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEwMDEsIm1heCI6WzEuODYwNDI0OTk1NDIyMzYzMywyLjczODc4MDk3NTM0MTc5Nyw2Ljg3NTI0OTM4NTgzMzc0XSwibWluIjpbLTEuOTg5MDM1ODQ0ODAyODU2NCwtMS44MzM2OTQzMzg3OTg1MjMsMy42NTY5NDQ3NTE3Mzk1MDJdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEwMDEsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTAwMSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozMTAyLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTI3OCwibWF4IjpbMi40NDQwNDg0MDQ2OTM2MDM1LDQuMjcyNzY4OTc0MzA0MTk5LDMuMjA1NjcwODMzNTg3NjQ2NV0sIm1pbiI6Wy0yLjQ2NzYwMTI5OTI4NTg4ODcsLTQuMDE3MzI2MzU0OTgwNDY5LC05LjE2Njk4MjY1MDc1NjgzNl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTI3OCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMjc4LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIwMDQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMzksIm1heCI6WzIuMzc5NDI5MTAxOTQzOTY5NywzLjA2MTg0Njk3MTUxMTg0MSw1Ljc0MTYyMTk3MTEzMDM3MV0sIm1pbiI6Wy0yLjI4MTk0MTE3NTQ2MDgxNTQsLTQuMDAwNzQ2NzI2OTg5NzQ2LDIuMjQ2NDc5NzQ5Njc5NTY1NF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjM5LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjIzOSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo0MjAsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNTI1LCJtYXgiOlszLjk4MDQwNDYxNTQwMjIyMTcsNC43MTQ1NzI5MDY0OTQxNDEsMy45NjM3ODEzNTY4MTE1MjM0XSwibWluIjpbLTMuOTUzMTMwNDgzNjI3MzE5MywtMS42ODIwMzYxNjE0MjI3Mjk1LC02LjQzOTUzNzUyNTE3NzAwMl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjUyNSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNTI1LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjM1NDMsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNjUsIm1heCI6WzMuNjg3Njg1OTY2NDkxNjk5LDIuMzAzODM0NDM4MzIzOTc0Niw1LjkxMTI2MjUxMjIwNzAzMV0sIm1pbiI6Wy0zLjgzOTAyNTAyMDU5OTM2NTIsLTEuNzIwMDU3MDEwNjUwNjM0OCwxLjkyNjUwODQyNjY2NjI1OThdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI2NSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNjUsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MzY5LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTA4MSwibWF4IjpbMy41NTgyNjk5Nzc1Njk1OCw1LjAzNzk3NjI2NDk1MzYxMywyLjE0NDMxMDcxMjgxNDMzMV0sIm1pbiI6Wy0zLjU3ODEyMzU2OTQ4ODUyNTQsLTEuMTkxMDY0NTk2MTc2MTQ3NSwtNi41NzA4NzEzNTMxNDk0MTRdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEwODEsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTA4MSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxODAzLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTA0MiwibWF4IjpbMy45MDM2NDMxMzEyNTYxMDM1LDMuNzA5MzI1MDc1MTQ5NTM2LDUuMzIyOTEyMjE2MTg2NTIzXSwibWluIjpbLTMuNTUxNTM5ODk3OTE4NzAxLC0xLjE5NTMxNzM4NzU4MDg3MTYsLTEuMTU0MjI5MjgzMzMyODI0N10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTA0MiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMDQyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMxOTUsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0ODUsIm1heCI6WzMuMzEwOTg2OTk1Njk3MDIxNSw0LjE2NDk4Mjc5NTcxNTMzMiwzLjQ3Njc2NTYzMjYyOTM5NDVdLCJtaW4iOlstNS41Nzk1NDg4MzU3NTQzOTQ1LC0yLjUzNTU0MDEwMzkxMjM1MzUsLTMuNjA2ODMwMzU4NTA1MjQ5XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0ODUsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDg1LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjgyNSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEzMywibWF4IjpbMi45ODI0MDk3MTU2NTI0NjYsMS45MTA1MDgyNzUwMzIwNDM1LDguNzQwNjI5MTk2MTY2OTkyXSwibWluIjpbLTUuMjUwNTg2NTA5NzA0NTksLTIuNTMzMTU5NDk0NDAwMDI0NCwwLjA4MjQ2NDk4NTU0OTQ0OTkyXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMzMsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTMzLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIxMywidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQwNjUsIm1heCI6WzIuODAxNzgxNDE1OTM5MzMxLDUuNzg2MTkxOTQwMzA3NjE3LDQuMjA1NTMxNTk3MTM3NDUxXSwibWluIjpbLTIuNzM2ODIyMTI4Mjk1ODk4NCwtMS42MTM0NTk0Njc4ODc4Nzg0LC01LjkxNjkyNDk1MzQ2MDY5M10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDA2NSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0MDY1LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjQwNjUsIm5vcm1hbGl6ZWQiOnRydWUsInR5cGUiOiJWRUM0In0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NjE4OSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE0NywibWF4IjpbMy4wNjY0NzI1MzAzNjQ5OTAyLDIuODQyNTE1NDY4NTk3NDEyLDcuMTIzNjIyNDE3NDQ5OTUxXSwibWluIjpbLTIuNDA3ODE1OTMzMjI3NTM5LC0xLjYwMTM0MzAzNTY5NzkzNywxLjM2NzkyNzA3NDQzMjM3M10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTQ3LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE0NywidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxNDcsIm5vcm1hbGl6ZWQiOnRydWUsInR5cGUiOiJWRUM0In0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6Mjc2LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDc3MywibWF4IjpbNS43OTA2MTg0MTk2NDcyMTcsNC45MDc3MTI0NTk1NjQyMDksNi41OTkxMTM5NDExOTI2MjddLCJtaW4iOlstNS43OTY0OTc4MjE4MDc4NjEsLTMuMDE3MDcyMjAwNzc1MTQ2NSwtNi4zNTg3Nzc1MjMwNDA3NzE1XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0NzczLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQ3NzMsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6ODAxOSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjk2OCwibWF4IjpbNS42MzIxODc4NDMzMjI3NTQsMy4xMDMzOTUyMjM2MTc1NTM3LDkuMTIwNTc4NzY1ODY5MTRdLCJtaW4iOlstNS41MDE0Njc3MDQ3NzI5NDksLTIuOTkxMjU4MTQ0Mzc4NjYyLDIuOTY0NzcwMDc4NjU5MDU3Nl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6OTY4LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjk2OCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxNzA0LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjQzMywibWF4IjpbMy40MjY0MTE4NjcxNDE3MjM2LDQuMzYzMzMzNzAyMDg3NDAyLDUuMDA4NTc2ODY5OTY0Nl0sIm1pbiI6Wy0zLjU0MzQ4NjU5NTE1MzgwODYsLTQuNDcxOTMwOTgwNjgyMzczLC03LjA2OTM1OTMwMjUyMDc1Ml0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjQzMywidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNDMzLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjM4ODIsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozODksIm1heCI6WzMuNDI1ODUxNTgzNDgwODM1LDIuOTI1NjkwNDEyNTIxMzYyMyw3LjY3NTA4ODg4MjQ0NjI4OV0sIm1pbiI6Wy0zLjIzMTEyNzI2MjExNTQ3ODUsLTQuNDA5OTI2NDE0NDg5NzQ2LDIuNjk5NTY2MTI1ODY5NzUxXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozODksInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6Mzg5LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjYyMSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjIwMjQsIm1heCI6WzMuMTkxOTQ2MDI5NjYzMDg2LDcuNDExMjM3MjM5ODM3NjQ2NSwyLjk2MjQzMzgxNTAwMjQ0MTRdLCJtaW4iOlstMy4yOTM5MTk4MDE3MTIwMzYsLTAuMDA2NTUzNjI2MTUzNjE4MDk3LC01LjgzNDQzODgwMDgxMTc2OF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjAyNCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMDI0LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMyODIsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo3MjQsIm1heCI6WzIuOTkwMDU5MTM3MzQ0MzYwNCw0LjAzMzY2MTg0MjM0NjE5MSw3LjQ5MjA5ODgwODI4ODU3NF0sIm1pbiI6Wy0zLjAwOTA1ODcxMzkxMjk2NCwtMC4wMjMxNTk1NjU0MDQwNTc1MDMsMS40NjMxMDAwNzU3MjE3NDA3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo3MjQsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NzI0LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjEyNDgsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozNDE2LCJtYXgiOlszLjQ1NjYyNjE3NjgzNDEwNjQsNC45MTc5ODM1MzE5NTE5MDQsMy4wNDE3ODE5MDIzMTMyMzI0XSwibWluIjpbLTMuNDQ0MjU2MDY3Mjc2MDAxLC0yLjg1OTExNDg4NTMzMDIsLTcuODk2NTE5NjYwOTQ5NzA3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozNDE2LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjM0MTYsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NTY3MywidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjIwMSwibWF4IjpbMi45OTc0MDk4MjA1NTY2NDA2LDIuODU2MjIzODIxNjQwMDE0Niw1LjU2MzEyNjA4NzE4ODcyMV0sIm1pbiI6Wy0zLjA2MjQwNzAxNjc1NDE1MDQsLTIuNzE1ODMxMjc5NzU0NjM4NywwLjA3NTE0NDQ4NDYzOTE2Nzc5XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMDEsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjAxLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjM3NSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI5NzYsIm1heCI6WzMuNDI2NDExODY3MTQxNzIzNiw0LjM2MzMzMzcwMjA4NzQwMiw1LjAwOTU4Mzk1MDA0MjcyNV0sIm1pbiI6Wy0zLjU1NDQzNjQ0NTIzNjIwNiwtNC40NzE5MzA5ODA2ODIzNzMsLTcuMDY5MzU5MzAyNTIwNzUyXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyOTc2LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI5NzYsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NDgzOSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQ3OSwibWF4IjpbMy40MjU4NTE1ODM0ODA4MzUsMi45MjU2OTA0MTI1MjEzNjIzLDcuNjc1MTU4OTc3NTA4NTQ1XSwibWluIjpbLTMuMjMxMTI3MjYyMTE1NDc4NSwtNC40MDk5MjY0MTQ0ODk3NDYsMi42OTk1NjYxMjU4Njk3NTFdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQ3OSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0NzksInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NzQ0LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MzIwOCwibWF4IjpbMi44MDE3ODE0MTU5MzkzMzEsNS43ODQ2MjEyMzg3MDg0OTYsNC4yMDU1MzE1OTcxMzc0NTFdLCJtaW4iOlstMi43MzY4MjIxMjgyOTU4OTg0LC0xLjYxMzQ1OTQ2Nzg4Nzg3ODQsLTUuOTE2ODQxNTA2OTU4MDA4XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozMjA4LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjMyMDgsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MzIwOCwibm9ybWFsaXplZCI6dHJ1ZSwidHlwZSI6IlZFQzQifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo0ODY2LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTA0LCJtYXgiOlszLjA2MTQxOTAxMDE2MjM1MzUsMi42MDAwMzEzNzU4ODUwMDk4LDcuMTIzNTYzNzY2NDc5NDkyXSwibWluIjpbLTIuNDA4NDMxMjkxNTgwMiwtMS41OTkzNDYyODAwOTc5NjE0LDEuMzY3OTI3MDc0NDMyMzczXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMDQsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTA0LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjEwNCwibm9ybWFsaXplZCI6dHJ1ZSwidHlwZSI6IlZFQzQifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxODksInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0MzkxLCJtYXgiOlszLjM4ODM5MjQ0ODQyNTI5Myw0LjIxNjAyMTUzNzc4MDc2MiwzLjc2MTg1NzAzMjc3NTg3OV0sIm1pbiI6Wy01LjcwMDI3NTg5Nzk3OTczNiwtMi41MzU1NDAxMDM5MTIzNTM1LC0zLjYwNjgzMDU5NjkyMzgyOF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDM5MSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0MzkxLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjY0MzUsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozODgsIm1heCI6WzMuMDIxMDcwMDAzNTA5NTIxNSwxLjkxMDUwODI3NTAzMjA0MzUsOC43NDA2MjkxOTYxNjY5OTJdLCJtaW4iOlstNS4yNzkwNzUxNDU3MjE0MzU1LC0yLjUzMzE1OTQ5NDQwMDAyNDQsMC4wODI0NjQ5ODU1NDk0NDk5Ml0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6Mzg4LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjM4OCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo2NTcsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMzgyLCJtYXgiOlszLjYyNjQwMjM3ODA4MjI3NTQsNS4wODg4MjA0NTc0NTg0OTYsMi4xNDQzMTA3MTI4MTQzMzFdLCJtaW4iOlstMy42NDk4NDg2OTk1Njk3MDIsLTEuMTkxMDY0NTk2MTc2MTQ3NSwtNi41NzA4NzEzNTMxNDk0MTRdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEzODIsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTM4MiwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoyMjk4LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTA0MywibWF4IjpbMy45MDM2NDMxMzEyNTYxMDM1LDMuNzA5MzI1MDc1MTQ5NTM2LDUuMzQzMjc2MDIzODY0NzQ2XSwibWluIjpbLTMuNTY3MzAzNjU3NTMxNzM4MywtMS4xOTUzMTczODc1ODA4NzE2LC0xLjE1NDIyOTI4MzMzMjgyNDddLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEwNDMsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTA0MywidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozMTUwLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MzA4MiwibWF4IjpbMy45ODk3MjYwNjY1ODkzNTU1LDQuNzEzNDgzMzMzNTg3NjQ2NSwzLjk3MjAxMDM3NDA2OTIxNF0sIm1pbiI6Wy0zLjk1MzEzMDQ4MzYyNzMxOTMsLTEuNjgyMDM2MTYxNDIyNzI5NSwtNi40Mzk2NDQzMzY3MDA0Mzk1XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozMDgyLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjMwODIsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NTE4NCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjg5OSwibWF4IjpbMy42ODc2ODU5NjY0OTE2OTksMi4zMDM0MjAwNjY4MzM0OTYsNS45MTkwNTg3OTk3NDM2NTJdLCJtaW4iOlstMy44MzkwMjUwMjA1OTkzNjUyLC0xLjcyMDA1NzAxMDY1MDYzNDgsMS45MjY1MDg0MjY2NjYyNTk4XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo4OTksInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODk5LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjE2MTQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyOTA4LCJtYXgiOlsyLjM3ODI5NTQyMTYwMDM0Miw0LjI5NzE0MzQ1OTMyMDA2OCwzLjIyNzg3ODA5MzcxOTQ4MjRdLCJtaW4iOlstMi40Njc2NzEzOTQzNDgxNDQ1LC00LjI4OTg1NzM4NzU0MjcyNSwtOS4xNjY4MzE5NzAyMTQ4NDRdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI5MDgsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjkwOCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo0ODE4LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6Mzc5LCJtYXgiOlsyLjM3OTQyOTEwMTk0Mzk2OTcsMy4wNjE4NDY5NzE1MTE4NDEsNS43NjAzNDgzMjAwMDczMjRdLCJtaW4iOlstMi4yODA4NjQ0NzcxNTc1OTI4LC0zLjk5OTEyMzU3MzMwMzIyMjcsMi4yNDY0Nzk3NDk2Nzk1NjU0XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozNzksInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6Mzc5LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjY1NCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI4NjgsIm1heCI6WzMuNDU2NjI2MTc2ODM0MTA2NCw0LjkzNzc0MDMyNTkyNzczNCwyLjkzNjI4MjYzNDczNTEwNzRdLCJtaW4iOlstMy40NDYxNjAzMTY0NjcyODUsLTIuODU5MTE0ODg1MzMwMiwtNy44NTg5MzY3ODY2NTE2MTFdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI4NjgsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6Mjg2OCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo0NDI1LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTA2LCJtYXgiOlsyLjk3MTc0OTA2NzMwNjUxODYsMi44NTYyMjM4MjE2NDAwMTQ2LDUuNTQ1ODA5NzQ1Nzg4NTc0XSwibWluIjpbLTMuMDYyNDA3MDE2NzU0MTUwNCwtMi43MTU4MzEyNzk3NTQ2Mzg3LDAuMDc1MTQ0NDg0NjM5MTY3NzldLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEwNiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMDYsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTgzLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjIzMSwibWF4IjpbMy4yMjE3NDYyMDYyODM1NjkzLDcuNDExMjM3MjM5ODM3NjQ2NSwyLjk1NTU2MzU0NTIyNzA1MV0sIm1pbiI6Wy0zLjI5ODk2NDUwMDQyNzI0NiwwLC01LjgyNDQ4MTk2NDExMTMyOF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjIzMSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMjMxLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjM3MzUsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo4NjAsIm1heCI6WzIuOTgyMDA0ODgwOTA1MTUxNCw0LjAzMzU5MTI3MDQ0Njc3Nyw3LjUwNTE5OTQzMjM3MzA0N10sIm1pbiI6Wy0zLjAwOTA1ODcxMzkxMjk2NCwtMC4wMTE1NzYyMjMxODcxNDg1NzEsMS41MTIxMTcxNDc0NDU2Nzg3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo4NjAsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODYwLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjE0NTUsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo1MjQ1LCJtYXgiOls1Ljc5MDYxODQxOTY0NzIxNyw0LjkwNzcxMjQ1OTU2NDIwOSw2LjU5OTExMzk0MTE5MjYyN10sIm1pbiI6Wy01Ljc5NjQ5NzgyMTgwNzg2MSwtMy4wMTcwNzIyMDA3NzUxNDY1LC02LjM1ODc3NzUyMzA0MDc3MTVdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjUyNDUsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTI0NSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo4MTg3LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTIxMywibWF4IjpbNS42MzIxODc4NDMzMjI3NTQsMy4xMDMzOTUyMjM2MTc1NTM3LDkuMTIwNTc4NzY1ODY5MTRdLCJtaW4iOlstNS41MDE0Njc3MDQ3NzI5NDksLTIuOTkxMjU4MTQ0Mzc4NjYyLDIuOTY0NzcwMDc4NjU5MDU3Nl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTIxMywidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMjEzLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIzMDQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNDQyLCJtYXgiOlsyLjAyMzUwNjQwMjk2OTM2MDQsNC43MDMzNTQ4MzU1MTAyNTQsNC42MzkyNDQwNzk1ODk4NDRdLCJtaW4iOlstMS45MjM5NzU3MDYxMDA0NjM5LC0xLjgxNjA2MTk3MzU3MTc3NzMsLTMuOTM5NTk3NjA2NjU4OTM1NV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjQ0MiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNDQyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjM5NzgsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMDAxLCJtYXgiOlsxLjg2MDQyNDk5NTQyMjM2MzMsMi43Mzg3ODA5NzUzNDE3OTcsNi44NTY5NjMxNTc2NTM4MDldLCJtaW4iOlstMS45ODkwMzU3MjU1OTM1NjcsLTEuODI3MDQ4NDIwOTA2MDY3LDMuNjU2OTQ0NzUxNzM5NTAyXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMDAxLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEwMDEsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MzA2NiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE1OTksIm1heCI6WzEuMDI2MjQwNTg3MjM0NDk3LDIuOTMxNzU3Njg4NTIyMzM5LDEuMDM4NjgzMjk1MjQ5OTM5XSwibWluIjpbLTEuMDMyMTUwNzQ1MzkxODQ1NywtMC4xNzI0NTYzMjQxMDA0OTQzOCwtMS4wMDEwNjI1MTIzOTc3NjYxXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNTk5LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE1OTksInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MzUzMSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjY3MCwibWF4IjpbMS45MDkyOTI4MTcxMTU3ODM3LDEuNDYzMjc0MTIxMjg0NDg0OSwwLjg4MDg3NzU1NDQxNjY1NjVdLCJtaW4iOlstMS45MjQwNDA1NTU5NTM5Nzk1LC0wLjY0MDU0MDE4MjU5MDQ4NDYsLTAuODgwODc3NTU0NDE2NjU2NV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NjcwLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjY3MCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxMjE4LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTkwMjQsIm1heCI6WzcuNjE3NzUyMDc1MTk1MzEyNSw1OS45MDU2Mzk2NDg0Mzc1LDcuNTk0NzQ1NjM1OTg2MzI4XSwibWluIjpbLTcuNjYxNzQzMTY0MDYyNSwwLjA5MzMxNTkxNDI3MzI2MjAyLC03LjgwNDg0ODE5NDEyMjMxNDVdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE5MDI0LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE5MDI0LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjE5MDI0LCJub3JtYWxpemVkIjp0cnVlLCJ0eXBlIjoiVkVDNCJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMwNDI5LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTY4NSwibWF4IjpbMTAuODgwOTY0Mjc5MTc0ODA1LDEuMzEyODcwMTQ0ODQ0MDU1MiwxMS43NDMxNTE2NjQ3MzM4ODddLCJtaW4iOlstMTEuMTEyMjg4NDc1MDM2NjIxLC0wLjAxMTkxNTY4NjU0MDMwNTYxNCwtMTAuNTMyMDU5NjY5NDk0NjI5XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNjg1LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE2ODUsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTY4NSwibm9ybWFsaXplZCI6dHJ1ZSwidHlwZSI6IlZFQzQifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoyNDMzLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTEyNTMsIm1heCI6WzYuMTAwODA2NzEzMTA0MjQ4LDMyLjEzNTE5Mjg3MTA5Mzc1LDUuNjYxODA5OTIxMjY0NjQ4XSwibWluIjpbLTYuMDg3NDgxMDIxODgxMTAzNSwtMC4wMDIxMDQ0MTA5MDE2NjU2ODc2LC01LjM4ODg5MTY5NjkyOTkzMl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTEyNTMsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTEyNTMsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTgwMzMsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNjg3LCJtYXgiOls4Ljk5NzAxNzg2MDQxMjU5OCwyLjA0MTUxMzkxOTgzMDMyMjMsNy42MzUwMjEyMDk3MTY3OTddLCJtaW4iOlstOC43NTM0MzcwNDIyMzYzMjgsLTAuMDIyMzA5MjU4NTgwMjA3ODI1LC05LjUwODkzMTE1OTk3MzE0NV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTY4NywidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNjg3LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIxMDksInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMDExMywibWF4IjpbMTQuMjYwODk5NTQzNzYyMjA3LDc5LjEyMTg3MTk0ODI0MjE5LDE0LjI2MDg5OTU0Mzc2MjIwN10sIm1pbiI6Wy0xNC4yNjA4OTk1NDM3NjIyMDcsMC4wMzU2ODQyMjc5NDM0MjA0MSwtMTQuMjYwODk5NTQzNzYyMjA3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMDExMywidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMDExMywidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozMjY5NywidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjc1NiwibWF4IjpbMS4xODM1OTk0NzIwNDU4OTg0LDEuMjM1NzE2MjIzNzE2NzM1OCwxLjAwNTc5Mjg1NjIxNjQzMDddLCJtaW4iOlstMC44Mjc5ODY5NTU2NDI3MDAyLC0xLjMwODc0MzAwMDAzMDUxNzYsLTEuMDA1NzkzMzMzMDUzNTg4OV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NzU2LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjc1NiwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxMTM0LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NjIwLCJtYXgiOlszLjMyOTkxMDI3ODMyMDMxMjUsNi40MzAyMTEwNjcxOTk3MDcsMS43MjUwMDM3MTkzMjk4MzRdLCJtaW4iOlstMy4zMjk5MTAyNzgzMjAzMTI1LC0wLjAwOTE3NTUwMjY5NTE0MzIyMywtNC45MzQ4MTY4MzczMTA3OTFdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjYyMCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo2MjAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTIwMCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjYyNCwibWF4IjpbMy4zMjk5MTAyNzgzMjAzMTI1LDYuNDMwMjExMDY3MTk5NzA3LDEuNzI1MDAzNzE5MzI5ODM0XSwibWluIjpbLTMuMzI5OTEwMjc4MzIwMzEyNSwtMC4wMDkxNzU1MDI2OTUxNDMyMjMsLTQuOTM0ODE2ODM3MzEwNzkxXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo2MjQsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NjI0LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjEyMjQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo4MDgsIm1heCI6WzYuODgyNDkyMDY1NDI5Njg3NSwxMS41Mjc5Mzg4NDI3NzM0MzgsNS42MjA1NjA2NDYwNTcxMjldLCJtaW4iOlstMi4zMTY2NjY2MDMwODgzNzksLTAuMDEzODQyMDU0NjQyNzM2OTEyLC01LjYyMDU2MDY0NjA1NzEyOV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODA4LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjgwOCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxMzc0LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODA4LCJtYXgiOls2Ljg4MjQ5MjA2NTQyOTY4NzUsMTEuNTI3OTM4ODQyNzczNDM4LDUuNjIwNTYwNjQ2MDU3MTI5XSwibWluIjpbLTIuMzE2NjY2NjAzMDg4Mzc5LC0wLjAxMzg0MjA1NDY0MjczNjkxMiwtNS42MjA1NjA2NDYwNTcxMjldLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjgwOCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo4MDgsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTM3NCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjExOTYsIm1heCI6WzMuMzQ5NTkzODc3NzkyMzU4NCw2LjU5NTU0NTI5MTkwMDYzNSw0LjMyMTQ1NjkwOTE3OTY4NzVdLCJtaW4iOlstMy4zNDk1OTY3Mzg4MTUzMDc2LDAuMDI2MDU5OTQ2MDQ1Mjc5NTAzLC03Ljc1MDIyODQwNDk5ODc3OV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTE5NiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMTk2LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjI0NzIsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNDUzLCJtYXgiOlszLjM0OTU5Mzg3Nzc5MjM1ODQsNi41OTU1NDUyOTE5MDA2MzUsNC4zMjE0NTY5MDkxNzk2ODc1XSwibWluIjpbLTMuMzQ5NTk2NzM4ODE1MzA3NiwwLjAyNjA1OTk0NjA0NTI3OTUwMywtNy43NTAyMjg0MDQ5OTg3NzldLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE0NTMsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTQ1MywidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoyOTg4LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTI3OSwibWF4IjpbMy4yODQ1NjU2ODcxNzk1NjU0LDEwLjIyOTg4NTEwMTMxODM2LDMuMzI5Njc3MTA0OTQ5OTUxXSwibWluIjpbLTMuMjg0NTY1Njg3MTc5NTY1NCwtMC4wMDY4NTgxODk1OTAyNzUyODgsLTMuMjg0NTY1Njg3MTc5NTY1NF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTI3OSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMjc5LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMwMzYsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMjgzLCJtYXgiOlszLjI4NDU2NTY4NzE3OTU2NTQsMTAuMjI5ODg1MTAxMzE4MzYsMy4zMjk3MDc2MjI1MjgwNzZdLCJtaW4iOlstMy4yODQ1NjU2ODcxNzk1NjU0LC0wLjAwNjg1ODE4OTU5MDI3NTI4OCwtMy4yODQ1NjU2ODcxNzk1NjU0XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMjgzLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEyODMsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MzAzNiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE2OTQsIm1heCI6WzMuMTg4NDUzNDM1ODk3ODI3LDYuODg1MTY3MTIxODg3MjA3LDQuODAzODg1NDU5ODk5OTAyXSwibWluIjpbLTMuMTg4NDUzNDM1ODk3ODI3LC0wLjAwODYxODk5MDg5MDY4MTc0NCwtNy4xMDU4NDExNTk4MjA1NTddLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE2OTQsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTY5NCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozMTE0LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTY5NiwibWF4IjpbMy4xODg0NTM0MzU4OTc4MjcsNi44ODUxNjcxMjE4ODcyMDcsNC44MDM4ODU0NTk4OTk5MDJdLCJtaW4iOlstMy4xODg0NTM0MzU4OTc4MjcsLTAuMDA4NjE4OTkwODkwNjgxNzQ0LC03LjEwNTg0MTE1OTgyMDU1N10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTY5NiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNjk2LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMxMTQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNDAwLCJtYXgiOlszLjA0MDA5NDg1MjQ0NzUwOTgsNi4zMTQ0NTA3NDA4MTQyMDksMy4wNDAwOTQ4NTI0NDc1MDk4XSwibWluIjpbLTMuMDQwMDk0ODUyNDQ3NTA5OCwtMC4wMDU4MTYxMDAxNjUyNDc5MTcsLTMuMDQwMDk0ODUyNDQ3NTA5OF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTQwMCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNDAwLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMyNDMsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNDAwLCJtYXgiOlszLjA0MDA5NDg1MjQ0NzUwOTgsNi4zMTQ0NTA3NDA4MTQyMDksMy4wNDAwOTQ4NTI0NDc1MDk4XSwibWluIjpbLTMuMDQwMDk0ODUyNDQ3NTA5OCwtMC4wMDU4MTYxMDAxNjUyNDc5MTcsLTMuMDQwMDk0ODUyNDQ3NTA5OF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTQwMCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNDAwLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjY1NTIsIm1heCI6WzUuNzAxNzM4MzU3NTQzOTQ1LDExLjg1MjQ5MzI4NjEzMjgxMiw0LjE4MDcyOTg2NjAyNzgzMl0sIm1pbiI6Wy01LjcwMTc0MzYwMjc1MjY4NTUsMC4wMjIzOTg0OTIzMjEzNzIwMzIsLTUuOTc5NzE4Njg1MTUwMTQ2NV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NjU1MiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo2NTUyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjEyNjM2LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NjM3MCwibWF4IjpbNS43MDE3MzgzNTc1NDM5NDUsMTEuODUyNDkzMjg2MTMyODEyLDQuMTgwNzI5ODY2MDI3ODMyXSwibWluIjpbLTUuNzAxNzQzNjAyNzUyNjg1NSwwLjAyMjM5ODQ5MjMyMTM3MjAzMiwtNS45Nzk3MTg2ODUxNTAxNDY1XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo2MzcwLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjYzNzAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTI2MzYsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozMzcyLCJtYXgiOls1LjE3NzI4NTE5NDM5Njk3Myw2LjM4Nzk2MjgxODE0NTc1Miw1LjE3NzI4NjYyNDkwODQ0N10sIm1pbiI6Wy01LjEyMjM0NzgzMTcyNjA3NCwtMC4wMDQzMTE2MzYwOTAyNzg2MjU1LC01LjEyMjM0Njg3ODA1MTc1OF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MzM3MiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozMzcyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjU4NzQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozMjAyLCJtYXgiOls1LjE3NzI4NTE5NDM5Njk3Myw2LjM4Nzk2MjgxODE0NTc1Miw1LjE3NzI4NjYyNDkwODQ0N10sIm1pbiI6Wy01LjEyMjM0NzgzMTcyNjA3NCwtMC4wMDQzMTE2MzYwOTAyNzg2MjU1LC01LjEyMjM0Njg3ODA1MTc1OF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MzIwMiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjozMjAyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjU0MDAsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNDg5MywibWF4IjpbOC4yNzczNDg1MTgzNzE1ODIsMjYuNjI3MzA5Nzk5MTk0MzM2LDkuMzE3MzYwODc3OTkwNzIzXSwibWluIjpbLTguNTA2NDg2ODkyNzAwMTk1LDAuMDA1MjU3NTY1NTI4MTU0MzczLC03LjMxNzc0NDczMTkwMzA3Nl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjQ4OTMsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjQ4OTMsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MjQ4OTMsIm5vcm1hbGl6ZWQiOnRydWUsInR5cGUiOiJWRUM0In0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NDE3NjksInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNTQwLCJtYXgiOlsxNC45ODE3MTk5NzA3MDMxMjUsNC41MjI2MzQ1MDYyMjU1ODYsMTAuNTc4ODI4ODExNjQ1NTA4XSwibWluIjpbLTEwLjg2MjM5NDMzMjg4NTc0MiwtMC4wMTU5NjA0NDE5MDIyNzk4NTQsLTExLjc3Nzc4MzM5Mzg1OTg2M10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjU0MCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNTQwLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjI1NDAsIm5vcm1hbGl6ZWQiOnRydWUsInR5cGUiOiJWRUM0In0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NDY1MCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI1MDI1LCJtYXgiOls4LjI3NzM0ODUxODM3MTU4MiwyNi42MjczMDk3OTkxOTQzMzYsOS4zMTczNjA4Nzc5OTA3MjNdLCJtaW4iOlstOC41MDY0ODY4OTI3MDAxOTUsMC4wMDUyNTc1NjU1MjgxNTQzNzMsLTcuMzE3NzQ0NzMxOTAzMDc2XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNTAyNSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNTAyNSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoyNTAyNSwibm9ybWFsaXplZCI6dHJ1ZSwidHlwZSI6IlZFQzQifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo0MTc2NiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI1ODEsIm1heCI6WzE0Ljk4MTcxOTk3MDcwMzEyNSw0LjUyMjYzNDUwNjIyNTU4NiwxMC41Nzg4Mjg4MTE2NDU1MDhdLCJtaW4iOlstMTAuODYyMzk0MzMyODg1NzQyLC0wLjAxNTk2MDQ0MTkwMjI3OTg1NCwtMTEuNzc3NzgzMzkzODU5ODYzXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNTgxLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI1ODEsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MjU4MSwibm9ybWFsaXplZCI6dHJ1ZSwidHlwZSI6IlZFQzQifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo0NTkwLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTk0OCwibWF4IjpbMTEuMzI2NDk4OTg1MjkwNTI3LDIyLjY1OTQ3NzIzMzg4NjcyLDExLjMyNjQ5ODk4NTI5MDUyN10sIm1pbiI6Wy0xMS4zMjY0OTg5ODUyOTA1MjcsMC4wNDM5NjgwMTQ0MTkwNzg4MywtMTEuMzI2NDk4OTg1MjkwNTI3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo1OTQ4LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjU5NDgsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NTk0OCwibm9ybWFsaXplZCI6dHJ1ZSwidHlwZSI6IlZFQzQifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo5NjM2LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTk4NCwibWF4IjpbMTYuMjUzODc3NjM5NzcwNTA4LDIuMDQxNTEzNjgxNDExNzQzLDE1LjQzNzkyNzI0NjA5Mzc1XSwibWluIjpbLTE1LjczNDI4NDQwMDkzOTk0MSwtMC4wMjIzMDkyNDc0MDQzMzY5MywtMTIuOTUyMzUzNDc3NDc4MDI3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxOTg0LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE5ODQsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTk4NCwibm9ybWFsaXplZCI6dHJ1ZSwidHlwZSI6IlZFQzQifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozNDU2LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTk0OCwibWF4IjpbMTEuMzI2NDk4OTg1MjkwNTI3LDIyLjY1OTQ3NzIzMzg4NjcyLDExLjMyNjQ5ODk4NTI5MDUyN10sIm1pbiI6Wy0xMS4zMjY0OTg5ODUyOTA1MjcsMC4wNDM5NjgwMTQ0MTkwNzg4MywtMTEuMzI2NDk4OTg1MjkwNTI3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo1OTQ4LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjU5NDgsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NTk0OCwibm9ybWFsaXplZCI6dHJ1ZSwidHlwZSI6IlZFQzQifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxOTg0LCJtYXgiOlsxNi4yNTM4Nzc2Mzk3NzA1MDgsMi4wNDE1MTM2ODE0MTE3NDMsMTUuNDM3OTI3MjQ2MDkzNzVdLCJtaW4iOlstMTUuNzM0Mjg0NDAwOTM5OTQxLC0wLjAyMjMwOTI0NzQwNDMzNjkzLC0xMi45NTIzNTM0Nzc0NzgwMjddLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE5ODQsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTk4NCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxOTg0LCJub3JtYWxpemVkIjp0cnVlLCJ0eXBlIjoiVkVDNCJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjIwNzk5LCJtYXgiOlsxMi4yNDQzMTMyNDAwNTEyNyw2OS44OTM1Mzk0Mjg3MTA5NCwzMC41MTcyMTU3Mjg3NTk3NjZdLCJtaW4iOlstMzIuMzQyOTg3MDYwNTQ2ODc1LC0wLjAwODY0NzY1MDQ4MDI3MDM4NiwtMTMuOTQ3MTc1OTc5NjE0MjU4XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMDc5OSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMDc5OSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozNTUzOCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE5NjM3LCJtYXgiOlsxMi4wMDQzNjMwNTk5OTc1NTksNjkuODkzNTM5NDI4NzEwOTQsMzAuNTE3MTk4NTYyNjIyMDddLCJtaW4iOlstMzIuMzQyOTg3MDYwNTQ2ODc1LC0wLjAwODY0NzY1MDQ4MDI3MDM4NiwtMTMuOTQ3MTc1OTc5NjE0MjU4XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxOTYzNywidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxOTYzNywidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozNDUwNiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEzNzcwLCJtYXgiOlsxNy40ODIzMDM2MTkzODQ3NjYsMTcuMzk3Nzc5NDY0NzIxNjgsOC45NjAxMjQ5Njk0ODI0MjJdLCJtaW4iOlstMTcuNDgyMzAzNjE5Mzg0NzY2LC0wLjAxOTgxOTAyMTIyNDk3NTU4NiwtOC45NTk1NTE4MTEyMTgyNjJdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEzNzcwLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEzNzcwLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIxODUyLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6OTM0LCJtYXgiOlstMjEuNTE1Njk5Mzg2NTk2NjgsNC41ODY1MDM5ODI1NDM5NDUsOC42NTkxOTg3NjA5ODYzMjhdLCJtaW4iOlstMjQuODY0NDI3NTY2NTI4MzIsMC4wMDE5MTY1NTYzODYyNzcwNzk2LC05LjQ1MjY4NjMwOTgxNDQ1M10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6OTM0LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjkzNCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxNDE2LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTIyNjksIm1heCI6WzE3LjQ4MjMwMzYxOTM4NDc2NiwxNy4zOTc3Nzk0NjQ3MjE2OCw4Ljk1OTM1NzI2MTY1NzcxNV0sIm1pbiI6Wy0xNy40ODIzMDM2MTkzODQ3NjYsLTAuMDAwNTE3NjA2NzM1MjI5NDkyMiwtOC45NjA2NTk5ODA3NzM5MjZdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEyMjY5LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEyMjY5LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIxMTA1LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6OTIyLCJtYXgiOlstMjEuNTE1Njk5Mzg2NTk2NjgsNC41ODY1MDQ0NTkzODExMDM1LDguNjU5MTk4NzYwOTg2MzI4XSwibWluIjpbLTI0Ljg2NDQyNzU2NjUyODMyLDAuMDAxOTE2MzkyMDA3ODQyNjYsLTkuNDUyNjg2MzA5ODE0NDUzXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo5MjIsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6OTIyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjE0MDQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMzk1MiwibWF4IjpbNi4xMDE1NzEwODMwNjg4NDgsMzIuMTM1MTkyODcxMDkzNzUsNS42Mjg3NzUxMTk3ODE0OTRdLCJtaW4iOlstNi4wODcxMTgxNDg4MDM3MTEsLTAuMDAyMTA0NDEwOTAxNjY1Njg3NiwtNS4zODg4OTE2OTY5Mjk5MzJdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEzOTUyLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjEzOTUyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIzMzA0LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDM0MSwibWF4IjpbOC45OTcwMTc4NjA0MTI1OTgsMi4wNDE1MTM5MTk4MzAzMjIzLDcuNjM1MDIxMjA5NzE2Nzk3XSwibWluIjpbLTguNzUzNDM3MDQyMjM2MzI4LC0wLjAyMjMwOTI1Mjk5MjI3MjM3NywtOS41MDg5MzExNTk5NzMxNDVdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQzNDEsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDM0MSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo1MzY3LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDA1MDQsIm1heCI6WzExLjI2MzkxNjk2OTI5OTMxNiw1Ni40NzYwODk0Nzc1MzkwNiwxMS4zMDA2NjU4NTU0MDc3MTVdLCJtaW4iOlstMTAuNDc2NDA4OTU4NDM1MDU5LC0wLjAwOTIwMjgyMjExMTU0Njk5MywtMTIuMDM4NDA3MzI1NzQ0NjI5XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0MDUwNCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0MDUwNCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo2NzcyMiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjM0MDU3LCJtYXgiOlsxMS4yNjE3NjM1NzI2OTI4NzEsNTYuNDc2MDg5NDc3NTM5MDYsMTEuMjcyNjM5Mjc0NTk3MTY4XSwibWluIjpbLTEwLjQ3NjQwODk1ODQzNTA1OSwtMC4wMDkyMDI4MjIxMTE1NDY5OTMsLTEyLjAzMjcwOTEyMTcwNDEwMl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MzQwNTcsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MzQwNTcsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NjA1NjEsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo3ODYzLCJtYXgiOls3LjQxNjEwMDk3ODg1MTMxOCw0Ny4xNzEzMzcxMjc2ODU1NSw4LjAzOTI3NTE2OTM3MjU1OV0sIm1pbiI6Wy03LjIwNDkzNzkzNDg3NTQ4OCwwLjAzNTA4MzQ3NjQ1NDAxOTU0NywtNy4yMDQ5Mzc5MzQ4NzU0ODhdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjc4NjMsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6Nzg2MywidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxNDg5MiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE2MTUsIm1heCI6WzEwLjQ3NjYwODI3NjM2NzE4OCwxLjMxNjkxOTgwMzYxOTM4NDgsMTIuMDMxNTc4MDYzOTY0ODQ0XSwibWluIjpbLTExLjU3NzMzMzQ1MDMxNzM4MywtMC4wMTU5NjA0NDE5MDIyNzk4NTQsLTEwLjI2MDY2MDE3MTUwODc4OV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTYxNSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNjE1LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMxMDIsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo4MTExLCJtYXgiOls3LjQxNjEwMDk3ODg1MTMxOCw0Ny4xNzEzMzcxMjc2ODU1NSw4LjAzOTI3NTE2OTM3MjU1OV0sIm1pbiI6Wy03LjIwNDkzNzkzNDg3NTQ4OCwwLjAzNTA4MzQ3NjQ1NDAxOTU0NywtNy4yMDQ5Mzc5MzQ4NzU0ODhdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjgxMTEsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODExMSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxNTQ4MywidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE2MTUsIm1heCI6WzEwLjQ3NjYwODI3NjM2NzE4OCwxLjMxNjkxOTgwMzYxOTM4NDgsMTIuMDMxNTc4MDYzOTY0ODQ0XSwibWluIjpbLTExLjU3NzMzMzQ1MDMxNzM4MywtMC4wMTU5NjA0NDE5MDIyNzk4NTQsLTEwLjI2MDY2MDE3MTUwODc4OV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTYxNSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNjE1LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMxMDIsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo3ODg5MCwibWF4IjpbNy41OTMwMzIzNjAwNzY5MDQsMzkuNzY1MzkyMzAzNDY2OCwxMy4xNTY2NzUzMzg3NDUxMTddLCJtaW4iOlstNy41ODEwODI4MjA4OTIzMzQsMC4wMTIzNDA1NDI4NjAzMjkxNTEsLTEzLjE1NjY3NTMzODc0NTExN10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6Nzg4OTAsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6Nzg4OTAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6Nzg4OTAsIm5vcm1hbGl6ZWQiOnRydWUsInR5cGUiOiJWRUM0In0seyJjb21wb25lbnRUeXBlIjo1MTI1LCJjb3VudCI6MTI4NTgwLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODA5MDUsIm1heCI6WzcuNTU1NDYwNDUzMDMzNDQ3LDM5Ljc2NTM5MjMwMzQ2NjgsMTMuMTU2Njc1MzM4NzQ1MTE3XSwibWluIjpbLTcuNTM5NDE3MjY2ODQ1NzAzLDAuMDEyMzQwNTQyODYwMzI5MTUxLC0xMy4xNTY2NzUzMzg3NDUxMTddLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjgwOTA1LCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjgwOTA1LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjgwOTA1LCJub3JtYWxpemVkIjp0cnVlLCJ0eXBlIjoiVkVDNCJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNSwiY291bnQiOjEyODkxMCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjIwNjUwLCJtYXgiOlsxNC4zMzg1OTI1MjkyOTY4NzUsNzkuMzI5Mzc2MjIwNzAzMTIsMTQuMzA3Mzg2Mzk4MzE1NDNdLCJtaW4iOlstMTQuMzEyNTA4NTgzMDY4ODQ4LDAuMDM1Njg0MjI3OTQzNDIwNDEsLTE0LjI2MDg5OTU0Mzc2MjIwN10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjA2NTAsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjA2NTAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MzQ0MTYsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo5Nzk3LCJtYXgiOlsxMC4xMzc2ODk1OTA0NTQxMDIsNDcuMjAyMjM2MTc1NTM3MTEsMTAuNzc0MzU4NzQ5Mzg5NjQ4XSwibWluIjpbLTEwLjEzNzY4Mzg2ODQwODIwMywwLjA0MTQ2Nzc4NTgzNTI2NjExLC0xMC4xMDg5MzUzNTYxNDAxMzddLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjk3OTcsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6OTc5NywidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxNzY2NywidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE1MzIsIm1heCI6WzEyLjc2MDM3ODgzNzU4NTQ1LDIuMDQxNTEzNjgxNDExNzQzLDE2LjE4NTI0NTUxMzkxNjAxNl0sIm1pbiI6Wy0xMy4wNDQzODg3NzEwNTcxMjksLTAuMDIyMzA5MjQ3NDA0MzM2OTMsLTEyLjc0OTA0MDYwMzYzNzY5NV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTUzMiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNTMyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIyNjgsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMDk4MywibWF4IjpbMTAuMTM3Njg5NTkwNDU0MTAyLDQ3LjIwMjIzNjE3NTUzNzExLDEwLjc3NDM1ODc0OTM4OTY0OF0sIm1pbiI6Wy0xMC4xMzc2ODM4Njg0MDgyMDMsMC4wNDE0Njc3ODU4MzUyNjYxMSwtMTAuMTA4OTM1MzU2MTQwMTM3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMDk4MywidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxMDk4MywidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxOTczNywidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE1NjQsIm1heCI6WzEyLjc2MDM3ODgzNzU4NTQ1LDIuMDQxNTEzNjgxNDExNzQzLDE2LjE4NTI0NTUxMzkxNjAxNl0sIm1pbiI6Wy0xMy4wNDQzODg3NzEwNTcxMjksLTAuMDIyMzA5MjQ3NDA0MzM2OTMsLTEyLjc0OTA0MDYwMzYzNzY5NV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTU2NCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNTY0LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIzNDYsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo1MDM4LCJtYXgiOlsxMi4yMDQ0MzkxNjMyMDgwMDgsNzguNzE0MjAyODgwODU5MzgsMTEuNjY2NTkzNTUxNjM1NzQyXSwibWluIjpbLTExLjk4ODQzNzY1MjU4Nzg5LC0wLjA0NzYwMDExNjU4MDcyNDcxNiwtMTEuNzMyNzEzNjk5MzQwODJdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjUwMzgsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTAzOCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo5MDYwLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NjIwLCJtYXgiOlstMTUuMjc3NzUzODI5OTU2MDU1LDQuNTg2NTA0NDU5MzgxMTAzNSwxMC44MTY1MTExNTQxNzQ4MDVdLCJtaW4iOlstMTguNjI2NDgyMDA5ODg3Njk1LDAuMDAxOTE2NTU2Mzg2Mjc3MDc5NiwtNy4yOTUzNzM5MTY2MjU5NzddLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjYyMCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo2MjAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTAzMiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjUwMzgsIm1heCI6WzEyLjIwNDQzOTE2MzIwODAwOCw3OC43MTQyMDI4ODA4NTkzOCwxMS42NjY1OTM1NTE2MzU3NDJdLCJtaW4iOlstMTEuOTg4NDM3NjUyNTg3ODksLTAuMDQ3NjAwMTE2NTgwNzI0NzE2LC0xMS43MzI3MTM2OTkzNDA4Ml0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTAzOCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo1MDM4LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjYyMCwibWF4IjpbLTE1LjI3Nzc1MzgyOTk1NjA1NSw0LjU4NjUwNDQ1OTM4MTEwMzUsMTAuODE2NTExMTU0MTc0ODA1XSwibWluIjpbLTE4LjYyNjQ4MjAwOTg4NzY5NSwwLjAwMTkxNjU1NjM4NjI3NzA3OTYsLTcuMjk1MzczOTE2NjI1OTc3XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo2MjAsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NjIwLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE4NDcwLCJtYXgiOls3LjYxNzc1MjA3NTE5NTMxMjUsNTkuOTA1NjM5NjQ4NDM3NSw3LjU5NDc0NTYzNTk4NjMyOF0sIm1pbiI6Wy03LjY2MTc0MzE2NDA2MjUsMC4wOTMzMTU5MTQyNzMyNjIwMiwtNy44MDQ4NDgxOTQxMjIzMTQ1XSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxODQ3MCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxODQ3MCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxODQ3MCwibm9ybWFsaXplZCI6dHJ1ZSwidHlwZSI6IlZFQzQifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozMDQyOSwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE2ODUsIm1heCI6WzEwLjg4MDk2NDI3OTE3NDgwNSwxLjMxMjg3MDE0NDg0NDA1NTIsMTEuNzQzMTUxNjY0NzMzODg3XSwibWluIjpbLTExLjExMjI4ODQ3NTAzNjYyMSwtMC4wMTE5MTU2ODY1NDAzMDU2MTQsLTEwLjUzMjA1OTY2OTQ5NDYyOV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTY4NSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxNjg1LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjE2ODUsIm5vcm1hbGl6ZWQiOnRydWUsInR5cGUiOiJWRUM0In0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MjQzMywidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjU0MiwibWF4IjpbMC42MDMyOTk3OTY1ODEyNjgzLDIuOTkwODkwNzQxMzQ4MjY2NiwwLjYzMTc1Nzg1NTQxNTM0NDJdLCJtaW4iOlstMC42MDMyOTk3OTY1ODEyNjgzLC0wLjAwNDk1MDM5NjI1MDkzMzQwOSwtMC42MDMyOTk3OTY1ODEyNjgzXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo1NDIsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTQyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjEwMDIsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo2NzAsIm1heCI6WzEuOTA5MjkyODE3MTE1NzgzNywxLjQ2MzI3NDEyMTI4NDQ4NDksMC44ODA4Nzc1NTQ0MTY2NTY1XSwibWluIjpbLTEuOTI0MDQwNTU1OTUzOTc5NSwtMC42NDA1NDAxODI1OTA0ODQ2LC0wLjg4MDg3NzU1NDQxNjY1NjVdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjY3MCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo2NzAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTk5MiwibWF4IjpbMS4wMDA4NzE1MzkxMTU5MDU4LDIuMDA5MTc2NzMxMTA5NjE5LDEuMDAwODcxNTM5MTE1OTA1OF0sIm1pbiI6Wy0xLjAwMDg3MTUzOTExNTkwNTgsLTEsLTEuMDAwODcxNTM5MTE1OTA1OF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTk5MiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxOTkyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMyNDYsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNCwibWF4IjpbMSw3LjkxNzI3NDQ3NTA5NzY1NiwxXSwibWluIjpbLTEsLTAuMDE1NTU4MzYyMDA3MTQxMTEzLC0xXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozNiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI2MCwibWF4IjpbMS4zNTU2ODMyMDc1MTE5MDE5LDEuMTI3NjI4MzI2NDE2MDE1NiwxLjM1NTY4MzIwNzUxMTkwMTldLCJtaW4iOlstMS4zNTU2ODMyMDc1MTE5MDE5LC0wLjk2OTY2ODc0NTk5NDU2NzksLTEuMzU1NjgzMjA3NTExOTAxOV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjYwLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI2MCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjozOTYsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0OTIsIm1heCI6WzEsMSwxLjAyOTQxMjUwODAxMDg2NDNdLCJtaW4iOlstMy45NjgzMzI3Njc0ODY1NzIzLC0xLC0xXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0OTIsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDkyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjg4MiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQ0MCwibWF4IjpbMSwxLjQyOTcxODczMjgzMzg2MjMsMS4wMjYxNDA5MjgyNjg0MzI2XSwibWluIjpbLTEsLTEuNDkyMjIzMTQzNTc3NTc1NywtMV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDQwLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQ0MCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo2ODQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo3NTYsIm1heCI6WzEuMTgzNTk5NDcyMDQ1ODk4NCwxLjIzNTcxNjIyMzcxNjczNTgsMS4wMDU3OTI4NTYyMTY0MzA3XSwibWluIjpbLTAuODI3OTg2OTU1NjQyNzAwMiwtMS4zMDg3NDMwMDAwMzA1MTc2LC0xLjAwNTc5MzMzMzA1MzU4ODldLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjc1NiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo3NTYsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTQyLCJtYXgiOlswLjYwMzI5OTc5NjU4MTI2ODMsMi45OTA4OTA3NDEzNDgyNjY2LDAuNjMxNzU3ODU1NDE1MzQ0Ml0sIm1pbiI6Wy0wLjYwMzI5OTc5NjU4MTI2ODMsLTAuMDA0OTUwMzk2MjUwOTMzNDA5LC0wLjYwMzI5OTc5NjU4MTI2ODNdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjU0MiwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo1NDIsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTk5MCwibWF4IjpbMS4wMDA4NzE1MzkxMTU5MDU4LDIuMDA5MTc2NzMxMTA5NjE5LDEuMDAwODcxNTM5MTE1OTA1OF0sIm1pbiI6Wy0xLjAwMDg3MTUzOTExNTkwNTgsLTEsLTEuMDAwODcxNTM5MTE1OTA1OF0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTk5MCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoxOTkwLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjMyNDAsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNCwibWF4IjpbMSw3LjkxNzI3NDQ3NTA5NzY1NiwxXSwibWluIjpbLTEsLTAuMDE1NTU4MzYyMDA3MTQxMTEzLC0xXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNjAsIm1heCI6WzEuMzU1NjgzMjA3NTExOTAxOSwxLjEyNzYyODMyNjQxNjAxNTYsMS4zNTU2ODMyMDc1MTE5MDE5XSwibWluIjpbLTEuMzU1NjgzMjA3NTExOTAxOSwtMC45Njk2Njg3NDU5OTQ1Njc5LC0xLjM1NTY4MzIwNzUxMTkwMTldLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjI2MCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyNjAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NjQyLCJtYXgiOlszLjk2OTQ4MTQ2ODIwMDY4MzYsMTEuMzE1MzcyNDY3MDQxMDE2LDMuOTY5NDgxNDY4MjAwNjgzNl0sIm1pbiI6Wy0zLjk2OTQ4MTQ2ODIwMDY4MzYsLTAuMTEyMjUzMTg5MDg2OTE0MDYsLTMuOTY5NDgxNDY4MjAwNjgzNl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NjQyLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjY0MiwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo5NzgsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo4MDAsIm1heCI6WzcuNjQ5MDU1NDgwOTU3MDMxLDkuODE1NzUzOTM2NzY3NTc4LDcuNjQ5MDU1NDgwOTU3MDMxXSwibWluIjpbLTcuNjQ5MDU1NDgwOTU3MDMxLC0wLjEzNjgwODM5NTM4NTc0MjIsLTcuNjQ5MDU1NDgwOTU3MDMxXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo4MDAsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODAwLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjE1NTQsInR5cGUiOiJTQ0FMQVIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0OTIsIm1heCI6WzEsMSwxLjAyOTQxMjUwODAxMDg2NDNdLCJtaW4iOlstMy45NjgzMzI3Njc0ODY1NzIzLC0xLC0xXSwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0OTIsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDkyLCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjg4MiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQ0MCwibWF4IjpbMSwxLjQyOTcxODczMjgzMzg2MjMsMS4wMjYxNDA5MjgyNjg0MzI2XSwibWluIjpbLTEsLTEuNDkyMjIzMTQzNTc3NTc1NywtMV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDQwLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQ0MCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo5NDAsIm1heCI6WzQuOTM1MzY0MjQ2MzY4NDA4LDEzLjc3MzE3NjE5MzIzNzMwNSw0LjkzNTM2NDI0NjM2ODQwOF0sIm1pbiI6Wy00LjkzNTM2NDI0NjM2ODQwOCwtMC4wNTM0MTI5MTQyNzYxMjMwNSwtNC45MzUzNjQyNDYzNjg0MDhdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjk0MCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo5NDAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTUyNCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQxMCwibWF4IjpbMy45Njk0ODE0NjgyMDA2ODM2LDExLjMxNTM3MjQ2NzA0MTAxNiwzLjk2OTQ4MTQ2ODIwMDY4MzZdLCJtaW4iOlstMy45Njk0ODE0NjgyMDA2ODM2LC0wLjExMjI1MzE4OTA4NjkxNDA2LC0zLjk2OTQ4MTQ2ODIwMDY4MzZdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQxMCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo0MTAsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NzE0LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODAwLCJtYXgiOls3LjY0OTA1NTQ4MDk1NzAzMSw5LjgxNTc1MzkzNjc2NzU3OCw3LjY0OTA1NTQ4MDk1NzAzMV0sIm1pbiI6Wy03LjY0OTA1NTQ4MDk1NzAzMSwtMC4xMzY4MDgzOTUzODU3NDIyLC03LjY0OTA1NTQ4MDk1NzAzMV0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6ODAwLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjgwMCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo5NjQsIm1heCI6WzQuOTM1MzY0MjQ2MzY4NDA4LDEzLjc3MzE3NjE5MzIzNzMwNSw0LjkzNTM2NDI0NjM2ODQwOF0sIm1pbiI6Wy00LjkzNTM2NDI0NjM2ODQwOCwtMC4wNTM0MTI5MTQyNzYxMjMwNSwtNC45MzUzNjQyNDYzNjg0MDhdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjk2NCwidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo5NjQsInR5cGUiOiJWRUMyIn0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6MTU5MCwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE5MjIsIm1heCI6WzEuMDI2MjQwNTg3MjM0NDk3LDIuOTMxNzU3NDUwMTAzNzU5OCwxLjAzODY4MzI5NTI0OTkzOV0sIm1pbiI6Wy0xLjAzMjE1MDc0NTM5MTg0NTcsLTAuMTcyNDU2MzI0MTAwNDk0MzgsLTFdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjE5MjIsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MTkyMiwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo0MjAwLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDk4MSwibWF4IjpbMTQuMTI4MDI4ODY5NjI4OTA2LDI0LjEyNjA4NzE4ODcyMDcwMywzLjI5MTIyOTcyNDg4NDAzM10sIm1pbiI6Wy04Ljg4MDgzOTM0NzgzOTM1NSwtMC4wMzUzNzczMTYxNzY4OTEzMywtMy4yOTEyMjk3MjQ4ODQwMzNdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjQ5ODEsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NDk4MSwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50Ijo4NjQzLCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NzU0OCwibWF4IjpbMTQuMTI4MDI4ODY5NjI4OTA2LDI0LjEyNjA4NzE4ODcyMDcwMywzLjI5MTIyOTcyNDg4NDAzM10sIm1pbiI6Wy04Ljg4MDgzOTM0NzgzOTM1NSwtMC4wMzUzNzczMTYxNzY4OTEzMywtMy4yOTEyMjk3MjQ4ODQwMzNdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjc1NDgsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NzU0OCwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxMzAzMiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjIzODcsIm1heCI6WzIyLjU1Mjk0NjA5MDY5ODI0MiwyMi4xNDc1ODQ5MTUxNjExMzMsMTcuODI1MzQ0MDg1NjkzMzZdLCJtaW4iOlstMTMuOTE0MDc5NjY2MTM3Njk1LC0wLjE0MzUyNDE1NTAyMDcxMzgsLTE3LjI5OTY3MTE3MzA5NTcwM10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjM4NywidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMzg3LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIzODcsIm5vcm1hbGl6ZWQiOnRydWUsInR5cGUiOiJWRUM0In0seyJjb21wb25lbnRUeXBlIjo1MTIzLCJjb3VudCI6NDc1MiwidHlwZSI6IlNDQUxBUiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjIzODcsIm1heCI6WzIyLjU1Mjk0NjA5MDY5ODI0MiwyMi4xNDc1ODQ5MTUxNjExMzMsMTcuODI1MzQ0MDg1NjkzMzZdLCJtaW4iOlstMTMuOTE0MDc5NjY2MTM3Njk1LC0wLjE0MzUyNDE1NTAyMDcxMzgsLTE3LjI5OTY3MTE3MzA5NTcwM10sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6MjM4NywidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50IjoyMzg3LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjIzODcsIm5vcm1hbGl6ZWQiOnRydWUsInR5cGUiOiJWRUM0In0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTYzNywibWF4IjpbNi4zNDgwMjYyNzU2MzQ3NjYsMTUuNzA5NTU2NTc5NTg5ODQ0LDYuMzQ4MDI2Mjc1NjM0NzY2XSwibWluIjpbLTYuMzQ4MDI2Mjc1NjM0NzY2LC0wLjAxMTAxNDUxOTI1OTMzMzYxLC02LjM0ODAyNjI3NTYzNDc2Nl0sInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTYzNywidHlwZSI6IlZFQzMifSx7ImNvbXBvbmVudFR5cGUiOjUxMjYsImNvdW50Ijo1NjM3LCJ0eXBlIjoiVkVDMiJ9LHsiY29tcG9uZW50VHlwZSI6NTEyMywiY291bnQiOjEyNzY1LCJ0eXBlIjoiU0NBTEFSIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTYzMiwibWF4IjpbNi40MDY1MTcwMjg4MDg1OTQsMTUuNzA5NTU2NTc5NTg5ODQ0LDYuNDA2NTE3MDI4ODA4NTk0XSwibWluIjpbLTYuNDA2NTE3MDI4ODA4NTk0LC0wLjAxMTAxNDUxODMyODAxMTAzNiwtNi40MDY1MTcwMjg4MDg1OTRdLCJ0eXBlIjoiVkVDMyJ9LHsiY29tcG9uZW50VHlwZSI6NTEyNiwiY291bnQiOjU2MzIsInR5cGUiOiJWRUMzIn0seyJjb21wb25lbnRUeXBlIjo1MTI2LCJjb3VudCI6NTYzMiwidHlwZSI6IlZFQzIifSx7ImNvbXBvbmVudFR5cGUiOjUxMjMsImNvdW50IjoxMzMxNCwidHlwZSI6IlNDQUxBUiJ9XSwiYnVmZmVyVmlld3MiOlt7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTUzNjUsImJ5dGVPZmZzZXQiOjB9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyOTQ2OTEsImJ5dGVPZmZzZXQiOjE1MzY4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTE1MSwiYnl0ZU9mZnNldCI6MzEwMDYwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NjM2MTU0LCJieXRlT2Zmc2V0IjozMTEyMTJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyMTY4LCJieXRlT2Zmc2V0Ijo5NDczNjh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo2NTU1OTAsImJ5dGVPZmZzZXQiOjk0OTUzNn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjgwMDUzLCJieXRlT2Zmc2V0IjoxNjA1MTI4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NDg0NDY0LCJieXRlT2Zmc2V0IjoxNjg1MTg0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NDQ1LCJieXRlT2Zmc2V0IjoyMTY5NjQ4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTA3NiwiYnl0ZU9mZnNldCI6MjE3MDA5Nn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjUyMTI1LCJieXRlT2Zmc2V0IjoyMTcxMTcyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6ODQ4LCJieXRlT2Zmc2V0IjoyMjIzMzAwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NzIzNzUsImJ5dGVPZmZzZXQiOjIyMjQxNDh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo0ODQ0NjQsImJ5dGVPZmZzZXQiOjIyOTY1MjR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo4MTEwNTIsImJ5dGVPZmZzZXQiOjI3ODA5ODh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxMTU5NzcyLCJieXRlT2Zmc2V0IjozNTkyMDQwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjgwNjEyMSwiYnl0ZU9mZnNldCI6NDc1MTgxMn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjk1NTMzNTUsImJ5dGVPZmZzZXQiOjc1NTc5MzZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjozMzQxLCJieXRlT2Zmc2V0IjoxNzExMTI5Mn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjg1MTQ1OSwiYnl0ZU9mZnNldCI6MTcxMTQ2MzZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo4MjU0MywiYnl0ZU9mZnNldCI6MTc5NjYwOTZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyODI4MSwiYnl0ZU9mZnNldCI6MTgwNDg2NDB9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyNTA4OTcsImJ5dGVPZmZzZXQiOjE4MDc2OTI0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NTcxMTAsImJ5dGVPZmZzZXQiOjE4MzI3ODI0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6OTgzOCwiYnl0ZU9mZnNldCI6MTgzODQ5MzZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxNjcxNCwiYnl0ZU9mZnNldCI6MTgzOTQ3NzZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyMDAzODUzLCJieXRlT2Zmc2V0IjoxODQxMTQ5Mn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjEzNDUxOSwiYnl0ZU9mZnNldCI6MjA0MTUzNDh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo3NzU0LCJieXRlT2Zmc2V0IjoyMDU0OTg2OH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjIzNjIxNywiYnl0ZU9mZnNldCI6MjA1NTc2MjR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjozNTUxMTgsImJ5dGVPZmZzZXQiOjIwNzkzODQ0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NTk5NjYsImJ5dGVPZmZzZXQiOjIxMTQ4OTY0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6OTk5MywiYnl0ZU9mZnNldCI6MjEyMDg5MzJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyMjc1LCJieXRlT2Zmc2V0IjoyMTIxODkyOH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjE2NTE2LCJieXRlT2Zmc2V0IjoyMTIyMTIwNH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjI1NzYsImJ5dGVPZmZzZXQiOjIxMjM3NzIwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6Nzg2MiwiYnl0ZU9mZnNldCI6MjEyNDAyOTZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo3ODg0LCJieXRlT2Zmc2V0IjoyMTI0ODE2MH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjQwNTcsImJ5dGVPZmZzZXQiOjIxMjU2MDQ0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTM5OCwiYnl0ZU9mZnNldCI6MjEyNjAxMDR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjozMDIxMSwiYnl0ZU9mZnNldCI6MjEyNjE1MDR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxODE0LCJieXRlT2Zmc2V0IjoyMTI5MTcxNn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjM2OTYwLCJieXRlT2Zmc2V0IjoyMTI5MzUzMn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjg0MDksImJ5dGVPZmZzZXQiOjIxMzMwNDkyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjAzNTQsImJ5dGVPZmZzZXQiOjIxMzM4OTA0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MzU2OSwiYnl0ZU9mZnNldCI6MjEzNTkyNjB9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxNTc1NSwiYnl0ZU9mZnNldCI6MjEzNjI4MzJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo1ODg2LCJieXRlT2Zmc2V0IjoyMTM3ODU4OH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjIzMjA2LCJieXRlT2Zmc2V0IjoyMTM4NDQ3Nn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjIwNDQsImJ5dGVPZmZzZXQiOjIxNDA3Njg0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjQ3MzcsImJ5dGVPZmZzZXQiOjIxNDA5NzI4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTk4MzQzMywiYnl0ZU9mZnNldCI6MjE0MzQ0Njh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo0Mzk4LCJieXRlT2Zmc2V0IjoyMzQxNzkwNH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjIyNDI3NywiYnl0ZU9mZnNldCI6MjM0MjIzMDR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjozNDA0NDIsImJ5dGVPZmZzZXQiOjIzNjQ2NTg0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjQxMjUsImJ5dGVPZmZzZXQiOjIzOTg3MDI4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTMyNiwiYnl0ZU9mZnNldCI6MjQwMTExNTZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyOTE2NywiYnl0ZU9mZnNldCI6MjQwMTI0ODR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjozNzkyLCJieXRlT2Zmc2V0IjoyNDA0MTY1Mn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjEwNDg0LCJieXRlT2Zmc2V0IjoyNDA0NTQ0NH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjc5MTksImJ5dGVPZmZzZXQiOjI0MDU1OTI4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTg5OTYsImJ5dGVPZmZzZXQiOjI0MDYzODQ4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6Nzg2MywiYnl0ZU9mZnNldCI6MjQwODI4NDR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyMjQ2MCwiYnl0ZU9mZnNldCI6MjQwOTA3MDh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjozNjY3LCJieXRlT2Zmc2V0IjoyNDExMzE2OH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjE5MTE3LCJieXRlT2Zmc2V0IjoyNDExNjgzNn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjExNDEsImJ5dGVPZmZzZXQiOjI0MTM1OTU2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTc5MDYsImJ5dGVPZmZzZXQiOjI0MTM3MTAwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NzA0OCwiYnl0ZU9mZnNldCI6MjQxNTUwMDh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo0MDI1MywiYnl0ZU9mZnNldCI6MjQxNjIwNTZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxMDYyMSwiYnl0ZU9mZnNldCI6MjQyMDIzMTJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxNTg3NCwiYnl0ZU9mZnNldCI6MjQyMTI5MzZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo3NzIxLCJieXRlT2Zmc2V0IjoyNDIyODgxMn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjE0MTk5LCJieXRlT2Zmc2V0IjoyNDIzNjUzNn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjE3OTYxOSwiYnl0ZU9mZnNldCI6MjQyNTA3MzZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjozMjA3MTAsImJ5dGVPZmZzZXQiOjI0NDMwMzU2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjU0MDQxLCJieXRlT2Zmc2V0IjoyNDc1MTA2OH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjI3MDMsImJ5dGVPZmZzZXQiOjI1MDA1MTEyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTc1MTQwLCJieXRlT2Zmc2V0IjoyNTAwNzgxNn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjY4NTEwOCwiYnl0ZU9mZnNldCI6MjUxODI5NTZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxMjk4NzQsImJ5dGVPZmZzZXQiOjI1ODY4MDY0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTEwMTYsImJ5dGVPZmZzZXQiOjI1OTk3OTQwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6ODE2MTgsImJ5dGVPZmZzZXQiOjI2MDA4OTU2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTIxOTUsImJ5dGVPZmZzZXQiOjI2MDkwNTc2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTEyNDY4LCJieXRlT2Zmc2V0IjoyNjEwMjc3Mn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjMyMDEsImJ5dGVPZmZzZXQiOjI2MjE1MjQwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NDIzMywiYnl0ZU9mZnNldCI6MjYyMTg0NDR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo0MjUxLCJieXRlT2Zmc2V0IjoyNjIyMjY4MH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjY1OTgsImJ5dGVPZmZzZXQiOjI2MjI2OTMyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NjU5OSwiYnl0ZU9mZnNldCI6MjYyMzM1MzJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo4NzAyLCJieXRlT2Zmc2V0IjoyNjI0MDEzMn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjEwMzE4LCJieXRlT2Zmc2V0IjoyNjI0ODgzNn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjEwMDE5LCJieXRlT2Zmc2V0IjoyNjI1OTE1Nn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjEwMTE3LCJieXRlT2Zmc2V0IjoyNjI2OTE3Nn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjEyNzMwLCJieXRlT2Zmc2V0IjoyNjI3OTI5Nn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjEzMzQxLCJieXRlT2Zmc2V0IjoyNjI5MjAyOH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjk3OTksImJ5dGVPZmZzZXQiOjI2MzA1MzcyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6OTc5OSwiYnl0ZU9mZnNldCI6MjYzMTUxNzJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo0OTE1NywiYnl0ZU9mZnNldCI6MjYzMjQ5NzJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo1MDkwNywiYnl0ZU9mZnNldCI6MjYzNzQxMzJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxNzc4MiwiYnl0ZU9mZnNldCI6MjY0MjUwNDB9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxNjUyOCwiYnl0ZU9mZnNldCI6MjY0NDI4MjR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxOTUzODEsImJ5dGVPZmZzZXQiOjI2NDU5MzUyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTk5MDYsImJ5dGVPZmZzZXQiOjI2NjU0NzM2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjA4NjY3LCJieXRlT2Zmc2V0IjoyNjY3NDY0NH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjIyMTE0LCJieXRlT2Zmc2V0IjoyNjg4MzMxMn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjM5MjUwLCJieXRlT2Zmc2V0IjoyNjkwNTQyOH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjgzODUsImJ5dGVPZmZzZXQiOjI2OTQ0NjgwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MzkyNTAsImJ5dGVPZmZzZXQiOjI2OTUzMDY4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6ODM4NSwiYnl0ZU9mZnNldCI6MjY5OTIzMjB9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxNDcyMzcsImJ5dGVPZmZzZXQiOjI3MDAwNzA4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTQxMjA0LCJieXRlT2Zmc2V0IjoyNzE0Nzk0OH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjg5NTE1LCJieXRlT2Zmc2V0IjoyNzI4OTE1Mn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjYzMjQsImJ5dGVPZmZzZXQiOjI3Mzc4NjY4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NzU0NDEsImJ5dGVPZmZzZXQiOjI3Mzg0OTkyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NTc5NCwiYnl0ZU9mZnNldCI6Mjc0NjA0MzZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo4NDEzMywiYnl0ZU9mZnNldCI6Mjc0NjYyMzJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyMTU0NywiYnl0ZU9mZnNldCI6Mjc1NTAzNjh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyNzQwODMsImJ5dGVPZmZzZXQiOjI3NTcxOTE2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjMyMzExLCJieXRlT2Zmc2V0IjoyNzg0NjAwMH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjUzODc3LCJieXRlT2Zmc2V0IjoyODA3ODMxMn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjk1MjcsImJ5dGVPZmZzZXQiOjI4MTMyMTkyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NjA5NTIsImJ5dGVPZmZzZXQiOjI4MTQxNzIwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTA0MDIsImJ5dGVPZmZzZXQiOjI4MjAyNjcyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NTg5Mzg5LCJieXRlT2Zmc2V0IjoyODIxMzA3Nn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjYxODIwNSwiYnl0ZU9mZnNldCI6Mjg4MDI0Njh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxMTM2MDgsImJ5dGVPZmZzZXQiOjI5NDIwNjc2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NTc0NzksImJ5dGVPZmZzZXQiOjI5NTM0Mjg0fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NjE4MywiYnl0ZU9mZnNldCI6Mjk1OTE3NjR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo2MjU0NCwiYnl0ZU9mZnNldCI6Mjk1OTc5NDh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo1ODg5LCJieXRlT2Zmc2V0IjoyOTY2MDQ5Mn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjMxNzQ4LCJieXRlT2Zmc2V0IjoyOTY2NjM4NH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjM5NjMsImJ5dGVPZmZzZXQiOjI5Njk4MTMyfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MzE3NDgsImJ5dGVPZmZzZXQiOjI5NzAyMDk2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6Mzk2MywiYnl0ZU9mZnNldCI6Mjk3MzM4NDR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxMjE4MzEsImJ5dGVPZmZzZXQiOjI5NzM3ODA4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MTEwNzgsImJ5dGVPZmZzZXQiOjI5ODU5NjQwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjcwMSwiYnl0ZU9mZnNldCI6Mjk4NzA3MjB9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyNzAzLCJieXRlT2Zmc2V0IjoyOTg3MzQyNH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjg5NzgsImJ5dGVPZmZzZXQiOjI5ODc2MTI4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6Mzc5LCJieXRlT2Zmc2V0IjoyOTg4NTEwOH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjE3MTgsImJ5dGVPZmZzZXQiOjI5ODg1NDg4fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjY2MCwiYnl0ZU9mZnNldCI6Mjk4ODcyMDh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyMzA1LCJieXRlT2Zmc2V0IjoyOTg4OTg2OH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjMyMDEsImJ5dGVPZmZzZXQiOjI5ODkyMTc2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6MjcwMSwiYnl0ZU9mZnNldCI6Mjk4OTUzODB9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo4OTQ1LCJieXRlT2Zmc2V0IjoyOTg5ODA4NH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjM3OSwiYnl0ZU9mZnNldCI6Mjk5MDcwMzJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxNzA0LCJieXRlT2Zmc2V0IjoyOTkwNzQxMn0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjQyODEsImJ5dGVPZmZzZXQiOjI5OTA5MTE2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NTc0OCwiYnl0ZU9mZnNldCI6Mjk5MTM0MDB9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyNjMxLCJieXRlT2Zmc2V0IjoyOTkxOTE0OH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjIzMDUsImJ5dGVPZmZzZXQiOjI5OTIxNzgwfSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NjE2MCwiYnl0ZU9mZnNldCI6Mjk5MjQwODh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyNzg1LCJieXRlT2Zmc2V0IjoyOTkzMDI0OH0seyJidWZmZXIiOjAsImJ5dGVMZW5ndGgiOjU3NDgsImJ5dGVPZmZzZXQiOjI5OTMzMDM2fSx7ImJ1ZmZlciI6MCwiYnl0ZUxlbmd0aCI6NjA4OSwiYnl0ZU9mZnNldCI6Mjk5Mzg3ODR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoxNTczMSwiYnl0ZU9mZnNldCI6Mjk5NDQ4NzZ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjozMzYyNCwiYnl0ZU9mZnNldCI6Mjk5NjA2MDh9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo1NDE2OSwiYnl0ZU9mZnNldCI6Mjk5OTQyMzJ9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyMDYzOSwiYnl0ZU9mZnNldCI6MzAwNDg0MDR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjoyMDYzOSwiYnl0ZU9mZnNldCI6MzAwNjkwNDR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo0MTgyNCwiYnl0ZU9mZnNldCI6MzAwODk2ODR9LHsiYnVmZmVyIjowLCJieXRlTGVuZ3RoIjo0MDg3NiwiYnl0ZU9mZnNldCI6MzAxMzE1MDh9XSwic2FtcGxlcnMiOlt7Im1hZ0ZpbHRlciI6OTcyOSwibWluRmlsdGVyIjo5OTg3fV0sImJ1ZmZlcnMiOlt7ImJ5dGVMZW5ndGgiOjMwMTcyMzg0fV19ICAg4GTMAUJJTgBEUkFDTwICAQEAAACFG4UTAoUTiQEAjwff933P93zP93zf933fv3z/8i//uvzr1q5b13zd8y9v931rv27tuvzLt3Zf161d1619u65bu65buy5f923f233/8nXd2nXd2nXd2rfr8vbrurXr8i/f2nXd2nXd2q/L23Xdt3Zdt3zv83bf933f933fuz5v169bu65b13zf231ft67duy7v9q3r2n3Lt3Zdt3Zdt3Zr967duq7duq7dui7fu27f863b97zdu3brunzv2nXP273r8nZvt65rt65rt65rt67L+3zvunbv8n3P927fuq7dt67L967L2z72fd/3duu6duu6du+6fOu69u3Wdc33Pm/3bd/3bd/3fd/3vevzfX/zfd26du+6vNv3rtv3fGvXrWu3dl23dl23dt26duu6duu69lvzrdv3vN27duu6fF+3dmu3dt/ard26rt3zdu+6vN3brevarevarevarevyPt+7rt27fN/zvdu3rmv3revyvevyfd+3dt26duv2vd26rt26rt27Lt+6rn27dV3zfd/3/M33fM/3/M33fd/3vV23bt/zvd26rt3aLd/2L9+//FvXtVvzrt26rt26rt26rt3arf3WruvWrsu//Ovyr1u7bl3zrd26rt26rt26dt3add3add23dt26dsvXPf/ydt/XrX27bl27Lt/ar1u7Lv/yb+3Wbu3yrd3XdWvXdWvfruvWruvWrsvXfdv3dt+/fF23dl23dl239u26fE9bb7+uW7su39p37da1y798a9d1a9d1a78ub9d139p13fIv+5d9279sf/Z93/d93/d93/d9f/Z93/d93/d93fd93/ds3/d935993/d93/d93/d93/d9X/d93/d93/d93/d93/d93/d939d93/d93fd93/e9z/f9y7Pv+77v+77v+77v+77v+77v+77v+77v+77v+77v+76v+77v+76vfb7va5/v+76v+76v67rv+/61W77v+96n67r2qe/7vq/7vu/7vu/7vu/7vu/7vu/7vn75vu/7vu77vu/7uu/7vu/7vu/7vvZd3n1Z9+X5uvfpvnfrvu/7l3V9t+Z9WnufN9X1afnep/u+7/u+7/u+7/u+7/u+7933/Vu67/u+7/u+7/u+7/u67/u+7/u+72uf+r6/T77v65fv+77t297nqe/7vn95uu77vu/7Xm/6WNs+X/vU+zz1Pk99T/fue77v+77v+77ve7fv+57v+77v+77vA/8DSG2A/wTUPm+A/wTUPm+AA/8AAAAAAAEAAAEACQMAAAIBAQkDAAEDAQMJAgACAgEBAQELrX5SmQFBEokT8RJJD3URdRGtFxEYFRDlDrUG8QTxA/UCeQKVAS0CYQHkmEkBFQFhAX0B/MkBMQGtAWEBfQGVAZUBgICVAa0BFQGtAYCwMQEpA+RFAqkCEQPkrQHJAa0BsOSAgGRkmLDImJjk5PwVAUkBmIDI/MjkyMjkyGTIlQGVAUkBfQHJARUCSQFJAeQVAZjI/JUBYQHk5LA0NGRMMQGwMQEVAcj85MhMTH0BrQH8/PwxAWRkmIBkTBhkmICw5GRkMQGtAbCYgPwxAWEBFQHkmJiAZPyVAfyANDRkyEkBlQGVAZUBMQH5ATEBLQL8RQIxAWEB5K0ByOSRAnkCFQH8yQH5AeR9ATEBYQExAZUBYQH5AfwVAZUBLQIxAUkBgIAVARUByOT8/DEBMQH8ZEz8gOSYNMj8QQOpAgUG7QX1AqkDYQH8FQFkTExMmGTkmEzhATEBrQHhAeT8mJhMZICYGBjI5JiYNBgDZEwDNIADgBgYGDQ0ZBgYZIA0ZGQ0GBg0NAc0GDQ0BzSATExkgDQ0mLAYGIBkZIBkZBgDNBgYGBg0ZBiAGBgYGBg0NBgYgDRMZBgDZDQDGAM0NEw0NBgYAxgYGDQ0TANkgDQ0F0xMDzRMGExMZGQ0TBg0GJgYAxgHmBg0GAsYGANMTBM0GBgDGAewTAcYGA9kGDQYNBhMNICYsDQ0ZIAYNAM0GAMYGxgYGExkZGQHgAcYgANkgDQYBxhMBxgDTAMYGA8YGEw0AzRMNBM0GBgDGAM0BzQDNANMGA80NA8YNDQ0CxgXGAMYEzSwBxgYNBgYCxg0NDQXNDSwTDQDTAM0NAc0NGQYGBgHTDQYH4ADGAMYTBgHGAsYGEyATBgDGAc0C0w0Cxg0B2QnGBgYC0xMBzQ0AxgDGGRkGBhkmBgYsAuYNAM0gDRkTAsYCxhkgDQ0GAsYAxgYCxgYGAcYNAMYA0wYA4DkGDMYNBgTNDQ0GAMYDzQ0DzRkTAMYGBg0GBgYNDQ0BxgYZGQHGEwYA0wYGCMYGA+ANAsYGDQ0Axg0CxgYGBM0GBgHGBgHGAMYNA8YGAdMTAdMNBgDGBgDGA8YGAcYExgYTEwHNDQXGANkOxgYAxgLGBgLGBgnNDQ/GDQYGBgYGBgrGBgDGEyYGBhMGBgHGBgHGAMYBxgfNBgYGAcYGBg0DxgPNAMYMxg0TA9kgAsYDxg0D2Q0GDQDGAc0AzQDGANkgBg0KxgHGBgDGBgTNDQYGAcYGxgbGBMYGAcYGxgYHzQPGB80mBg0Dxg0IxgYZBsYGBgXGBgbGAcYGAc0TB8YJxgYIxgYYxgTGBMYHxgDGBgLGCMYFxgDGBgDGBgYAxgYPxgXGBgHGCsYExgYIxgYGAMYFxgDGBgYIxgYH0xfGBsYIxgLGAs0FzQHNBdMGBgDGBgzGBM0JxgHGBgYJxgTTDQPGBgLGBdMTAcYNzQLNE8YBxgYI0wDGCcYAxgLGDQrGBMYGDcYGBMYFxgYLxgvGC8YGAMYBxgzGBhDNDQPGCcYOxgYGBg3GA8YDxgYBxgYExgPGBsYGEsYKxgPGBg/NBgHGAsYCzQDTEwbGAc0HxhLGAMYVxgYRzQYHxgY8xgXGAMYGBdMAxgjGAsYGAs0MxgDGAMYH0xMNxgbGDQXZBc0DxgYNAM0azQLGBc0KxgrGFMYDxgLGDMYBxgPTEwPGAcYDxgLGBgbGA8YGBg0FxgYFxgYExgYGxhMNB8YB0xMAxgPGBgjGEMYFxgYNIADGAcYGA8YDxhDGB8YA2SANDRTGC80NAeAAxgDTEwYGDQDGAcYJxgHGAcYC2QfGBcYBxgPGAsYBxgYExgbGBNMNBcYDxgfGBgPGF8YExgDGA80GAc0bxgDNBgnGAMYExgDNGQPNAM0AxgTGBMYGBgzGDcYQxhTGBcYJxgYwxgXGA8YUxgbNBMYC2QPGFsYCzRkgxgnZGQHGBhLGCsYExgYGJiwcxgvZGQYnxgHGBgTGEs0RxgYLxg3GAcYOxgYFzQYexgYsxgXGBcYGxgHGN8YIxgHGK8YMxgbGDMYdxgPGIsYLzQ7GGsYKxj/HxgjGBgzGPcYTxgfGEsYCxjTNCcYCxhjGCcYGCsYzxinGEMYKxiDGP+PGB8YFxj/AxgYczQYKxhTGFMYDxgjGBj/GxgLGB80GBj/DzRHNM8YsxgLGCsYFzQnNFsYGxgY/3MY/08YvxgXGIMYGINMAxgDGMsYqxgfGGsYYxgYZzSbGDQzGFMYxxgHGBcYSxgvGBj//yMYUxgbGFc0axhfGLMYBxhHGP//DxgTGP+nGG8YcxgXNBgrGP//LzQfGLc0GG8YGD8YGIMYoxj/TxjLGP8PGKM0ixj//4MYMzT/PzSPGLMY9xj/AzQXGP8zNA8YAxj/GP8Yyxj/kxj//2sYGEMY/wcYGF8Y/+cYJxhbGBj/zxgY///PGBsYGP/DGAcY2xgY//+DGG8Y/z8Y///vGAMY8xj/uxiDGBgYGP+/GBgjNP/zNP/jNBsY//8nGP//5xh7GP83GP//cxj/Fxj/GP9vGMMY////7xgY/////////yMYsxj/////////////cxj//////////////4cY/////////////2MYJxhzGP93GNMYkxgDGP//7xiXGP//////////////////////////9xj/////////////Bxj//38Y//sY////sxj2PCzpxNtY+uAKfjCdlp0B2WfLtuQuHwexqqPGF0Hw7uUuERMBIfzv4TgvSzeQXDyN/5twDCXiJR/iBDWfHarWIf7Ta6dSvi8cuF0b/zPc/m0XkOcUt4sE6jIi7ldEDxriZUZj562jAgfq5knLZXgqNQDtmyOqvq78TZfwB2A6rQTmgaJbWirtuDKRBiTj4So1poCgEKy3ZKrqDzMUDAhPKd7IWmVRO5wqhW9NNO2TNPILx6Y93O6PGvB7H8rsEfV6n+0CFarlZKz/L10wEvzxN9BSXugRGV80GrCQoP9dM5f+FjW7+nEy1rutaxPVST307X3yVTT1ZuwU3tMhopsFdp4HFjqf9Bx9RFtU620xnN9FsOoEP3NzFKDvD11rVwLOi5lEvNjCCRHFVXR0ZSnRI1IsUF6yb/t90FMPaMQA8Ipc76PMlvDUAChO1eTr1P135XjSUAAw6+7bvVlgLUnhO/uGEX7DX1TkMH2H43N8lAmX67oQlhpUhUqiLGWhmbmzjgNHlCh5YbTWLbGTQIAWChpN6N2vWTTseXA/G+gBiOQeT+2ZK3DlAOoW6v6GCF0cSDhO7dZSiCeproDNUud9Nd6mfZF7X4ZN1qZC1KEI1NBQs+EsmvsZZx7BKOcvVLGYthedYx9CQCl4BmtD5nXtwzTsYRUtBYIlY5jXHm3vETzp8agTOk8URt9H1CQNoUuf177UmETV6N+FT6eqItVgWtVfy81HP8nacB65V3y791HKJ46RXSRfRmVioh/sLUtD6lDoW1eQnTipLvxqBR6WcJZCK+FeOr/1Tc8JbN1Ezw4JwEUwZhT9HlrZDj+v74EmHyM5IEIxHpabHkDsWyr68+oa7ny27GBesDz/surQ6qHu5xogY75oZe7ahLFJ+xMmDHIIW/JQy5UyYNQinz0KfiF6OAmvUgNyM8yModbRx+Rqrkt3a00VG7TDpAvVGflOEELFt4iaM1OGtiGO5pNoO0hZK8WLFCXrd4dp3fStSVR7oPaMB9zP5MNAAtaQIGYpMXsLL4waHFcSeFuhvNG8E7B2WQMFWFUr65mkHy0IHWilA4SSg5/11d1gQdn6AjO0qnZzrvk19UEP9LxvraRbO4nUAWKi+KuN/wdeya6DHjdXHmHAB2Kxq/5joaM8nRVGY1vocuHX5xwNwUNVYyct5lRVKQWj28byNkimr2MYn9rGAjbn/bkV3ye2KXmWYhMPZOI55MJh7XJVKhzxHQDlxhD52jMdJ4g5Jy+CBjAlNaABYmjimSKxsELfArea0N+o+L3pZXv1jCVYyugX3u2PMvBxzNpmOEiavDWh8C1PA14T3feo1gOgu1LUZiPjd5mobQQc02NSIHP/ljjmaEJCIwVL3nRwv6gtXGpynY8q77JQnTAClt9qJInZ7nNk7ouzkdCfijLuUD7uHTNx+54mcu3nme0KYyulD0KH/uqt+Ol0Wdk1nyEFtYuTKulwJxAHnmNm5rmO5h5q/1LPm9/ljvPl+T87ZSwDSsD1j1DMoeCHpQxUXnopkXibZvHrngBMUmNc4bGqFyGFwXxQOVyq6X+gPsKw9weZG19kKtWRZShae9V6a51gu5iQwKQXEGPaROSjkB+GtbWn9fjEathZRRQ6ptQ2ZMh8Ly5AShC6EHZf/9ErGRw+UA/NGW9mU3Md7RPyKurWeusx5CkyuNPmnkVkQa/7wWVuwNhWsLdOT0AqcwAcRIYB7SCkovCRqISi4B3H6e5iTwpZTa8AhMPEHKG/K6lvfepQMFKOCH2o609WoHxYzrppBZyovI7pOmggN5QaqChhzpw1U/dsvc2arjHr/GVK0wBbIA0QYjkl9pyMi+48VSw4rD3xcuAl3xoiW6+jwtcy0lH2ruHM6eQdMkYfQbaVZr/9aJXz5fRQhVuYzUu4huzkRSBnu0G8e1+wP1bvPfwg03zdv6wvphXdASkRxhymVZZkzEINCIm1irXshS1c1Lvs37vBxed7PKI0OOvDKkr2ksLpHl4gn44Xyeoz5yJ5B7nmkty6XqTa0XVivfs3yLnO3s/YGHV0VsPnB7ibN3mGLDh4R98kZZ5YUe0xjikcjC7USZmC8N3qkR9ULjpJdG1WVXhTD0RwnyEjJPRs2coGEA0qfDfDrqs0FzJ0SF1CA7mutjh+HIabzriDdmRQv6mHRitAgQfbE0sAJUFGJxDJ2Iysj/l4Lx78DQ+lV0zmAde0qxxbJa5zA4HGtkZDFd4iWWIIqZ852XM7n8la5dyevk7G7y9KXTSLd2KzT1KC4/Lcf8ztaGAkKvaSRIzQn/nJHhMKUsFwLrbaFeYLJSzeSGa6wUaz27bvwW4AJAbMYgMzpa4RvHPivkEEYu9OIhVwJRw3JdUQZCWIntx27X1hyMhmIE10PFIU807eLVIaY+I7AhgmD86q+t2/IXbhHVLjB0gEvulA4QNGTT7uMoX99Mqf9lkGBmKGUM2zRJ593Az2ERlg5NtLHwkKSLJXgPYzX5/bnwsE486O9KAX+8zOyTz49tcwxhOzBGHNlyz3HDMvzQ87FzD1j8i5ym0ilkdwVydxJRIvfzgz7YWZAYTZr7Th7AFGaZZzFos4pQ7bxoaWaOiikbHULn9AppPXBEwl33BKT7YPdDhVCsha7x8AYp0qtmM4+hZJ4Jok6YlbTLWK0TosI+9xdI3iogDnzSQUzBv+UzvelV7kSWEotvv8TDuXsG9XomM/337J5BUX/+TFx7rRfN5MLAWO3myw+kgGOiCiWncCZhRPSV4482ychPw7zOrh/PsQikd0T2x4WUqNApBEgaNOg99Kb+S3NWk7yUeKM2yJrkb5LS+eEat7vsbiIwznMQLhQHKV8oq9JwrfsjaSS4rU8rLiIiTnZvA+0b69ol0Q0zxm94zWkNPWEYZmxQ6FzXNiHwxaX8lizKJfdAdyWAUT7EueCRw7yjILGIvixPRadVeZcDizQUvFOZJSDa82Sv0uXceo3eBQPGi6FrqEU83eNwfIXXQ2etjHkuBzWwz9Te7Po7repgUtELgDCT7N2pwTDMkp9iMMHRIwoiC1RJzdzrwJEJORbF8iUE6ZhvsTCciigB7lCKHsIxHNHitpypXOroCBLkhWCHqyFI5asuP/tso2MJ90ZlPWDj6lqAENL/pvvF42I2HULxFaoGKpi11EUsSCfs8+yWDdVq/EWGKO9Xnzic+v3e2Gb9nNVT6mCB3QZIzMAwzOCFMdz0FxA2hg7JnPuzFMoHvpHXCf/eHnC0ao0WzKP7pd8PTRkqn1X5I3yg5CRZGCN17m0STR2+dNO+HRtr6hbNnEz4G2nIuiEDiuV2bpL1fTIlGixD9DBBN4VDPvR535meoSGOU7PPeZOqPH5wQoZeFENepTahtV0KnX61oC27uVoqC2Kh+ETWTbxVdhLTYAkJpYd+VovvTa7dXhsTXDOwboYvSMZ1/VasWQfUavk3jcU6KkyY0byKvqE9ytLHDx8pmqostNp9+RNYOPDGEUHeFPvOXJ0eXEKTRR0uDrseX1WyPaNx3Ua9LfST2OVYMY5eLub+eDRs9RlNYb/tJbpvZm9vFreCxmBjv+7FEh1NoEykye1M4h1Slwq7jAIYTcdZRU1iVJN2EHPJ9A7ifi7c7fyKAYSdBTu3NNv3cGLKiwBPDX5tUAPcZbQc1AQ9lehrcCYMeMS6dp0Fg4vzgf5OViAY2CWvgoYeGafhNVnEri8pqZ/ZdgpMv0AtzzM83v8heJaU7g6QlJqMkGDnfRsjA3xKPy+sSK6uabMJyaNrjWLMGVzcrISLPk64JE6MK2aqOHWErlPbE57+wKNdjhPRtlSxIKQoE98zxOhvCSbL6hg+BCIPOk2+yuy2eL3Jg6LQ+kp2+/znnkwGE4CLx5gl5CuUvOw3B1BnFkrWVWTZTtaV0w9gkMr6vP8575w2hDMzYEM3EgksnD7y7T2zN3Mj7fq9ZVlPdmpjbQKIqaB4sjcSLQGdt3qJMkmH9qNuu7wYxbtXgFzSAhYT2DwucJMSW8vKXt5c0sjyIoMnJpiJZfRvTsogTuZKp5gjrW4FDe/+iQ00gzk9am8iiuGWwNMLE5M/KrTFUwWcvQIncKS0JHo1UQGu+cv2B8kKX5Zs7eESlmK2+Ng2FJjeNv44FT4l0uTJNVhNUJhMIpxNBASAcMxq11p6w6zcMv+2kFe644uFYlm6IQxX4tCJYzUqQBvDW/2VDLFZ9aRFDEKbfTLQeiwgb1Pc4V/w906yJGHc/WLjwLcA/P+c7BGqBEtkJT9Tf7J9UAms1hWu0YdppT3M4Q4aLBnNBPhDlnM1Omw2/dQbqEUWZZ5f6KptJaSMkjH3rW1baa0e+D0d9mS2TR0VmWgQy1Dwn+eEEI/EgOYdLWs9EuKyfcO990yEuvCE2N/RYrxBGC0dMZsTGNbSTQ0V1HY+I9o7HQZ0XwUkgACbDcUVr5UportqJWDsVkTpWs6M1l6sgstyT8pREct6ziqmOd7X/XSgLlaizulJyikovoINvrQIvz04ygEbYYdOgPG/HkgKcwjAFZEUpFZdmh73LAqFLx1CdNU80WehlVno1MU20oXL7eht0UMJ6+VxCXJNW4Br/8XquslBS4hpQLn1tmSguW/RHLqntHMS+TQO0TXGRKTOJaYdixjuUN1FnsGTFmMjogLfkuFxZZHwNM48C0yFgmpme9qZeZg//HNprfyGIagN9S0rYgwBiCEBh7TF5DVbIzVPwTQmpPxiteuexP67Jl/2iYbGGq5ZYfoqxyxzzoXfbQHtKT64++nNnfOcZDn3CbwF1j53UZI7B5VY829eaBHUz+hmR6eBTj8AGGPcJS2eKxfbfGuYanjlPTrPPXIPmtNUp40OADHgHtK6cxRzvPQICI8F8MCyF7VAOastHmHkaJ7i92TfAI5LcjCakiQ+J0lQ4s+fs/rvW+oELb7yZVpFDBYMPq1kNaBTtu+DT0cVjWtR8AGh60x6c62rNf2vRF9kLRhxhQ54ZldMaIS1QuAZmbkFFKU26Gi95cbtrQ6UZaY0f4t4hsQpqrx8s49BHCat/W21y1b8DkyuDX0BH1Rd2ecsZKAIyCsxE2Ek3lwQ5SxkHq1uNgHTI6/gtTOPmMYbbDCbH0qhhn6qzgZT+RqKUBxygTASPhOuyD9E/MRm/a5RhQd3v8hsiNDe0vHfOKVf3Rc7O5217SpZNsYZd1ddPfHXOuvzKBkXG2WNvEBhB9ilmoiiVUosP52D7FdXuZkgbpVHqP5zvHVbLHADR+XSm0XsOKUYwTS1o0U/cq3AhFcV94NhVjtUS+HOTeBRGGIAvEiNMO1DkBtqoYThtYDXlhgCu2zOIoxIs2j8oeTbNMcdsr+6IJqwCJ/TUVFIHz1zld7GCtsKNzHuITCIDXxVLWoedwCywPbA7R180WfJH5SmvOwM6FgP2GquNfhVWS+0CEM1HTD4aWq3gZpwNeeH5hJaJ3mnYUf/vKZFjtEt1YVNNtJCkmXOaLXDdL9Q3CoWlv6o+QmnJbg2NevB3iqwHnp1b1k1Q4siSmoDvfgqJKOokWVSedBPaD2Gh175V5Tb5xVJ7DXtXbel3BY9O9NhYupdSPAf1bp6k9gm8hk+6Apa4Tr0geZtjiP0StMqZHuIk41wZhEyJjBiXZ03/L7i8VaUfQNTCPxr80VqJV5uoOjVgQX3KI+ZEw/mhQFPALxnNM2Ayl8IYaPWyNPa8DiD6mBU6JUCEkqlXvOmTwTWjR84thnLOz8SIMWk3UHmPYTAu9aNv2TjzwHt0DgOAuOqE6jW2Kpa8qFtgrV0lsug9zZdMqQyr7NYcSyWYjKfJAdrUPOzbTcFeobifFrFbb3SuZYSj9moBYdIyjagFSqLL9dTmVLQv/470q6aet19iDctKy9h4v9xDnFsT5fqxBkUXksJGhGDPTbrwrvsPIkXShqLmMLH/2KlVarHMH3JHlXjwu+aw+DOYnKaSw+s4kOkQowf3Mmbk2cWZN74w2hWmHhlPqAwaDTVeifyrVT7wgg07LAOc9YTzitbZkEDSYb53oaJVlYMOIRAsQrifwoO/UMZDc0RZLiMNbcMPvN5es0BLoPuI0pkP5+rlUG69cwCFQIXNfMj4Qx474ZNWRa+MVd8VQDhu1UsW2MFxrbmMf9Qog2kr8R2Lrapi4PLrF8rDwXjc9lUQnXpmiju+390oRoTVnBQ+XiNbaGdcMFUzlaqCCHUx5g9t1PgTSmgHN4NZhXXTbsKsGeFdW8dNEISRwV7vBdAo5nPJI1LOGQR1rYf1RVl09T2mVEFnOHzyqM926kiaqt8JHhmclg5ev7X87+QBvzYLqvRZC+FraeTT9osgffGblVoWrm7By9Gn70lJPzDytLWRIgYSZyUlkG/erQN90p/XSEgLuv2npPh+dr4eUf6PsFLANtxoSsHPvxskqzv5xE5HpYCevmQyCP8jCmbLpsWPmFIJMiJfwtp1m16QBPTZBS9HVeMDftdo4hFg2nMRqRjzQjjgZB/Cc20NHsTJzx8imOKV2egH6yaZbt3iKeSoRCh7UqdHyWhxGfZHPvRV9EbOValD0S9dihHtAR4er7LOxhVopZBWllHGkGrxfnIrPIYa0trt6aK8JSgQuKdNrgqOCfbqlzoKQMEMLPUzdC9pWXWSvanK1ZwXcksOi2Mou5e3mCNS8PZUAOhM3SxNFOlETKzOdrKOIpG6HVjZHCSsWWYjpAo7FsjXnt4DryD5a10K6rVvaUsZdoeYANhRzS+25eC28gwk7mBNa+QzfYAN6QlHKK91EFfIw4ZTHyH/GyxmOjbz1twbLpxwLk3Q1ZTiuYE8AWhd8gLm97DVlETXjK/FAeQ3+8ztY4cihGqHUrzL5dOR3MHVdoCcyKD+nAit8VdDHf5GwQ6o9CrYbN8ebBXHD/n85XGshOZwKBhZNxrrGwmFLB1DG53qrzH5a9fVgO0NzkiBksfBm2ufJjUB1Sa4gwsG8kkV0UHOyiWTdHuMNjsk2hU/pQPxSkBB2RoFkbczhJratJU7HULgwcN4eNYANqdkoWS/gCoioYdupDhIwDG4j7k6OsyzNxtIURbm51WJClLR9Rqu0LsIZ+ULQj1LWrBHCrNcnGy+pTXWL+7qswF6PQCLrfijlaaSuBMjW5MLaHyY2JoqH7aqG4/kjbkTxXaHJfiZ61PcPUjacWXSTC6dpHY9gp+ynxIQ3kCF3kfd5eQ+3BFGzi5t/qL1xL4zANnrWs02knpSUziBHxg3iAuYeV2eBx1Ads4l0uWBkru6QsF5J0cda6+xfnr01w+bM+vl/KQVr+fcSujOPEUxpZ+mpQVTQRVMv6hZ7Ww2yyS3aFXSKS1FQYVzmC/CnAAlOcu4g0MKv07wsER5uAzMTbyKORtnIkk3JU1DIDLxz00SNHHaOZXyWybR7shI018pRQSHRONLA+nljgOzKOys5H4lYanQTNQA/uCWYy/WCQxp9A30/Ih11Nj1X312g3od6DsTqjnWoVAvjRrC67a7znxkNq+bFdKPtjMSqhxn9xDeAlu9Gpk6lVkociMeWs7gj/LsdDIlyWsQc6FOPmBQQI6O6sFGr5hJYuoTAtFBT2fzYd+/jjfWUtwa8e2I1e474mHkp2WFhHDW7akKdyEoBtkGLQcrsYNTaUZY50VqrXiRg9KFqGms6Vwmk/Gs5+4FYLlyvS05QZVGMdFAwH2rJACiSH5Afa/YV4n5pmj2QtTqRu94nO2QCKG1ARpnil9unzwIMrviScL0ckoSSu7ZZDg4hiymhHjcGiQJbqhIqp10Y9yM96KTciqK37Rw6k1h11LKyg+WKR3xL+bGufDgTIMIAj1m0+QV6hHWj5AnJ13IyNNp86Tq/V4/XRmOH0vvFZRjr3fknNMREI9POrdUvD39zmxrpm4BrUmghVvXXsmGqa2H3EfbBRrGWbNp1pVYJ0x+hOorZjDVoUspmgKEKNdvHyWv/qHFkYkqblUQVymnqHS/sBlmEYgHakwCs1jcMCBlTSm2h2f5eC4rFi4aLx64vbKxS0RoD3cEO/k4W4KANH527HrrBMgfgTkidDPg08HihKaD8fA/SnbfwH9sFAuRkwAVmkKshnUowcrJ59AYwwwqKG8b299WXfGvtglIsswdB2vV9d+7zBvSz0sK56gtatBEELOYVUxZ57Y+URMGoZjm/BhYb59n8U8i/EcyM0fj07jLGItvXbj7PMnvMvFC64TgcnTomHGop0+GDpJDl+DsBLDoaB0Pz0sgFSfFwL5CqSKEY33olnOoLkPWr0ZLa9BIyjYh7q3ox7agf08lgMo60aXR688US0+ywzCpYieIHNxyAycytDne4pWUh4nWTl6zLJ90PkaErLa4tL4k+1pKG74F+2f2Ywc2HD7ZKIlabwMMS9YDCs8S7hQ4hD0ZchVSIUITbHgk8z0wEY0IQdGbHvGONQf417osTkWronTFZ2ebazQOm2X84/vg5/aT/R191BhHMN97pIFxWIh3+gPGHHpe94vHsvRLH4cXqDNbzeBAuy+LOHwRP2oeg/fFyTWzxPY/hezJZ63cJNfiwYIU+cYP/ZszQDmONhj/IYyxjsQ+6nNJorzu4VhXXOd/T2ljc9+sJYr769ygq7BhdOiVyf3e3yNWzNfkfg4ydHgLfoXyrDQyn+4d6x30cnhQHHI9JGbf06E8oTR84qyMzQl6T6B9dxzGmw6fZQj9aSdeS24hDPR3kV5WxWm4Yyh08oyseUIm5iTAOtup45T/vQc3FqJlHQejofYV2+TOm/0lJevq7+T6gsSG3wVZpAMH7CG9DEpKNctR38A3KalCvaECBajzJQwvF5afvtGPRB6uKflxndENEuZLE65oMXhi9DaX2/12G8R0BrxIYQWO7T1tWwlQLjW+YAGSzD5jACeH249En+et3XCAY9MwakzEECPPriQS4bY/wK3TlG2p+QrLTHoEuIdUVql4X/tHiysDc7e9XYKve3iM/AhufEuLU3WmCj3Kmk3Rnj5EXHMYaF1/VrUh1B2i9M6iwUbkKec8AgjYKu1S62/y99SJ873m93oUNu0nkIQllYp4Hx28pkxNGU42nHH74ktTRnKqfaxWLXVoDFfGtaFaE0VcrfDGIukUCNTa9u2VWuPMHdOxDp9dU2rAFoKwBRLEWoThHNs5vYdrclXuG1yRbsYRJhxlI1zAzhiMcWgYXt3Www9pTK7jyJOCV5GD+UJZSvb3x1wVIuo1hj7KXWdeoUrQ4gahskIPGTGMh9XoCt6tcHD76DcDVf9O6B2lgM37Ye8gXWg2fJDmJ2u4ZDMIvmWtMqpozII7lF3fZUDInZBKtk+SNksn3pR036yN/t91etq1t5HRXxliqsc1MBNtoogFo/ma/5Y9IOTkhtrSEV176gbptXUSdh5aKMhZRD36N4wIfOK92YTNLGv0tJ03dFYbz9GDCcGzWcRBPiPFiRmVY+R8Y//ZluXyaHawDTNpD/D++eNA4uqwoZu7dRde/3Yi0qKWAqgt+z5pHLIIVYHTpRN+SIfarI4Sc1PzxTbNC7T0mvzi4fnuo96/XZmIbCjJnBFqlZTohdVNBk0vGyx4277s5orOH2oxG8KuovIMasgBw07NhAVL+msGjCo8aismcxR36HSXSrY7Q2fHqhngpr/khiMC/3AxiW8znU7oPN6E7aMXr2qlRB+3+IVclw007jEC7e/3ayWqgd/MVg7hYljgaYVoL27lRMaESfd/lHrZtI3ClfSLLIXwxU7TMjaldQcoa8ATCN1HbJsdGV5BhTgx3EjBATbwHX3sL2V6kqd1BKIRe13UhLqq0pRbc3jN+MmJ472UyZ5nvh+bpmXH/2UYcKBfqZZlcGhkAengEcpNb+dtaeu7jCp4WznXLxGhOEz9p425RqyrAafHdZAwbNQdl+Ls0UZhkr+QzLNR1tgGBdDmlNpTOAdZutdXRFO6HS/RHAuc8WAeqwsFZoMUH/XzC7wSO/MM0HPjDtz1rtyRH140B6Z0jDbNOtCtVkIW/i4SERT8JiWnwt32eWpcvaNw8BHYZHTaxMRgmrEseC1cvbPWK64MM/Ogt2BtBI16MwoQ6p2rtf1iRXg5X+vdX8IIBc0iKThKE1iJyZfY4xoXsj6xzQGuPI70Wxb8Ji6cfAwNy/+FVp3AlgQtb6TVBQYJeJEV0NG8lnW9qIN1Zw9FzATZ1IhDkmYrL7V1HdIo9ZCTzuVDLLy0efGxFyikZ4vdnK2GqTvvtCKp2OV2EqN9FuJmG6Yu85sdUe757hzCxPx5+9Spsjn9elbYNlddPRl9ZvjdWVEm2p9mMFg0GsWiEek82pWDZEXF5sdv2LMtFd/11XIh3PhxlmRUHiTHcpIbP/1qqF7xQXEaUxOvmq8RWlLOyXz4GKjEPBjrFDeUF+JjU4uxJ9OYOFR1TONk0Xee0q8m00E07O/276wO1XOX/UcMAAAAA/z8AAHHZO8AAAAAA6dk7wK7Zu0AOAAMBAQKABP0///////////cEBI//T5P/AwAA/wEAAAoBAQEBCcQfGT91A1kECFgEJARYFEgHIDBgMFAsWBwsHBgHCAMEB2iEmLwcOBAUAwgQFAMgJAsYCAQIBwQfEBw0CAcEaQFJAQ0BCQEXBAsEAwQIBzAYEwgDGAcIEwQDBAMgEBcEBwQQAwQUhKQlAyUDBQUpBXECfQIEGAgUAwQDCGA4GBAPFBQfRESwsC8EEBcQAyAQAxADBCwULBgDEFAsByAIAwgfEBQDFCMQJwQLJBQrBAQDIAiwzBA4PGhkgHy0ODAIBxQDCBMIHBQDGBgEAwgDCB8cFBMESCAYEAsIJBgbGCQwHAhTEAcIBAgIEAggMAQQJwgUDzA8CwQHCBAfBAMUBBQIEAcEBBMEMxwIAwgDCAgUHwQbBAQHCBMECwgDBAQEAyAkBwQTBA8QBCsEA4BEBBBDCAcEBwQHEAQICwgDBAQDEAQEAwQXCAgEFwQLBBcEFwQDCBcEByAEBA8IFAMUAwgHBAMsHAQEDxADEBQEEAQIBwQQGwgDBAcEHwQHBAQEBIMEJwQrBAQHGBQDCDcECAMEEwQjBA8EIwQfBA8IFwQTCAQEAwgDBBAIBwgfBAQHBAMECwQbEAcEBCMIBxAEIwQHCAgLBAQ3BAsERwQXCCsIAwQXBBArBDsEMwQDEAQnBBcEBwgPBAQHBFMEBwQDBAQrBDsIOwQfCBsECwQLCB8EBCcEDwQEGwQHBBsQJwQ3CLMQLwQDCBsIBGsEJwQIDwSTBCsESwQDBDcEBAMQGwQnCCcEJwQrCAMIBAgDBAMEDwR/BG8EvwRfBCcEIwQLBCcERwQ3CAMEGwgfBGMIHwQbCCsERwQbBAQnCCcEcwQLBB8EpwQLBBsEKxAUBwQHBEcEWwQTBFsIvwSTBJ8ICwTnBEsENwQTBC8ETwjrBMcI/7cEJwi3BJMEWwQHCAsEDwh3BBME1wT/PwjXBP///3MI////Fwj//////xsE//+XBAT/////hwSgHXBxp3JXPOuUpQWiAAC8CWxc8XXh0GBcZFX8wSU+BP1vnOkSYFxOVfxMikS1ourexZykYJz8VfygA5xTSzI8O7qkAb1Mvjz2P8Y+/YLfcZAPyFtekFQToPG8qz+MnGiSnnYhHa/co/tMhOKxJjguvJs+YHK7c3zyY9YFmHWG4qzPA8BFF8DxavOL3P9p3FUj0CfJXxb1YE/KY17MBAWcB5IEXaAETta5pAG9EgDaKtj61azgtLGun7Ceqbt7bzNmEedBhMxTOKh9GHnK95qpWPBJXVpHZyAhP3hef248u3x/tnHgOed+sk14NwJg7w1osJQ1PiZlwRWxDytZXMeMbNh3fYWIsQYmXL9SFaIMcKr8Jsl1OA0qFoKbR7+HXuYd3CrZQbM4Mk4AF4g2WL/qVm60P5BGO7EdYSp2Tnmj9zjkDRZ8aPdYDM+K4hW+CQG+dthKPYpbk3qN9p3WCH17pktN79nkVI/k4y+OiDeVjgpzpzNCpX925AXh23c1jM9HahbHBbEaiVM9gTo0dqvK0bfZzDXJezjGZFVpTP6sYbVdHoGh4Ax9hY/LJBFZ4YzeJKzjh8oYATGgjRjBn5JTKqYigYXduJQgwRyZT3aI1/S6qiJ8tABA4TInS40MJQkOiZglum0x9YQsw2OJaGRkVJ33Lq+bPOXAutl3JoDGjeTEUNjAaGEo6GkwNkth88Xd4AbaF8xPUaKATOiFa+YKHkCj6sCck+TGW1U299VICtJB3A/gJ0R/DHzyxE1vCNw+Q53qHPg7lC1nCO1CH2sEPIY6O2v0u0Aci3vDS4uoMuNSZvhrQlYaW7pfJVo1iCUyHjgquQQiHi9R0N8EB7Nb4C7gFY1NG9pk4c1hT9uhpE2EkchCxRdEv27W9WqDnaR8SBNheI4UAD/0eZ6oFyRLFZj8OM3rNabpq3F/Fq1uZAZTVgVWzPgrsRSDWB00/zCq6Znd8i0s681MBM+erupCV0WVIIM2Wn7pJWt2lbFlOJ987r3QR8BgVVIpwEn10MXZ1SWuuNbh6d5s2yrq7TxKym2KVlvu5MY2lfrEG4F+VaaeNayWICBqa62CvsVyFVL14q2zzIuIDu9Iejeotpfh1UD2qDrmb4J3pAe1EfK2LUspDNPqHhT6sE9SGu6LsJZv8cAundxvJHc8a38NHsH8vxdA2/S7BbgTtRwhUEVFWUtsNJ5fFk8VwwR11HypQdbUBEeVSsfr+hYjVwDb1ab//QB378Ag3glzLR0EkIpmALbL+GH8+089aCeJnEN/JOkMHg+HcPS7YM+DfXtlYdcStFp/NSL44ppWw3QXQ+ypCx8YFSfGrdhcwMnJ1rPNqK8zlai11l/dsFhRhdZ1kJadpmOVCd6aRj/68EKnIxVHavpF049bP1PiLR4clkTBgQjoVbJKmNkeY5S2VLIzzjxnwmsDhKtFiPOqvAwEjgmgd4SDBGaOepaL93TGX7uihk6MgNQb4toyfCXtN9FbLR0kkELASfpUL44ZVf1weVORt6uv4Chrt5Jy5gX4WegqEqQZgi7mAvcxZvoV2I1OVvT4IrclR7FReHZ2HGeajVgKMDLcEjXaWuiB9vSbJx9DWC27ZpxURH0CvGW6mirKNNYn+A/bxzkmxeyo1fq+1cbBea6/ILHZFJLS7MsI8EDO28ws5qfD1CBUzTqPLMGfKjeKPSZ13IV4qgzB/JqTZIXTHLkKYUCzEDhJgyMfe42NbQVUhO6ogQ7AmKQfYjcJPAakCc+Yu4kzZ5TWaFrmMzwwLWGT4sC6/dg1lQUNdy+dxShDWBmjV71slrYtTCTyFp5dwwS8d6feSKUmVmPeYpvxwFLEXitlFfNLUYBeM9JwNLYzTpRAlt8dubcw25Efj0l/EBzyxiZtCNyrLCnm/PkkqyJr9PCeO20c/IauIm8c/MLz4l4KMmW74hvp706rIdaZJjTHlkur2xIuUbyzXW41BZ6ky5JTZWrgJ/sDRr7CxsVVAaZCNtU0ktVDWha0WR4h8koTm1Sybd8MIgOsx2MoNkxKOO+W4SFPbxm2kpk1I1Yn6K0Vdq9HBB1By2qobLJdK1l+8phreAgTuXaNdRTrjcCbjCatxfnajKpOSYIzAd8tlaaPxGE3mOzvowSLMjUu+u0I2XWCPCYC10DfCFZXKcsWa9WKA8AEdh9ggWtSgoQsfNW8ZeKyVlCIVYcWZAbWQIP3bUo01jspu0t3LJ8n16uCopJvN2AGQG+F+ktq/XHW2M6xxlk4wVK9JG/rRxbLNTefYqArAPO/YA4GXX3YYw74IGVgDvgVTsjS8MAw2k1pKH+8bHX5CsHcv6NN0xyU7ZMithAxtgAzd4OJ7UFKwFUglbaCVW65DGk+XFh5D2ZeN+9pOTZivTjbZTeJixiWHMR4+iggX7LaHvgOJ98x8BfTH6NbQQM/0KMWbwFYBCCI67JEd2GLPhAQSOsbMNiJomP2Rrn/IuTAW5+9jBOWYYChq3Ct729ar95RQwGzwj0kCOBE1t1FzYnWpvnyUZhnP/UjD30AYlcbYgjcrKRsJh506IhD5/z7FHUlbhQfgslnBDypDTaA1R18uhUkDnw5Uo3lNKObN3bX7FFFJ3hrzu4VKkWg/FkXlc3IG+LNOhQVJxVix51hL8h+VfSj2Gy7FvbR1SWAYUTKCA7UHNWqFcnEa4zBZVsC9nD186zAdrg7e/89iG/4jeZoRz1JVJCU7mqRjAfVTAlG9twjVYwOPoA/mCFfQh8OUDPCmL1X0zpXRHiQMIZbuD/O+DXV0SGM05cz+JqhIQweUF2hFz46frjsZVQ80pXkZtPDbALoh96kNYkGCBwWyxh0OdRd6hxgNn5rFiRdy7K/mTadxubjSHLmGZwZQGoPolYhnnWw/Q2PHQX9fF+T3xq4uCVTepslUCk2t8esehQCvVnKcXrAnha1hm08WYLK9/pQNHE6ljAJsjs0lreHGmlLyGisAR5aib8y4BmjzojppJhTDYqiXFyAA6gwaqoeklHr9z2CENQBKONe2jUbHOZ0fO3amihVmd19sWl12+TAUAM/ZqSYRhGIsXY494nK0e2JOfBU45ZEVI2a95en056UvD+y93cHfS9oCF9thR4qDaiaTsiVql3uv15DgPhrhwyK4oGE6s8X7HAYDXcz1Rd5rSg9OpMWtbPJ04J8StCnOEJEIb7SWQlVTtjXKEGBIPaD9eYsF1XmfsGxkbQA+o/xLHxOsn5hyQYu28TC7Jd/2O9horAdEa7spBi/BGaZxKiWxMLslxO0YGo1/f/jnpapJySeG2YqBmChcMdbHfrGze6GODnXNicRXneNKpExm27WSiuEOR+gaLVnUOQa9OCh+NylzcwIKKRckNI3AJ198GQEvvS3MBn+1clO7YW3v6AuZeKvuQ6XNL4cXhKT09l3nkD4SnA9WhVAjohhfwI/JYWPVg3+VOcfv65meAWrggJsYf3tRmNvHq/MWPJYZ2X5Ynz2RSJNcNzF5VDrom8u9YtFJryUe6EhDB5QXaEXPqQO11BdC/Jc+SxJCRr8ooJxl2QO4nRqmdJdLISkyNa3ZcVme/nzjYB2WQREskKAb5qn1kcUTM4YinsyW+FLLmVa+ZMxFJWjLlQDWyHqJn6g0HKx8lj1XUHuHuM2Xqr4+6YehhAgH8n3xGbDmjnJh5S2U+uPCzHHI0YZ2HnejV+QFMOifbyQs8Y8Y6AlQtw0dX9LmSicQqG/cdldRyCGZSivcTdbYFlzVV99jHIktHRGSrulDk9HpR4HzRSK2phoYnXt/RJRbndG/gK41a/83TPCaZkr/ooJkXP1TmQb5qoRV9QscMTz22kN86oKjx0FTHQJ8DwvaAhfbYUeKg2oWQ5hKM8cqoqkEjo3guIQ7f4kljDFGvIwc1x/z73R8xVEaNw1I2KM/jz1wo0hAVk44cXUuPiF20T+hWUts8RZYfbAkqMJPcWwFKKL3H5asF953VsSZ0sC0ZW1uN8dw2VT+tHpzmRmoR72QIa7u/bG3JwwbW6UJqsESl68KK64o6RSOjJzxWfSUPHTESHoAsZQQf0OqUzbnBaTGS7+7pC4f2SnDNs6OZM7Q2pp5whRJTqIlDl2DYh80quVywaR8bde6/kGY4P9XAJ6uhmoRYhczetreq7V8KN+XEsZ71z5/M6llxKws2H5q4kTlWOeaMEZfDBeN4R5D83aIVs0QY4Yh0CgCWAm+K+1IQwCxp2Qu3k9F9Pt+9oBPsOSwov4kyd0OaJnbsIow71TZ8hDkVj5mOJ3qtOthclk7Nk6+H+3GCRQuUE+oGbzpdK4qFhFDNkRfWeXcfoEQp6LKzYZP0tiCFOY4qLhJRBXQPUM8z3yeAWAEMkSNf4Ld7B9isR0lbYR+TziKyN6Cj8izPYDbtvEwuyXf9wCO8iJeQoZmpISwTCc27J8qVDPul4iftznfjG7N4MTiRwxNfGmwtQ5099k9mTi/fbDBoLQ/mFKBJX56DOlkGwRm5GrRd/7X10F2JJD1E5SerD/FZW0IdceHN0ISaz6+aXsygGwv+5tMNZjf3QS0tWf0d1hcI/6kAi3TqIw6hZ4sl0t1o5WqTj0+d+X0Fsh+PHNcVaV/16m2FkQebqUXhxA2dnSiBTts/ql+0Y6QLTMSIBfrcn/J1KTMjqciNkwn9/jfjrCdHr6EniR54NB47/Hu2tP7q8zdqXzkYXsl57ahiPg921a1l/KbEDFf7hHpI54uWi0klk/sr7/SCpEqE+SjqypqjNG85Rs+tNghw96nan91BKlEmtbMiV0r078S5yWWBkJ+Ev5Lrlba0id4lOwF14TXWS0LT1L8nMsWVGsMdlQnMGhvzEJ9FnuC9wBLVCN6qK2yEcitc5hmnPQXHdlNZH1uGkIUDespHQ+rA7fc6HiKTYdahdBreHqqnqalBb/t6H2GAKulbHswgXqk7AYm4JjphBQ4ivn1TPE3A0nWtviYz1MjBECYU9MjBECYU9M16OMQe4b2FgQOQWEkSi4Lb3UGHoEggAAAAD/DwAAAD5XO5+t08AAAHBBDAAAAP/Y/+ERokV4aWYAAE1NACoAAAAIAAwBAAADAAAAAQeAAAABAQADAAAAATAAAAABAgADAAAAAwAAAJ4BBgADAAAAAQACAAABEgADAAAAAQABAAABFQADAAAAAQADAAABGgAFAAAAAQAAAKQBGwAFAAAAAQAAAKwBKAADAAAAAQACAAABMQACAAAAIgAAALQBMgACAAAAFAAAANaHaQAEAAAAAQAAAOwAAAEkAAgACAAIAAr8gAAAJxAACvyAAAAnEEFkb2JlIFBob3Rvc2hvcCBDQyAyMDE3IChXaW5kb3dzKQAyMDIxOjEyOjA4IDAzOjQ1OjMwAAAAAASQAAAHAAAABDAyMjGgAQADAAAAAf//AACgAgAEAAAAAQAAA+igAwAEAAAAAQAAAyAAAAAAAAAABgEDAAMAAAABAAYAAAEaAAUAAAABAAABcgEbAAUAAAABAAABegEoAAMAAAABAAIAAAIBAAQAAAABAAABggICAAQAAAABAAAQGAAAAAAAAABIAAAAAQAAAEgAAAAB/9j/7QAMQWRvYmVfQ00AAv/uAA5BZG9iZQBkgAAAAAH/2wCEAAwICAgJCAwJCQwRCwoLERUPDAwPFRgTExUTExgRDAwMDAwMEQwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwBDQsLDQ4NEA4OEBQODg4UFA4ODg4UEQwMDAwMEREMDAwMDAwRDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDP/AABEIAIAAoAMBIgACEQEDEQH/3QAEAAr/xAE/AAABBQEBAQEBAQAAAAAAAAADAAECBAUGBwgJCgsBAAEFAQEBAQEBAAAAAAAAAAEAAgMEBQYHCAkKCxAAAQQBAwIEAgUHBggFAwwzAQACEQMEIRIxBUFRYRMicYEyBhSRobFCIyQVUsFiMzRygtFDByWSU/Dh8WNzNRaisoMmRJNUZEXCo3Q2F9JV4mXys4TD03Xj80YnlKSFtJXE1OT0pbXF1eX1VmZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3EQACAgECBAQDBAUGBwcGBTUBAAIRAyExEgRBUWFxIhMFMoGRFKGxQiPBUtHwMyRi4XKCkkNTFWNzNPElBhaisoMHJjXC0kSTVKMXZEVVNnRl4vKzhMPTdePzRpSkhbSVxNTk9KW1xdXl9VZmdoaWprbG1ub2JzdHV2d3h5ent8f/2gAMAwEAAhEDEQA/AOXx3H1iQd21ljvpB40rsOu/bc1EHWMnfu9OqZ3RtPO6uz9796lCpdue4/Siu3u18fo7PzjttYq3homcMSdRsF3EQNC6NXU8kVOsFdZ9E1iNhOhbazc/3fm7UJvVMjaG7KyAAJ2nsK2eP/AINf8ARMjXbLqvn/PexCnSEBjhctOv/cpMpUNW1flPycffa1rSywABgj6W6zX+09KjKfjY++prXF9hBDxP0dtmn9piE0j7K4/8K0R/ZScR9laf+FcI/so8Iqq0tFnfrSZ3VMjaW7KwCCJ2nuLGeP8Aw7kW3qeSam2GusesbBGwjQNqZuZ7vztyz50hFs/omPruh1vy/mfYgccLjp1/7lIlKjq2D1jJ37vTqmd0bTzuss/e/euQM15lzidu6us/SDBrXWdNm65yB46I+W7a0n6M1Vd2sn9HX+cN1r0eGIOg3COIkal+gEkkk9apJJJJSkkkklKSSSSUpJJJJT//0OWpIdY4yHEV28lrj/N2fnO9O5qrchWaTuscZ3AV292v/wAHZ++G3MVYSE0bnyCTsnq/omR7N3uq110/nv0mn+agI1f9FyPdt91Xj7v579Hp/nIQ0148giN5ef8A3MVHYeX7UrSRiOjX9M3/AKlJxJxGzp+md/1KTZGM4Dn1W/8AUpOk4zQefVd/1KH8VdPohR7f6Jj+zb7rdddf5n9Jr/moJ1158ii2f0XH9273W+Pt/mf0ev8AnInePn/3MlDY+X7UPARstwaCZDSaquC1p/mq/wA5vqXOQTJRsw7RM7Qaqu7Wf4Kv9wOuegdx5FQ2foFJJJOQpJJJJSkkkklKSSSSUpJJJJT/AP/R5amXPJB3RXbrLXx+js/O9trFW1geSs0kOsdqHEV26y1xH6Oz98Mvaqw8O6aNz5BJ2T1z9kvgF3uqny/nv0iB80ev+iZHu2ndVpr7v579Hp/nIP8ArqiN5ef/AHMVHYeX7UrZOI6OfWb/ANSk6RiNnn1nf9Sk0E4jhx+lb/1KTgRiNHP6V3/UpfxV/BD80eyfslEgt91sef8AM/pEH/XRGs/omP7tx3W6a+3+Z/R6/wCckd4+f/cyUNj5ftQawfNHy5aCSds1Vay1k/oq/wA73WvQD4d0bLIaDqGk1Vay1pP6Ov8AcD73IHceRUNn6BSSSTkKSSSSUpJJJJSkkkklKSSSSU//0uWpO57jO6K7dZa+P0dmvu23MVaPxVmmHWOJO6K7dZa+P0dn53ttYq2kJo3PkEnZNV/RMjQO91Xj7f5736IXA05Rq4+yX+4Nh1Wmuv8APfo0ABEby8/+5io7Dy/amaP1V3Yeq3/qUnD9Vb3Hqu/6lJsfZHA8es2P81J0fZGgces6f81D+Kun0RcjXlFt/omPoG+63x938z79UEhHsj7JR7g6XW6a6fzP6NE7x8/+5kobHy/agj8FYyIDgSYBrqky1gP6Kvu3dc9V9IVi+GuBB2zXXrLWT+ir/O91r0DuPIqGxeiP1w+s7QLLeqWMYS0FxqqDZLtrtrjVt9rEP/nt9YtoP7XMkT9Cnna50fzf77WsWHmen9nMQHeprGyeXeDvW/zmKlyICZEEi+IriQOgeq/57fWDdH7YO3dE7KeN7WT/ADX+jPqJv+e/1i2k/tcyBMbKedhf/o/3/YuWEDQ690pBAjsncB/eki/APUu+u31ikhnWC53u2t2U6w5oaP5v86vc9T/54fWcMbZZ1SxjDtlxqqDZc7a6HGrb7WLCoLvsDR7tu/j37fpf9sKGUa/s2kbt4n6E/neDvW/zmJmt1xHet12lXQ2d3/nt9YtoP7XMkT9Cnna50fzf77WsT/8APb6wbo/bB27onZTxvayf5r/Rn1FyvIgJCBode6fwH96S3iHYPU/89/rFtJ/a5kCY2U87C/8A0f7/ALEj9dvrFJDOsFzpO1uynWHNDf8AB/nV7nrlpBAjsr+Pu+wsHu27+Pft+l/2whIEUeKW9bpGvQP/0+WpO6x2u6K7fzmvj9HZ++G3MVYKzS7c9x+lFdvdr4/R2fnHbaxVvDRNG58gk7J6v6JkDbu91XjLf579J7f3fo+799AH3o1f9EyNdsuq+f8APexCnSERvLz/AO5io7Dy/albH2V0/wClb/1KTo+ytj/Su/6lJpH2Vx/4Voj+yk4j7K0/8K4R/ZS/irp9EJ+5Ht/omONu33W+Mu/mf0nu/e+j7f3EGdIRbP6Jj67odb8v5n2JHePn/wBzJQ2Pl+1CVYyDteNds11fnNZP6Kv9wOueq/jorGQ7aZ+jNdXdrJ/RV/nDda9A7jyKhsUmWXHFjWA/jWOXeNbW/wDgqotIJgK7nNP2SYj9JoYju78/f/6LWeDE+IQx/L9Uy3Za+MpydNRCaZ76zolxydE9a3adpxGmG7t/MN3c+O/1P/A0+UXHDA1IDxprH53/AAbW/wDgqag/qTRx7+JP7x/N2bf/AARLMafsQMR7xDoj978/f/6LUP6Wv7zJ0+jTaQTATa+MqIMT4hSme+s6KZjXJ01EK5RtOKww3dv5hu76Xjv9T/wNUuOTor1B/U2Dj38Sf3v3dm3/AMETMmw810d/o//U5akh1jjIcRXbyWuP83Z+c707mqtyFZpO6xxncBXb3a//AAdn74bcxVhITRufIJOyer+iZHs3e6rXXT+e/Saf5qAjV/0XI9233VePu/nv0en+chDTXjyCI3l5/wDcxUdh5ftStJGI6Nf0zf8AqUnEnEbOn6Z3/UpNkYzgOfVb/wBSk6TjNB59V3/UofxV0+iFHt/omP7Nvut111/mf0mv+agnXXnyKLZ/Rcf3bvdb4+3+Z/R6/wCcid4+f/cyUNj5ftQ8BWLyGvGu0murgtaf5qv85vqXOVcyVZvJY8GdoNdXdrP8FX+4HXPQO48iobJrMUZFO0O2S8Ev2sPL9ng238/d7nqv+zdAfUOo3Rs/kus8f5GxWHHGYN9pES0OjaTq79J7GTZ/N/yEP7RibR7jMa+3vtd/J/0vpqKJlrV/YvNdfzYfsv3bfWOrts7P5bav3v5W9N+zDsn1ToJjZ/INv739lF+0YO76R27o+ieNzf5P+h3pvtGJt0cd0ae06naf5H+lRvJ4/wCKio+H2sxQ+qj0t+5jS5wMPBMPDf8ASel7t/8Aok78X7RQGh2wlzSX7WE/T9Pwbb+fu9z0xdS5hfW1+0lwZZsO2dw2e/Z6f0N6ROM1ofaREtDo2kyXfpPY2bP5v+Qm6+N32Tp+HdB+zdAfUOo3Rs/kus8f5GxP+y/dt9Y6u2zs/ltq/e/lb1P7RibR7jMa+3vtd/J/0vpp/tGDu+kdu6Ponjc3+T/od6dc/H/FRUfD7UX7MOyfVOgmNn8g2/vf2UcUPqp9LfuY1znAw8Ew8N/0npe7f/olD7RibdHHdGntOp2n+R/pVPdS5u+tr9pJDH7DtncNnv2en9DekTLS7+xIrp+b/9XlqZc8kHdFdustfH6Oz8722sVbWB5KzSQ6x2ocRXbrLXEfo7P3wy9qrDw7po3PkEnZPXP2S+AXe6qfL+e/SIA+KPX/AETI9207qtNfd/Pfo9P85B/11RG8vP8A7mKjsPL9qVsnEdHPrN/6lJ0jEbPPrO/6lJoJxHdv0zf+pScCMRvf9M7/AKlL+Kv4IT8UeyfslEgt91sef8z+kQf9dEaz+iY/u3Hdbpr7f5n9Hr/nJHePn/3MlDY+X7UGsHzVm+WuknbNVWstZP6Kv873WvVY+HdWLyGvGoaTXXrLWk/oq/3A+9yB3HkVDYpM1x+ya7tvqfy45d4t9H/NsVACVeyyPs8aTv8AKeXf8I53/gKotIJhDH8v1TLdQ9umpjVKZAjT4pR2+4Jy47RKetbdGwYrfo79/wDI3c/H11LLc77GJ3bd4/fj87xb6P8Am2JUFxwWiSW7/wCVH0v6np/+Cpskj7KBpO8eH8r/AIRzv/AVD+l/hMnT6NICUh7dNTGqTSCYSjt9wUzGqZAjT4q7j7BjM+jv3/yN3Px9dUy47RKvUFxwWCSWh/8AKj6X9T0//BUzJsPNdHf6P//W5ak7nuM7ort1lr4/R2a+7bcxVo/FWavdYSfdFduvtfH6Oz8722sVaNE0bnyCTsmq/omRoHe6rx9v8979ELgaco1Y/VL/AHbYdVprr/PexBAE66DxRG8vP/uYqOw8v2pWj9Vd2Hqt/wCpScP1Vvceq7/qUgB9kcO3rNj/ADUiB9kaO3rOn/NQ/irp9EXI15Rbf6Jj6Bvut8fd/M+/VCIE6ajxRrB+qUe7dLrdNdP5n2InePn/ANzJQ2Pl+1BH4KzkHa4Gds11ay1k/oq9Zbuueq0aKzcIdI9s116+1k/oq/zvda9A7j6qGxXziDibS4H9IPbI01d+aGb/APwRUJgELVfVVfT6Vlha3eCQHkH6cO9j3Or+g9z/AKCr/YMeAd7txE8t52udHH+kDGJkJgAg910gSWmCD31lLQd9O6vfs/F3R6jo3RO5vG9rZ4/0R3qI6fj7dHukCQJbzsLvD/SexO9yKOEsqWzhMdtH0/pbf5R/P3/+i02YQcMNLgfePbI0+l+aGb//AARF9GuussY/c0FxaIYSSHDb7w31Pc1znfSTuqqvoFVjyxocCQHkH6cO9j3Or+g5z/oKOxd/1rXVpXg5cwCE4IPfWVc+wY8A73biJ5bztc6OP9IGMUv2fi7o9R0bonc3je1s8f6I71J7kVvCWjoO+ndX6GzhsdtH859Lb/K/f3/+i1AdPx9uj3SBIEt52F3h/pPYjCmuuvYx8tBcWiGEkhzdvvDfU9zXOd9JNlIEADukAh//2f/tGZZQaG90b3Nob3AgMy4wADhCSU0EBAAAAAAAFxwBWgADGyVHHAFaAAMbJUccAgAAAgAAADhCSU0EJQAAAAAAEMddF+V0tW712745lMDpeVw4QklNBDoAAAAAAOUAAAAQAAAAAQAAAAAAC3ByaW50T3V0cHV0AAAABQAAAABQc3RTYm9vbAEAAAAASW50ZWVudW0AAAAASW50ZQAAAABDbHJtAAAAD3ByaW50U2l4dGVlbkJpdGJvb2wAAAAAC3ByaW50ZXJOYW1lVEVYVAAAAAEAAAAAAA9wcmludFByb29mU2V0dXBPYmpjAAAADABQAHIAbwBvAGYAIABTAGUAdAB1AHAAAAAAAApwcm9vZlNldHVwAAAAAQAAAABCbHRuZW51bQAAAAxidWlsdGluUHJvb2YAAAAJcHJvb2ZDTVlLADhCSU0EOwAAAAACLQAAABAAAAABAAAAAAAScHJpbnRPdXRwdXRPcHRpb25zAAAAFwAAAABDcHRuYm9vbAAAAAAAQ2xicmJvb2wAAAAAAFJnc01ib29sAAAAAABDcm5DYm9vbAAAAAAAQ250Q2Jvb2wAAAAAAExibHNib29sAAAAAABOZ3R2Ym9vbAAAAAAARW1sRGJvb2wAAAAAAEludHJib29sAAAAAABCY2tnT2JqYwAAAAEAAAAAAABSR0JDAAAAAwAAAABSZCAgZG91YkBv4AAAAAAAAAAAAEdybiBkb3ViQG/gAAAAAAAAAAAAQmwgIGRvdWJAb+AAAAAAAAAAAABCcmRUVW50RiNSbHQAAAAAAAAAAAAAAABCbGQgVW50RiNSbHQAAAAAAAAAAAAAAABSc2x0VW50RiNQeGxAUgAAAAAAAAAAAAp2ZWN0b3JEYXRhYm9vbAEAAAAAUGdQc2VudW0AAAAAUGdQcwAAAABQZ1BDAAAAAExlZnRVbnRGI1JsdAAAAAAAAAAAAAAAAFRvcCBVbnRGI1JsdAAAAAAAAAAAAAAAAFNjbCBVbnRGI1ByY0BZAAAAAAAAAAAAEGNyb3BXaGVuUHJpbnRpbmdib29sAAAAAA5jcm9wUmVjdEJvdHRvbWxvbmcAAAAAAAAADGNyb3BSZWN0TGVmdGxvbmcAAAAAAAAADWNyb3BSZWN0UmlnaHRsb25nAAAAAAAAAAtjcm9wUmVjdFRvcGxvbmcAAAAAADhCSU0D7QAAAAAAEABIAAAAAQABAEgAAAABAAE4QklNBCYAAAAAAA4AAAAAAAAAAAAAP4AAADhCSU0D8gAAAAAACgAA////////AAA4QklNBA0AAAAAAAQAAAAeOEJJTQQZAAAAAAAEAAAAHjhCSU0D8wAAAAAACQAAAAAAAAAAAQA4QklNJxAAAAAAAAoAAQAAAAAAAAABOEJJTQP1AAAAAABIAC9mZgABAGxmZgAGAAAAAAABAC9mZgABAKGZmgAGAAAAAAABADIAAAABAFoAAAAGAAAAAAABADUAAAABAC0AAAAGAAAAAAABOEJJTQP4AAAAAABwAAD/////////////////////////////A+gAAAAA/////////////////////////////wPoAAAAAP////////////////////////////8D6AAAAAD/////////////////////////////A+gAADhCSU0EAAAAAAAAAgABOEJJTQQCAAAAAAAGAAAAAAAAOEJJTQQwAAAAAAADAQEBADhCSU0ELQAAAAAACgACAAAAAgAAAAc4QklNBAgAAAAAABAAAAABAAACQAAAAkAAAAAAOEJJTQQeAAAAAAAEAAAAADhCSU0EGgAAAAADPwAAAAYAAAAAAAAAAAAAAyAAAAPoAAAABQBSAE8AQQBEADEAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAAAAAAA+gAAAMgAAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAAAAAAAAAAAAAAAAAAEAAAAAEAAAAAAABudWxsAAAAAgAAAAZib3VuZHNPYmpjAAAAAQAAAAAAAFJjdDEAAAAEAAAAAFRvcCBsb25nAAAAAAAAAABMZWZ0bG9uZwAAAAAAAAAAQnRvbWxvbmcAAAMgAAAAAFJnaHRsb25nAAAD6AAAAAZzbGljZXNWbExzAAAAAU9iamMAAAABAAAAAAAFc2xpY2UAAAASAAAAB3NsaWNlSURsb25nAAAAAAAAAAdncm91cElEbG9uZwAAAAAAAAAGb3JpZ2luZW51bQAAAAxFU2xpY2VPcmlnaW4AAAANYXV0b0dlbmVyYXRlZAAAAABUeXBlZW51bQAAAApFU2xpY2VUeXBlAAAAAEltZyAAAAAGYm91bmRzT2JqYwAAAAEAAAAAAABSY3QxAAAABAAAAABUb3AgbG9uZwAAAAAAAAAATGVmdGxvbmcAAAAAAAAAAEJ0b21sb25nAAADIAAAAABSZ2h0bG9uZwAAA+gAAAADdXJsVEVYVAAAAAEAAAAAAABudWxsVEVYVAAAAAEAAAAAAABNc2dlVEVYVAAAAAEAAAAAAAZhbHRUYWdURVhUAAAAAQAAAAAADmNlbGxUZXh0SXNIVE1MYm9vbAEAAAAIY2VsbFRleHRURVhUAAAAAQAAAAAACWhvcnpBbGlnbmVudW0AAAAPRVNsaWNlSG9yekFsaWduAAAAB2RlZmF1bHQAAAAJdmVydEFsaWduZW51bQAAAA9FU2xpY2VWZXJ0QWxpZ24AAAAHZGVmYXVsdAAAAAtiZ0NvbG9yVHlwZWVudW0AAAARRVNsaWNlQkdDb2xvclR5cGUAAAAATm9uZQAAAAl0b3BPdXRzZXRsb25nAAAAAAAAAApsZWZ0T3V0c2V0bG9uZwAAAAAAAAAMYm90dG9tT3V0c2V0bG9uZwAAAAAAAAALcmlnaHRPdXRzZXRsb25nAAAAAAA4QklNBCgAAAAAAAwAAAACP/AAAAAAAAA4QklNBBEAAAAAAAEBADhCSU0EFAAAAAAABAAAAAc4QklNBAwAAAAAEDQAAAABAAAAoAAAAIAAAAHgAADwAAAAEBgAGAAB/9j/7QAMQWRvYmVfQ00AAv/uAA5BZG9iZQBkgAAAAAH/2wCEAAwICAgJCAwJCQwRCwoLERUPDAwPFRgTExUTExgRDAwMDAwMEQwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwBDQsLDQ4NEA4OEBQODg4UFA4ODg4UEQwMDAwMEREMDAwMDAwRDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDP/AABEIAIAAoAMBIgACEQEDEQH/3QAEAAr/xAE/AAABBQEBAQEBAQAAAAAAAAADAAECBAUGBwgJCgsBAAEFAQEBAQEBAAAAAAAAAAEAAgMEBQYHCAkKCxAAAQQBAwIEAgUHBggFAwwzAQACEQMEIRIxBUFRYRMicYEyBhSRobFCIyQVUsFiMzRygtFDByWSU/Dh8WNzNRaisoMmRJNUZEXCo3Q2F9JV4mXys4TD03Xj80YnlKSFtJXE1OT0pbXF1eX1VmZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3EQACAgECBAQDBAUGBwcGBTUBAAIRAyExEgRBUWFxIhMFMoGRFKGxQiPBUtHwMyRi4XKCkkNTFWNzNPElBhaisoMHJjXC0kSTVKMXZEVVNnRl4vKzhMPTdePzRpSkhbSVxNTk9KW1xdXl9VZmdoaWprbG1ub2JzdHV2d3h5ent8f/2gAMAwEAAhEDEQA/AOXx3H1iQd21ljvpB40rsOu/bc1EHWMnfu9OqZ3RtPO6uz9796lCpdue4/Siu3u18fo7PzjttYq3homcMSdRsF3EQNC6NXU8kVOsFdZ9E1iNhOhbazc/3fm7UJvVMjaG7KyAAJ2nsK2eP/AINf8ARMjXbLqvn/PexCnSEBjhctOv/cpMpUNW1flPycffa1rSywABgj6W6zX+09KjKfjY++prXF9hBDxP0dtmn9piE0j7K4/8K0R/ZScR9laf+FcI/so8Iqq0tFnfrSZ3VMjaW7KwCCJ2nuLGeP8Aw7kW3qeSam2GusesbBGwjQNqZuZ7vztyz50hFs/omPruh1vy/mfYgccLjp1/7lIlKjq2D1jJ37vTqmd0bTzuss/e/euQM15lzidu6us/SDBrXWdNm65yB46I+W7a0n6M1Vd2sn9HX+cN1r0eGIOg3COIkal+gEkkk9apJJJJSkkkklKSSSSUpJJJJT//0OWpIdY4yHEV28lrj/N2fnO9O5qrchWaTuscZ3AV292v/wAHZ++G3MVYSE0bnyCTsnq/omR7N3uq110/nv0mn+agI1f9FyPdt91Xj7v579Hp/nIQ0148giN5ef8A3MVHYeX7UrSRiOjX9M3/AKlJxJxGzp+md/1KTZGM4Dn1W/8AUpOk4zQefVd/1KH8VdPohR7f6Jj+zb7rdddf5n9Jr/moJ1158ii2f0XH9273W+Pt/mf0ev8AnInePn/3MlDY+X7UPARstwaCZDSaquC1p/mq/wA5vqXOQTJRsw7RM7Qaqu7Wf4Kv9wOuegdx5FQ2foFJJJOQpJJJJSkkkklKSSSSUpJJJJT/AP/R5amXPJB3RXbrLXx+js/O9trFW1geSs0kOsdqHEV26y1xH6Oz98Mvaqw8O6aNz5BJ2T1z9kvgF3uqny/nv0iB80ev+iZHu2ndVpr7v579Hp/nIP8ArqiN5ef/AHMVHYeX7UrZOI6OfWb/ANSk6RiNnn1nf9Sk0E4jhx+lb/1KTgRiNHP6V3/UpfxV/BD80eyfslEgt91sef8AM/pEH/XRGs/omP7tx3W6a+3+Z/R6/wCckd4+f/cyUNj5ftQawfNHy5aCSds1Vay1k/oq/wA73WvQD4d0bLIaDqGk1Vay1pP6Ov8AcD73IHceRUNn6BSSSTkKSSSSUpJJJJSkkkklKSSSSU//0uWpO57jO6K7dZa+P0dmvu23MVaPxVmmHWOJO6K7dZa+P0dn53ttYq2kJo3PkEnZNV/RMjQO91Xj7f5736IXA05Rq4+yX+4Nh1Wmuv8APfo0ABEby8/+5io7Dy/amaP1V3Yeq3/qUnD9Vb3Hqu/6lJsfZHA8es2P81J0fZGgces6f81D+Kun0RcjXlFt/omPoG+63x938z79UEhHsj7JR7g6XW6a6fzP6NE7x8/+5kobHy/agj8FYyIDgSYBrqky1gP6Kvu3dc9V9IVi+GuBB2zXXrLWT+ir/O91r0DuPIqGxeiP1w+s7QLLeqWMYS0FxqqDZLtrtrjVt9rEP/nt9YtoP7XMkT9Cnna50fzf77WsWHmen9nMQHeprGyeXeDvW/zmKlyICZEEi+IriQOgeq/57fWDdH7YO3dE7KeN7WT/ADX+jPqJv+e/1i2k/tcyBMbKedhf/o/3/YuWEDQ690pBAjsncB/eki/APUu+u31ikhnWC53u2t2U6w5oaP5v86vc9T/54fWcMbZZ1SxjDtlxqqDZc7a6HGrb7WLCoLvsDR7tu/j37fpf9sKGUa/s2kbt4n6E/neDvW/zmJmt1xHet12lXQ2d3/nt9YtoP7XMkT9Cnna50fzf77WsT/8APb6wbo/bB27onZTxvayf5r/Rn1FyvIgJCBode6fwH96S3iHYPU/89/rFtJ/a5kCY2U87C/8A0f7/ALEj9dvrFJDOsFzpO1uynWHNDf8AB/nV7nrlpBAjsr+Pu+wsHu27+Pft+l/2whIEUeKW9bpGvQP/0+WpO6x2u6K7fzmvj9HZ++G3MVYKzS7c9x+lFdvdr4/R2fnHbaxVvDRNG58gk7J6v6JkDbu91XjLf579J7f3fo+799AH3o1f9EyNdsuq+f8APexCnSERvLz/AO5io7Dy/albH2V0/wClb/1KTo+ytj/Su/6lJpH2Vx/4Voj+yk4j7K0/8K4R/ZS/irp9EJ+5Ht/omONu33W+Mu/mf0nu/e+j7f3EGdIRbP6Jj67odb8v5n2JHePn/wBzJQ2Pl+1CVYyDteNds11fnNZP6Kv9wOueq/jorGQ7aZ+jNdXdrJ/RV/nDda9A7jyKhsUmWXHFjWA/jWOXeNbW/wDgqotIJgK7nNP2SYj9JoYju78/f/6LWeDE+IQx/L9Uy3Za+MpydNRCaZ76zolxydE9a3adpxGmG7t/MN3c+O/1P/A0+UXHDA1IDxprH53/AAbW/wDgqag/qTRx7+JP7x/N2bf/AARLMafsQMR7xDoj978/f/6LUP6Wv7zJ0+jTaQTATa+MqIMT4hSme+s6KZjXJ01EK5RtOKww3dv5hu76Xjv9T/wNUuOTor1B/U2Dj38Sf3v3dm3/AMETMmw810d/o//U5akh1jjIcRXbyWuP83Z+c707mqtyFZpO6xxncBXb3a//AAdn74bcxVhITRufIJOyer+iZHs3e6rXXT+e/Saf5qAjV/0XI9233VePu/nv0en+chDTXjyCI3l5/wDcxUdh5ftStJGI6Nf0zf8AqUnEnEbOn6Z3/UpNkYzgOfVb/wBSk6TjNB59V3/UofxV0+iFHt/omP7Nvut111/mf0mv+agnXXnyKLZ/Rcf3bvdb4+3+Z/R6/wCcid4+f/cyUNj5ftQ8BWLyGvGu0murgtaf5qv85vqXOVcyVZvJY8GdoNdXdrP8FX+4HXPQO48iobJrMUZFO0O2S8Ev2sPL9ng238/d7nqv+zdAfUOo3Rs/kus8f5GxWHHGYN9pES0OjaTq79J7GTZ/N/yEP7RibR7jMa+3vtd/J/0vpqKJlrV/YvNdfzYfsv3bfWOrts7P5bav3v5W9N+zDsn1ToJjZ/INv739lF+0YO76R27o+ieNzf5P+h3pvtGJt0cd0ae06naf5H+lRvJ4/wCKio+H2sxQ+qj0t+5jS5wMPBMPDf8ASel7t/8Aok78X7RQGh2wlzSX7WE/T9Pwbb+fu9z0xdS5hfW1+0lwZZsO2dw2e/Z6f0N6ROM1ofaREtDo2kyXfpPY2bP5v+Qm6+N32Tp+HdB+zdAfUOo3Rs/kus8f5GxP+y/dt9Y6u2zs/ltq/e/lb1P7RibR7jMa+3vtd/J/0vpp/tGDu+kdu6Ponjc3+T/od6dc/H/FRUfD7UX7MOyfVOgmNn8g2/vf2UcUPqp9LfuY1znAw8Ew8N/0npe7f/olD7RibdHHdGntOp2n+R/pVPdS5u+tr9pJDH7DtncNnv2en9DekTLS7+xIrp+b/9XlqZc8kHdFdustfH6Oz8722sVbWB5KzSQ6x2ocRXbrLXEfo7P3wy9qrDw7po3PkEnZPXP2S+AXe6qfL+e/SIA+KPX/AETI9207qtNfd/Pfo9P85B/11RG8vP8A7mKjsPL9qVsnEdHPrN/6lJ0jEbPPrO/6lJoJxHdv0zf+pScCMRvf9M7/AKlL+Kv4IT8UeyfslEgt91sef8z+kQf9dEaz+iY/u3Hdbpr7f5n9Hr/nJHePn/3MlDY+X7UGsHzVm+WuknbNVWstZP6Kv873WvVY+HdWLyGvGoaTXXrLWk/oq/3A+9yB3HkVDYpM1x+ya7tvqfy45d4t9H/NsVACVeyyPs8aTv8AKeXf8I53/gKotIJhDH8v1TLdQ9umpjVKZAjT4pR2+4Jy47RKetbdGwYrfo79/wDI3c/H11LLc77GJ3bd4/fj87xb6P8Am2JUFxwWiSW7/wCVH0v6np/+Cpskj7KBpO8eH8r/AIRzv/AVD+l/hMnT6NICUh7dNTGqTSCYSjt9wUzGqZAjT4q7j7BjM+jv3/yN3Px9dUy47RKvUFxwWCSWh/8AKj6X9T0//BUzJsPNdHf6P//W5ak7nuM7ort1lr4/R2a+7bcxVo/FWavdYSfdFduvtfH6Oz8722sVaNE0bnyCTsmq/omRoHe6rx9v8979ELgaco1Y/VL/AHbYdVprr/PexBAE66DxRG8vP/uYqOw8v2pWj9Vd2Hqt/wCpScP1Vvceq7/qUgB9kcO3rNj/ADUiB9kaO3rOn/NQ/irp9EXI15Rbf6Jj6Bvut8fd/M+/VCIE6ajxRrB+qUe7dLrdNdP5n2InePn/ANzJQ2Pl+1BH4KzkHa4Gds11ay1k/oq9Zbuueq0aKzcIdI9s116+1k/oq/zvda9A7j6qGxXziDibS4H9IPbI01d+aGb/APwRUJgELVfVVfT6Vlha3eCQHkH6cO9j3Or+g9z/AKCr/YMeAd7txE8t52udHH+kDGJkJgAg910gSWmCD31lLQd9O6vfs/F3R6jo3RO5vG9rZ4/0R3qI6fj7dHukCQJbzsLvD/SexO9yKOEsqWzhMdtH0/pbf5R/P3/+i02YQcMNLgfePbI0+l+aGb//AARF9GuussY/c0FxaIYSSHDb7w31Pc1znfSTuqqvoFVjyxocCQHkH6cO9j3Or+g5z/oKOxd/1rXVpXg5cwCE4IPfWVc+wY8A73biJ5bztc6OP9IGMUv2fi7o9R0bonc3je1s8f6I71J7kVvCWjoO+ndX6GzhsdtH859Lb/K/f3/+i1AdPx9uj3SBIEt52F3h/pPYjCmuuvYx8tBcWiGEkhzdvvDfU9zXOd9JNlIEADukAh//2ThCSU0EIQAAAAAAXQAAAAEBAAAADwBBAGQAbwBiAGUAIABQAGgAbwB0AG8AcwBoAG8AcAAAABcAQQBkAG8AYgBlACAAUABoAG8AdABvAHMAaABvAHAAIABDAEMAIAAyADAAMQA3AAAAAQA4QklNBAYAAAAAAAcABgABAAEBAP/hD2todHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvADw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVNME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+IDx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuNi1jMTM4IDc5LjE1OTgyNCwgMjAxNi8wOS8xNC0wMTowOTowMSAgICAgICAgIj4gPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4gPHJkZjpEZXNjcmlwdGlvbiByZGY6YWJvdXQ9IiIgeG1sbnM6eG1wTU09Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC9tbS8iIHhtbG5zOnN0RXZ0PSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvc1R5cGUvUmVzb3VyY2VFdmVudCMiIHhtbG5zOmRjPSJodHRwOi8vcHVybC5vcmcvZGMvZWxlbWVudHMvMS4xLyIgeG1sbnM6cGhvdG9zaG9wPSJodHRwOi8vbnMuYWRvYmUuY29tL3Bob3Rvc2hvcC8xLjAvIiB4bWxuczp4bXA9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC8iIHhtcE1NOkRvY3VtZW50SUQ9ImFkb2JlOmRvY2lkOnBob3Rvc2hvcDo4NTA1OTRmNy01NzllLTExZWMtYjFlNy1lMDA4MjQyYjRjNzciIHhtcE1NOkluc3RhbmNlSUQ9InhtcC5paWQ6NjllYTE0ZGUtMTFmMi01ZjQ4LTkxZGUtZDhlZjM3YWRmNTUzIiB4bXBNTTpPcmlnaW5hbERvY3VtZW50SUQ9IkI1QzBGMzVFRjYwMjg3MzY1QjcxMEE2NDdFODNBRTc2IiBkYzpmb3JtYXQ9ImltYWdlL2pwZWciIHBob3Rvc2hvcDpMZWdhY3lJUFRDRGlnZXN0PSJDRENGRkE3REE4QzdCRTA5MDU3MDc2QUVBRjA1QzM0RSIgcGhvdG9zaG9wOkNvbG9yTW9kZT0iMyIgcGhvdG9zaG9wOklDQ1Byb2ZpbGU9IiIgeG1wOkNyZWF0ZURhdGU9IjIwMjEtMTItMDdUMDM6MTk6MTcrMDc6MDAiIHhtcDpNb2RpZnlEYXRlPSIyMDIxLTEyLTA4VDAzOjQ1OjMwKzA3OjAwIiB4bXA6TWV0YWRhdGFEYXRlPSIyMDIxLTEyLTA4VDAzOjQ1OjMwKzA3OjAwIiB4bXA6Q3JlYXRvclRvb2w9IkFkb2JlIFBob3Rvc2hvcCBDQyAyMDE3IChXaW5kb3dzKSI+IDx4bXBNTTpIaXN0b3J5PiA8cmRmOlNlcT4gPHJkZjpsaSBzdEV2dDphY3Rpb249InNhdmVkIiBzdEV2dDppbnN0YW5jZUlEPSJ4bXAuaWlkOjM0YzhhOGMzLTBkODItN2Q0Yy05MTlmLTgzZDU5Y2NkZjdmNyIgc3RFdnQ6d2hlbj0iMjAyMS0xMi0wN1QwMzoyMTowNiswNzowMCIgc3RFdnQ6c29mdHdhcmVBZ2VudD0iQWRvYmUgUGhvdG9zaG9wIENDIDIwMTcgKFdpbmRvd3MpIiBzdEV2dDpjaGFuZ2VkPSIvIi8+IDxyZGY6bGkgc3RFdnQ6YWN0aW9uPSJzYXZlZCIgc3RFdnQ6aW5zdGFuY2VJRD0ieG1wLmlpZDo2OWVhMTRkZS0xMWYyLTVmNDgtOTFkZS1kOGVmMzdhZGY1NTMiIHN0RXZ0OndoZW49IjIwMjEtMTItMDhUMDM6NDU6MzArMDc6MDAiIHN0RXZ0OnNvZnR3YXJlQWdlbnQ9IkFkb2JlIFBob3Rvc2hvcCBDQyAyMDE3IChXaW5kb3dzKSIgc3RFdnQ6Y2hhbmdlZD0iLyIvPiA8L3JkZjpTZXE+IDwveG1wTU06SGlzdG9yeT4gPHBob3Rvc2hvcDpEb2N1bWVudEFuY2VzdG9ycz4gPHJkZjpCYWc+IDxyZGY6bGk+YWRvYmU6ZG9jaWQ6cGhvdG9zaG9wOjJkM2MwN2EwLTQ0ODItMTFlYi04ZWYwLWQyYjk1YzVkYTIyMzwvcmRmOmxpPiA8cmRmOmxpPmFkb2JlOmRvY2lkOnBob3Rvc2hvcDo3Mjk4MmM1MC00MDhiLTExZWItYmNiMy1kNGJkYzA2NjBiYjY8L3JkZjpsaT4gPHJkZjpsaT5hZG9iZTpkb2NpZDpwaG90b3Nob3A6YmIzNjFjOGMtNTZjZC0xMWVjLWE4ZjktYzIwYWRhYzdhYmY4PC9yZGY6bGk+IDwvcmRmOkJhZz4gPC9waG90b3Nob3A6RG9jdW1lbnRBbmNlc3RvcnM+IDwvcmRmOkRlc2NyaXB0aW9uPiA8L3JkZjpSREY+IDwveDp4bXBtZXRhPiAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgIDw/eHBhY2tldCBlbmQ9InciPz7/7gAOQWRvYmUAZEAAAAAB/9sAhAACAgICAgICAgICAwICAgMEAwICAwQFBAQEBAQFBgUFBQUFBQYGBwcIBwcGCQkKCgkJDAwMDAwMDAwMDAwMDAwMAQMDAwUEBQkGBgkNCgkKDQ8ODg4ODw8MDAwMDA8PDAwMDAwMDwwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAz/wAARCAMgA+gDAREAAhEBAxEB/90ABAB9/8QA3AAAAQQDAQEAAAAAAAAAAAAAAAIDBAgFBgcBCQEBAAIDAQEAAAAAAAAAAAAAAAEFAgQGAwcQAAIBAgQEBAQDBAYGBgUCFwECAwARIRIEBTFBBgdRYSITcYEUCJEyI6GxQhXwwdFSFhfh8WIzJBhygtQlJgmSQ1M0RCdjgzWGlldzk2R0hJSkRaJUtDZmR6PEdigRAAIBAgIDCgsFBwQCAwADAQABAhEDBAUhMRJBUWFxkaGxwXIGgSIyUmKyEzMUNBWCkqLCJPDRQiNTJRbh8UM1Y3PSRFTisyaD/9oADAMBAAIRAxEAPwCkOs7odR62TUw9T7fs/VgaRrTbhokh1bAMf/jNGYJScOLMTVS8ntw9zOdrsyrH7s9qPMb6zCUveRjPjWn70aMhndu3W7KRPoepOipC12bRatN30hY8CYdT9POB8JGtUbGYWvJlbur0k7cuWNY/hQ2sJPXGUHwNSXI6PnHV6VXciD0x3B2XepGv7Og1mpl2fWHwAj1wSMn/AKMpp9Unb9/YuQ4Y0uR5YeN+EfBRn7u7GXA/Ef4tHOYnfOku4WwwrNvXT+8aTSMvo1+SSXSn4TxZ4iB/0q2sPmOGxDpbuRb3q0f3XR8x4XcJeteXFpb+5yrQYXZdy1X852X/AIuZzFuGkLqJTgonjxHGtm+n7OXZfQzxt+WuNdJYD7stXqYO6UjpqX03ubFpGJRyAzCbVAk3PGua7luuB0+e+iJcd4VTE6PNXWdw7qdvOktj7Q9T73tvTG36Ld4Nn0bxbhAhV0kaaAGQNmvmIYgnnXOZHmmMu4+3C5dlKLbTTejUy3zLBYeGFlKEEmktO7uHP/tn6O2DrDpXqzVdR7Hpt4k0+8xQaabVqXkRPp43spJFhcnCrHvZj8Th8RbjZuSgnCrpv7T0mpkeFs3bUncgpNS3eI51pto0Ev3JP0l9DCuwf4q1Wji2Nsx0ywRxyMsQS/5RlFhVtfxV5ZL7ZSftPZp7W7WqqzRt2bf1H2bXibbVNylDon3MdLbD0js3R0vT2zQbJJuO5a5NXNo7xl0SCNkjb1G6hiSPOq7unjsTiLl1XpuaSVK7mlm3nuGtWowduKjVvVxG/die33SnUHbTpzeN76d0O8bhqNRrPe12oVnlkWPUSRhHYtcgAADwtVX3hzPGWMdchbuyjFbNEno8ldZu5Vg8Pcw0ZTgnJ10vjZwD7e9l0PU/cbW7Zvuij3jQQ7XrZ/odYWlivHNEqEYixUNhXTd6cVew+EjO1JxltpVW9RlPktm3dvuNyKktl9KF/c3smi6R6q6d27prQpsmll2IanUx6UlBLKNTOpdlubnKoF/Kse6WKvYjDyd6Tm1OlXrpRDPLNu1dStxUVs10cbLCd0+gOldg7S9Tb7tnTWh0e76badHJBroFZHSRp4A0ikNcEhiD4iuZyPM8Zdx9uFy7KUW2mm9GplzmWCw8MLOUIJNJad3WjUvtt6S2Pqvove9b1Fsel3bUQb62nil1sfuypGkML5AXOC48PM1ud68dibGKjG1clFbCdE6aay0nhkeFs3bDc4KT2nrW5RGp9sum9o3vvz3B2Hcdr02s2bbJN4bSbNOpMEIh1kcUYjW4tlU2XwvW/nGNxFrK7FyE2py2KvddYtvnNXL8PanjLsJRTitqi3NZgO/2x7b0p3G6Q2bYdvi2fbdZtmifW6bTXRZnl1ssTOygnEqACfAV792sXfv4K5O7NyknKjevRFPpPLOLFu3iYRhFJNLQuM7X396F6Y6W7cbxu2x9PaLatzi1236ePXaZGV40ebJIEOY2DDA1Rd2Myxd/GRjeuSlFxehvRVIs85wdi1h3K3BRdVpXGTeje3/Sev7M7Tv2u6c0Os3SbpfVa6TcGQ+68w08jLI5LfnVgCD415YzM8ZDM5W1dkoK7SldGzVaDPD4LDywak4LacK1pprTWV0+3DaNr6t65n2/etLFvmii2SfUnRa28kedJIQHtcer1G3xrqO9eJvYfDRlZk4y20qrepLQUuR2rd281cSktlvTv1RkfuM2LbekutNj0mwaKPZ9LJ0+k08GmJRZJjqZ1MrAH82VQt/Co7p4q9iMNKV6Tk1OlXrpRE55Zt2ryVtKK2a6ONndu7fbzpPZO0/Uu+bb05oNv3nTbboTBukCFJI3fUQKzq2a92Vyp8a5jIczxl3H24XLspRbdU3o1MuczweHt4acoQSaS0+FGkfbd0Z0/wBXdK9S6zqHZ9Lvk+l3ldPptTqgZJI0EEcmVCSLLcnCrDvXj8Vh8RCNm5KCcK6Hu7T0mrkeFs3bUncgpNS3eJHFtx2zTp341XTsMKafZF61XbotnQt9MNOdUE9kpf8ALlwt51frEXXlPtdp7fsq13drZ18dSqdqHx2xTxfaUpwV1HePuP6N6c6R6L23cdg2TTbHrdVv0UE2u0gMbe0dNOxjvmPpZkBI8a5/upmGKxGJnG9clJbDdG92qLbO8LYtWYu3BRe1TRxM2Xsd0B0p1F2x6a3ne+ndDu+v1EmuaXWzoXkkWPUSxhXObEAAW8LVo59meMs4+5C3dlGKcaJPR5KNjLMHh7mFjKcE266fCyv327bLoOqO4ev2zfNDFu+gh2fV6j6DVlpIldJokUgX4gNgb103enFXsPhYzsycXtpVW9R6CnySzbu35RnFSWy9e/VE37i9i2vpPrTpvbth0MWyaGTaNPPqINNdFllOslX3GFzjZQL+ArHutib2Iwk5XpuclJqr102UTnVm3avxVuKiqJ0XGzI/dxucz9xdlki1MqxybBF6Vcrw1eoHAYV49zJbWDk/TfQj07wR2cRFej1sr3qNVuB6QjZdVOkX182djK93YwqLYHEDzrrN0pYajH9IarXHcoCNXMQHBNpGAIytcHyrNkPUebBqtedq6lH1Mw/46MsRM5/ia4+FQiI6zG7Hqtwbd9MseumST3Uyn3HFjnXwNJajOJl+oNfrI953bNPqI2OqmunuMLHMbgY1CPNlmu/O4St217CRJq5Fmi2WS7ZiMW0OhPxNcj3cltY3GLen+aRe5sqYfDvfj1I67uPb7pNOymp6ih6Z0MW8joqLX/zLKfeGoGiEjTKwJ9bMbk241RRzPGfU/Z+1lse2pSujZ2qU5C0eCw/we1sLa9nWtNNaazlX2x9L7H1dB1r/AIi2iDfDoG2w6STV3kMef3zIq3IsGyi/wq67243EYf2XsZuFdqtN2lCtyLD2r237SKlSlK+E1HrDatFt33CxdMafTRQ7I2/7Np22KEsunaHULpzJGUv+Vg5uK3MtxV6eUO7KTc9mb2t3Q5U5KHhi7NuOPVuMaR2o6OOlTrP3H9EdO9K9E7Vruntm02x6mbfY9PJqtIrRyskkUzZCQx9N1GHlVJ3VzDFYjFON65Kcdhuje7VaSxzvC2LVhStwUXtLVvUZK+3PobpnqvoD+adQdP6Ledxj33W6cazVKZGMaRQZI2OYXCFiR8ajvTmOKw+LUbNyUY7CdE9FdJOSYSxdsVuQUntPX4DjPbHZdBu/fWfpvdNLHuOyrrt+gOzzEtAF06T+0AlxhGUBUeQq9zTFXreUq7CTU9mGndq6V5SswVm3PHOEopxrLRxVobX9y3TGz9IydI6fp3bdPscOv0Wt99dIDGXaF4grviQSMxIrT7o4zEYhXfbTc6bNK6dda8psZ9h7Vpw9nFRrtVp4KHW9f296Tj7JydQJ05oY93j6Lh1/8zyH3hqBolkeZWufWzHNfxqjjmmMeZq37WWx7alK6NnapTk0Fk8Hh/g9vYW17Otd2uzrOIfbVsOy9XdRdV6TfNBHvkWi2eGbTLqruIpDqUUuuIsxU5SfCui724q/h7Ft2ZuDcqaN6hU5FYt3bslcipJLd4zZ+pOmdm0X3K9KdKQbRpY+ndxi0jazYo1YaaQSQahmzLfEkoCfhWpgsdiJZNdvSm3cTlSW6tMaHvicNajmELcYrZaVVuboj7m+ltn6N2Xo6bpva9Ps02v1Wsg1EmlDI0ojiRwHOY3sThWPdLHYnEXbqvXHNKMaV36upOfYazahB24qNW604jpOq7fdJjsjJ1HF03oId5bomHcDueQmUagaIStOGzfnLHMTbjVWszxn1P2ftZbHttmldGztUpyaDeeCw/we1sLa9nWu7Wms177bOkOnuqehdbuG+7Fo951un6g1MMWs1kQkf2/p4CI7sb5VLkgeNbnevHYmxioxtXJRWwnROirVmvkeFs3bLc4qT2qaVwI5X252nSbp9wG69Mbltset2OLXb/Cm3S5jp1GmSb2giXAtGR6Rywq3zDFXreTxuxm1PZt+Nu1dK8poYSxblmDg4pxrLRuaK0Jv3QdN7d0dreio+mduh2OPWaPWvq00eZDK0LxBWkN8T6jj514d0cZiMRG77abnRxpXc0OvKeufYe1ZcPZxUap1p4Dte8dvuk4+yuq6ig6a0MG8joyDX/zHITMmo+iWR5VbMTnZjcnxqit5pjHmat+1lse1pSujZ2qULKeDw6wbnsLa9nWu7XZ1nLvtm6W2Tq7Tdbf4j2iHe/5fNto0TawmQxq4nMiriMocqL/CrrvdjcRhna9jNwrtVo9dKUK7IsNauq57SKlSlK+E5Z3U2+DYe8O8bJt0A0e2Qbnt0UG1aZmSBUlSAuirewDZjceZq2yS/cu5dC5ck5TalpevQ5UNHMbUIYuUYqkax0eBFkvuI6E6W6Y7dbtu2xdP6LZ9ZDu2jiTWadSkqxyzBDGhzGy2wtXKd2syxl/GwjduylFqTab4NBe5xg7FrDSlCCTTWlcZE+3Xobpjqvt/Du+/dO6Pd9zTfNfpxr9WpkcxqsORCcw9KFjYV6d6cxxeHxezauSjHYTonoq6nnkmEsXbFbkFJ7T172g4d2k2fQ7v301fTu6bfHrtnj1XUES7ZNmaEDTif2Sqkj8mUEeGFX+b4m9aypXISans29K16aV5SrwNmE8c4SinGstG5u0Nn+5fpvZ+jNy6Jh6c0Gn6fg3DRaxtTHowY/daKSEBnxNyMxt8a1O6OMxGJjd9tNzo40ruaHXlNjPsPatO37OKjVSrTwEjvDqtTB2N7BorvGx0fuSZZCP/AIGIkt4m5FMjb+p4zj/MyMyX6PD8XUVi0h3nddSkG2Jrt01DHLDBpRLPKSeBCxhmrrbk421tTait9unSUUYuTpFVfAb2e33XsEazdQiHo/SMgPv9RbhHoCAfCGRzO2HhGaq5Z1hm9m3tXXvQi5fi8n8RurLr1KzpBek1Hm18w02j6J25l/mvXu477qUNxpunNI6pfw+s17QrbzWM1HxOOu+7sxtrfuSq/uQr6xPscNDyrjlwRX5pU6ATrjp/bpA3TvQmnR4yT/MeotbPusjE8G9hfp9OvwyNT4DE3fe4iVN62lbXL40+dD4qzD3dpccm5Pk0R5j69/8AladXdR9U6fvgN91kUsGgk6c/luh02l0+j08AlG5l/bh06IBmyre+OAxrcwuCtYauwnV6225N033Js172JneptPVqSSSXgR9aa2zwCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/0Pm3N/v5yWzgTMVaw9RueXO16AQxcPmIHMlybtzw8aAiyJ+UWwLAFjja44G/ljQGb2jqbqfpycTdOdQbhsYABT6PUywKwH95FbKb87itfEYSziPewjLjSf8Aqetq/cteRJx4mb3tnc3ct53TaoOqum+nuq5ZtbpkXcdVt6aTXAtMiq41ehOnckE39ebzqvu5VC3CTsznb0PQpVjq82W0uShtwx0pyXtIxnpWtUfLGh0X7tpo9R3VZEGMPT2iiaY45isuqJYgC1sar+5rTwVV576Im13gVMR9ldZZTu7rvruy3WZlTGDatD7OQkqQ02nHC+Nrftrh+7s9vM7ddyT6JHSZtHZwc+yulHOvtY176fpfqbTWDLPv8futc5wG0sa38rcf2Vbd97jjirS34fmZo93IVsTfpdRyjTONJ91Us0agrB1hqygZjYWgmABJxq8vvY7v6Ny1HpRW21tZr9t9DOnfdRqPqenOgdSykTSblrlkuTYZYUAsOQ51U9xntXL0t3Zj0s3u8qpC2uF9B0f7eNbm7YdLbe6gwF9xLMpIbMdXK9ja1vCqbvTcrmVyD3o+qiwyWNMHCS330srX9t2sfSdzN2mjRcx2bcFGbgS2ogPDmcK6/vnPYwEaefHoZQ93o7WKfZfSib92TLJ1h01KhIafpxXdGu2L6mbHHmOHCo7kacLN78/yxJ7yaL0ez1ssZ3g1763sr1oxS0mn2rQ/T5GOWzzadb+BIFcf3dubeZ267k5dEi/zaOzg5081dKNF+1XXyx9Eblo3RQk3UUomKk5rNp4Fv+yrHvrcpjYR3HBdMjU7uQrhpP0n0I03tRrG0X3C90pIVW196jjViSLfXxYDHwFb+fz2Mlw9PQ9RmplcdrMbtfS9ZGL+5XJJ3U6EmQFc+2aCWRmJxLa+U2x58uFbfdKn0+6/Sk/wI8M9+aguBeszuX3Fa1dd2p32adcrrvG3opUnKFfUA3A5+Fc13Ont4+De5GXQXPeCOzhZLfa6TI9Baz3eyW1aB0/T03Rc/tFGNyyaeW2Y+JuMK8cwntZvOL/qr1kemEjTARfodTKp/a3rJNF3C3BlRfd/w5qY8rcrz6cm1uNdl33m4YJP/wAi6JHPd247WIfYfSjNfdfIrdcdPSKXQajpqNn9RJu+qnuMfLCse5NHhJvfn+VE94q+3j2etlje9GuGv7LdamZQnsaHQe0UJK5W1GnB+JAFq4/u3PbzK3XclLokdBnENnBzpvLpRz77VNc+n6R6g0wUZNV1CDIb+tQ2khXl4ceFWnfa444u0t+H5maXdyNbE36XUjh26SLp/uOlkQC0PXiGNXJsVXVrhmueFhXUW/FyTRuWPylLLxsx/wD+nWWC+6DUjWdutl1EikT/AOI44zlJtYabUHAcr3rle5MtvFTb17D6Yl53jWzYivSXQzb/ALf9X/8AJd0ttzqDp1XcMxQkG/1UzWPh4VXd57lczuQerxfVRtZNGmDhLj6WVm+2bWSaPuLu8iqvuHY9aiK9746mAnC/lXX99JuGBi1566JFD3dipYmXZfSjKfdMUl686akVCTL0/BK2YkkE6uYk424DlUdzNODuPfm/VQ7w1+Ij2V0sf+72KOLuF02wT0f4chcWGHq1mp9PzFZ9zklhZpee+hGGfut+L9HrZwTVR5ugdM4vaTcdQWwwwUD+qutppRTQehmB6MDR7tDk4kspDeBVqzkiK6GObFnXZ+qAoFn1cat8C5rGgg9JjOm4j/PNEVvf305XJGYcKm4tBMGZrq1UHUO+QlSx+rkIwxNxmte1QjBllPuEhRO3XYNsgLN048kh4Ef8FoBy8D4VyPdtL4vFv0/zSL3N2/YWF6PUjve7a36bsQdMij29R0ApnZySAX0AGF/MXtXGwubGcKK3b/5zoXHay9t7lv8AKcd+06b2NJ3F1JQmaL+V+1YmxuNQCD4/2V0Pfl7PsZbq2vylT3aVfaLi6zS+t5RqvuV0WolUH3uoNiWQITb0ppQRflf44VYZVLbyJt/07n5jVxq2czXaj1HZPun15k6G0eiIAhg6i04R2JLWXT6gE+d71z3cu5XHTjubD6Ylt3ihTDRfpLoZkPtn1Z0XbBp0UmY9R6uOxJyhckDYjh4/jXn31nsY2q17EfzGXd1bWHo/OfUcI7R+3L9yOoaTD3dz6jf0nD1LqTgwtwNq6fOvGyWNfNt/lKbLtGYvjn1myfdhuL6yfocuPbZNNuqqAcSrPAQGB+FV/cS5txv8ces2u80Nl2+KXUdz3nXfTdhG06ICmp7fK02YkgF9vUen5i9c5bubGcRit2/+ctnHay9t/wBP8pX37SXEfUfWupZGYQ7FE8RU2uy6lRbDj4cK6vvvow9p7036pSd3NN2a9FdJt/Uk6a37pOhJtQozywaGEqhIBy6fV435fC9aOXS2+796u/LpibOLWzmtum8uhjf3Zax9dsXSEJAUafdNd7dz6ypgQY3/AOjese4tzbv3lvRj0snvNDZt2+N9B1nctd9N2GGmiSyant+DJnJwL7eB6b8Dhe1UkZ7OcqK3b/5yxcdrL23/AE/yml/a5qjpO2m6ahFvOepZ47kkjKdPpziPAVYd95bGMi1r2F0yNXu5HasNbm0+hHJ+1kr6j7m94eRAsM249RMcjEAHLOwb8avs2pLIoN+bafQVmB0ZnLjn1mU+7DXya7WdDZ1WP29JuYB4kBpISCfMWrV7iXHOF7tR6JHt3mhsyt8Uuo711BrTp+xM2kiXMmp6BRpGck+p9AowJ54Xrm7M9jOIxW7efrst7kK5e3/4/wApyL7UpxBt3cTUrGRLFJtnti54suoWxHPka6DvzLZdmXBLpiVfdrT7RdnrOR93dSdT3u3idgoaXdNqLheREWmFwflV53elt5TB78Z9MiszZUx0lwx6EWi+5zWE9td825EBhj3bbPaufUSuoBsCeIxtXEd0Ln9xhBatiXQdJn0f0kpekukh/bLqvoe1cM8a5pn6i1qNcnLltC2I8uHxr176z2MbVa3CPWefd2O1hqPzn1HDezbLN9w2paQeiTW9RuMh9Kk++wsQa6nPdOTRrvW+opss0Zg+OfWZ/wC6rXPrtw6EaRVX2NLuNkFy1mlgtm+FvnVf3Fubdu/Xfj0M2u8sNmVvil0oyfcfqPQ7R2R7Cax+mNq6glXbVg00e7rLNDp3TRxEyrDHJGshYC1pMwFuFeuW2HfzLFxVyUEnp2aJvS92ja8B54y6reEsNxUqrRWujRvV6SuGv7qdf7hp20MG/tsO2Ww2nY4otp02XwKaJIi3/WJrpYZPhYvacNuW/Nub/FUqJY++1RS2VvR8VcxocxklZJZ2aXVOwEryHM73OBLsbnwNzVktCotRpvTpHRdVIABLYlTwNjwxoB3HKik5cQV8AR+wUB9lP/KTv7Hf27Y+70x6P7uG6igPsdQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQH//0aMarrDp3ctXqI9/7ebU07yMJdz2GWfaNQRmxJjDTaYn/wChgXqpeX4i37nESXBNK4uXRL8RvLFWp+8tLji3B9ceYS+09utyBfbertw6blF/+G6g0Pvwqxwy/W7eXPzaEU+Ix9ry7Ubi34S2X92f/wAifZYWfkzlB+kqrlj+4jL2x6n1sLz7Idv6w06AtHL09rodbIFPG8F1nHzjqFneHjou7Vp+nFxX3tMfxB5bdem3Sa9Fp83lcxpe4bTuu2TDTbhotRtEyghdLrI5IZDbC2WQKf2VZ2rsLsdq3JSW+mn0GlOEoOkk0+HQStihI33YQ5w/muiDAAE29+O/kMKxxL/lT7MuhmVn3keNdJ337rB7ndqUG6j/AA/tyA8OLTkj9tc53Nf9vT9N9CLbvB80+yus1jqDvt1f1D01unSGr23aIdt3eFIdRNBDMs6LGyOCjNMVH5BxFemA7q4XB31fhKbkm3papprwcJjis7vYi27clFJqmiv7zFdC92epO3Ok1el2bb9t1cOp1R1eofWLI7ByixWukkYsQt8a9817vYfMrsbl2Uk4qio1Sla6apnlgc1u4SDhBJpuumv7zXYeudzbrqbuI2m0R3iTcJtzXRhXOmWWZGRlC582WzXHq4863LmV2p4L4Nt7Gyo1/iovBSujePCGNnHEfEJLarXgM91z3a3/ALjaXadq3zQ7footkaXUaF9FHKsknuRhSGLyOOC8gK18pyKxljk7Tk9pJOtNziS3z1x+Z3MYkppKldVd3ws2Lo3vf1V0Tsei2fads2vU6XQpIFk1kUrO3uytKxYrKguC2FhWpj+62GxuIlfnKalKlUmqaElvcB74XOr2HtK1FRoq6610uu+aR0d1lunRW8aje9q0uk1Oq1OnlgMeqRyirK6SHKEdSDdABjwqyzXKrWZWVZuNpJp6KV0VW6nvmngsdPCXHcgk201p4R/uF17u/cncdFu++abR6TU6DSfQxR6JXRCmd5MzB3f1Xcjj8qnKsrtZbbdu0203XTTXRLcS3hjsbPFyUppJpU0cps/UPfPq/qXpbdekdZtuzw7Xu8McOp1EUU6zKI2R1yEzMAboOKmqzAd1cLgr6vQlNyTb0tU01W9wm5is7vYi07clFJqmiu54TFdB92uqu3m3nb9kg22eKfVSazUfWwPI6PIqoRdZEuLILDjxr3zTu7hsxvK7dck0tnQ0lSre89888Fm17CW3CCVG66V/qNdK9eb/ALZ1zunUu36XQ6nfOrtQ8EulmVhD7+tnSS0QEilQZAAMzGw41nmWTYfE4ONi45KFujqqV8RNadD3OAwwmYXbWIdyCTlOqo9XjPjMp3b3/rXX9Y7Lretdq0Wx73pdFpm23Q6UZo54ItVJIjufdlsS9xxFxXnkNjBxw04YWblByabeh1ok1qW5TcM80u4h3oyvRUZJKlNVKvhZI6x72dSdZ9PavpTdtv23T6GfVQ6pp9JFMsivFIJUAd5GW1xiLV55V3Yw2XXVdtyk2k1pa3eJIyxuc3sXBwmopNp6K7nhPdn79dT7H00vSsO37U2gTbG2wzTxTtMYjG0ee6ygFrN/dtesLvdXC3MVLEuU9qUtqlVSqdd6tNG+Zwzu9CyrKUaJU3a0pTfNC6J623Dofdn3faNPpdRrZdG2ikTVo7JkZ43zAIyHN+mOfCrPNsqtZlaVq62kpKXi0rVV30980sDjZ4Oe3BJulNP7cBL7idebx3G3TR7zv2l0Wj1Gi0Y0Ea6JZERkV3lu2d3ubuefyrLK8rtZdbdu2203XTxJbiW8RjcbPFzUppJpU0G19Qd+OrupumNz6S1+1bTHte7CKPUTaeKZZlEbpIMjNMwGMY4rwqry/urhcFejehKblFtqrVNKa3uE3cVnd7EW3bkopNJaK10eEh9Ad1eo+3uj1mj2XR7bqotRqzrJV1kcrv7jRrEQrJJGMoCDiL8a9817vYfMrsbt2Uk4qmilKVrup755YHNbuDg4QSabrprvU3zXNZ1Rr5utD1y2n043KXdv5u2kyMdN7+bOFCls2W/g1/OrD4C38J8LV7GxsV3aUpxV8Bq/FS9v7fRtbW1wVrU2rrbu71N15smj6e3jQbZpdDoNYusj1GkSVZPcVHTKzPKwtaQ8uNV+U93cPls3O1KTbVNLW+nuJbxt47NruMiozSSTror+8mdH98uq+iNp0Ww7Xtu1TaHRpKkUuqimZ2EkjSm7JKgJu5AsK8Md3WwuMxEsROU1KVKpNU0JLe4D0w2dXsPaVqKjRV11rp075pHSHWe5dC7xPvWzabSanWazSvpiusVnjyPIkpsI2QggpbjwqyzbKrWZWVautpKSlopWqTW6nvmngcdPB3HOCTbVNI5171/vncbedBve96XR6PU6LSx6BItCjohQStIGIkdyWvIeB4cqnLMrtZdadu22023p4ktxLeGMxs8XNTmkmlTRxnZPuvdD130vHIPeePp1DO9sTfVTYEDDle9UPcv5W5/7H0Is+8XvodnrZxnLm7eQC5yR6/UYE5b4G2J+FdgtZRReswXSUZl3qHIVXJdyAwa4CsLYHDjWTJeol7fEH2fqP2wsft6lHe2NwrE28r0MY6zGdLoH3vblGUN7qFWDqcc68gcaPUZpkjrEq3UXUTFSznUNa4OAyjz51C1nmyxH3BMZuhexjRORFLsLBEFgEvpNFexON643ux81jO31yL/Ofc2Oz1RNG1PfTq7VdKx9HzbZtC7Vp9p/k/1CxTe+YfYGnz3MpXNYXvltflW5/iuF+KWJ2p7Snt0qqVrtb2qvCeH1u97F2aRo47O7WlKb5hOg+5+99tIN5i2LRaDU/wA7SD6sa5HkK+wHCiP25Etf3De9bubZLZzNRV1yWzWlKbtK60941sDmNzB12EnWmvg8KMXrutd13LrGDrmfS6RN40+r0msTSIrrAX0YQJdC5ax9sFvVXthcrtYfB/CRbcKSVX5XjVrucO8YXsbO7iPbtLaqnwaP9jZeu+7vUvcLbU23etv2zSxjVxapH0UUiuJIVZQt5JXAFnN8K0cr7t4fLrzvW5SbcdnS1Smh7iW8bONze7i7atzUUq10V/fwkzo3u/1N0L08emdn0O2zaOXVy619VrYpmkDyZAR6JU9PoHL50zbu3h8yue0uyknRLQ1qVd9PfGBze7g4bEFFqtdNf3mlbB11u3S/WR660Gj0mp3aTU6yf2Jlc6cNrg4lGRXU2Gc5fVfxvW/icstYjCrCyb2EorRSvi0pucGk1bOMnav+2SW1Vvg8av7x3rzuPvfcmXbpN90ug0cu2++NP9EkiZvqWTNmzu97ZRYDzrwyjJLOWbfsnJ7bTdabldVEt89cfmVzGbO2ktmtKcJuOt759WarpKPpCfbNoj2uLaf5MsqRTe97PsDT5rmW2fKARha/KtL/ABbC/FLE7U9pT26VVK1rvaq8JsfW73sXZpGjjs7taUpv6zVO33cvdO3Gu3LX7JptFqZNy0a6N110cjqESQSFlyMljcczVjmuU2syhGF1tKLropvU3UzUwOOnhJOUEnVU08dSbP3R3nW9dbR3Am0ejG7bKsS6PSJHL9O/tpKgLpnLHCQ3s3hXhh8hsWMFLBxctiVat02tNOCm5vHpezO5dxCxDS2lTRuaK/vFdwe6e+dw9Jt53uDQbfBodTLqI5tHFIrZpI/bIZZHfkMAPjTKMgsZZOc7Tk3NJOrW5vUSJx+aXcZGMZpJR06K7vhZ0jfO4XczbO3OybfvXTu06DpzdNpi2naNwAZpZoJtJlR/TO1mMSlrlbX5cqpsPlGW4nHSuW7k3dtzcmv4dpS0rTHSq7zN+7j8XZwyjOEVCUUk92lOPXTgOfdE93OqugOn9T07sen23UaHV6x9ZM+sheSXOyojZWSRAFtGLC1/OrfNe72GzKandck0qaGloq3vPfNHA5tewcdmCTVa6V/qYHYuu976c66n690EGh1W7Tyauf2J45PpS+uVhMFRXVgFzHL6vjetvEZVavYRYVtqCUVw+JSm5wadB4WsdO3fd9JbTbfB4xJ677hbz3Hn26bfdLotJJtwnWH6JJEv9Qyls2eR72KC1uFeOUZJZytTVpye203tU3K6qJb5nj8xuY3Z20ls11cPhZuOt749Wbh0sOkZtr2n+WxbV/KRKkU3vGL2RBmLe7bOVAPDjyrSXdXCrFLE7U9pT26VVK1rvavCbLzu87Ls0jRx2d2tKU3zA9v+5+/9u4t502yaPb9YN99ptXJrIpGZRCHVfbySpxzm4N63M2ySzmez7VyWzWlKbtN9PeNfA5lcwddhJ1pr4DWOo+qtZv8A1JqeqtdDBp9YW0+oeCJXEGfTrGiizMTjkBNzW3gcBbweGWHg24pNVevS2+DfPDE4qWIvO7Kibpq1aKfuN16173dT9xNm1Ozb5te16TS6x4Z2fSRyq4MEnuJYvK4FyMfKqnLe6+GwF9X7cpOSTWlqmlU3kb2Mzq9irTtyUUm09Fa6PCR+iO9XVXQ/T79LbTt21azStrJdd7+pSVpi8uTMt0lQWGQWwrPNu7WGzK57S5KSdEvFa1Ku+nvmOBzi7g4bEFFqtdNd3wmt9Pdd7x0p1fJ1zt2l0U26PLrZW006u2mza4N7noR0bDPZfVVhisst4nCrDSbUUorRr8SlOjToNWzjJ2r3tkltaeLSSuu+4m99xJts1O96XRaaTbV1CwjRJJGG99kZg2eRybFBa1eGUZJZyxTVpye203tU3K6qJb56Y/MbmMcXNJbNaU4fCzsXd0Z+w32/XuHXSqt7Xw+lt/UKqMlf92xn7fxG/mHyNj9twqw8UmJEioDcXvxIPAfGuvpUoTcNp7fdY76vvaLpncJdMB69xkQwaTLxBaefJGB/1q0MRmmFsPZncinvLTL7savmNq1gr91VjB039S5XRGTj6L23QyOvU/Xuw7bNgW27bXk3nV4fw+3pB7IPLGWtf6ndu+4sTlwypbj+Lxvwnr8HCHvLsVwR8d82jnHpNd222kZtFsm9dXzJcPLuuqj2zSMbf/s+j9yW3kZRT2WYXfKuQtLejFzl96dF+EbeFhqjKb4XsrkjV859eP8Ayr+oI980vfBNP09s/Tuk0cvTnsaXadO8eb3BudzNLLJLLKRlFizYcuNbmFwrsVbnObetydeRJJLwI171/wBpSkYxS3l0vWz63VtngFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf/9L5uagr9bqiozIsj5yTYjEjlbjQDMlwjRovtIfURa1z43/dQEGNvaKsjmOZGHrRsjDmCGHCm5QHQdu7ndf7Vpl0p6m1G6bbb07Xuyx7ppbLy9rWJKoBHhVddynCze1sKMt+NYPljQ3IY+/FU2qrefjLnqZnaes+kd53bahvvbfbNPq312mI3bpzUz7U4k95MrvpmOo0zAGxICL8q17+CxFu3L2V+VKPRNKe5v8Aiy52elvE2pTW3bVarTFuO7vaUdA+6f1d1myEMX2HQE8bH9TUi9/DCq3uY65fo8+XQjb7wL9V9ldZXMEe8SozBBdyTYiw5HzrqykB/wAjpGvto3qOFrnDn5WoCCpAUoGsxPqANsCfhQHksT2WXPa1wrg4gYeHD8aAyGmMrQtc3sSQSeIFsbeXjQEgWtiQC4xPHnYfvoACgBmcgEkEX5/G/jQHmIZX9sFytvEA2PD4UBAm1d2dBdQtw5bA/tx40BtnbyNJOtuj3kIkY79t2VSbnDVRnEY1pZl8rd7EvVZsYP38O0ulHXPuemlXr/aPf0rabVx7JFYXsQh1OoII4Za5vuOqYGW/tvweLEuO8jriV2etnBI5DKCZltH/AApzx4k/E12Jz4NponBbKLqbE3tYcbnE0AhIUyLIgXJcX5eJta4vjQCpp4W9AVR/sMCBcWuaAYjMea0eIzZrgg4C/C+NAM+4yhZCuUBhnHMkcOHHCgJhnDRBhn9X/qxf0iw+NqAM6hYxkYgEsEwuTxP7qARkMoJuCpvlRiOfG/hagPGjChrqrNnurm5sp86AExliQnEzIFa+NiwAtUPUyVrLQ/dlBCe42wRadiUh6egOaRQPV9VqMQouMLVyfc1JYOdPPfQi87wNu/Gvm9bOGzOqdvNIA12+v1PC5FiK61aylitZr3STCXedO1wAHOFrYhW/ZWbG4SNsnGo2fqO4VDHrIrW5+o8axMY6zHdMzD+daBScFmQOQvH1LUy0IzWky/VsXvdSdQlWBA1ZIB4j0WBvytUI82WH7+rB/lz2AnjZi8mxsJkYAC40ehOBGJHxrj+7qSxmMp5/5pF9mzbw+Hr5vUirYAYrmVXUvihx9PEWtXXlCKENxe4UXNiTcqPgfhQHpbKCrgswNy4IIHIC/O9AKaS0t8rgtixHn8KAa1E93EasS2YFZCTY4nC4oBKMfWMlhGVNsLYcTQHiPAhz+m4xa5uRzHCgJrGPUZMijMG9TH05vG5uL3oBldLE8mQBWYWzAeBw+dqAeVIU4AAjBCMcBxP4UBA1M8jLkmUsuJexureDWwvRAt13ZzTdi+2bTaUw6fNtX0krY5l/lkouHA8uFcB3ejTOMVveN66OpzZ1wFj7PqlP/caF3UODYkKL3BHzrvzlifFP78RIjLDBSCOBwxB4YUA+oW6qQFUAWPPwt5UB4t0xJAtfKON743xoAAYNZMFUX44jz8r0BiNQJJZXR2wubx3uCOOPG9ALIeNgGkxU2uG4C3woD2C/uM8bW4lSMeVqAmNYq+SIB2OdlPpvjyHzwoBKWKxsmIAIYk2tj5WwoC3XX+v6Z2/sl2Ll3/YJupMu3q236FNc+ghDnSqWecxxvIykHAIV8zXC5bC9czTFq1NQ06Xs7TptPVV0XG6nS4yVuGDsOcdrRo003N3dOCJ3V3XQ5oukdh6f6JjX8su1bekurv4nWa06ie+PFWFdK8pt3PfTnc7Umo/djsoqFj5w93GMOJaeWVWabvXUHUW+z+91D1BuG9z3/PrdXJPa/grkgfACt6xhrVhUtQjHiSXQa129cuus5OXG6mI0+EheMhQPy28q9zyJjYqxWICR/U38IPjh+4UB9lv/ACkip0nfnKbkSdM5vjbdaA+xtAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf//TpBqtf203SbUnUdO7z0nqjKzPLtWtTcNNmubsNNrFSQC/ISmql2swteRchdW9NOD+9Cq/Cb6nhZ+VGUOy9pcktPOQj0hsu42/wz1/sm5sxOXQbt7uy6snkv8AxQMBPwmxqHmV2176xNcMKXI/hpL8I+Dtz93di+CXiPn0c5h917e9X7LEdbuHTmth0K4jcYI/qtMQ3AieAyRkfOvfD5thL72YXI7W8/Fl92VHzHldwN+0qyg6b60rlVUajdL+3kW68SCLjDnVhQ1Sbs+Vtz2qMra+v0twim4vMlyAK873u5cT6DO35S410llPuwihg7rpDpWzIOn9CxVrmzGbVEcf21zPc2KjgKLz30IuM/beJ0+ausrVgcxW/IlSbEkDlhXVFIRjqB6gUuFY5ieY/qxoDz2YyPcWyKDe54+eHlQHtiAqZcuFy3McbXHOgPYw8ZchFLgXDsMwAA8BQCZJXuHWytp2uFKkFSTYfKgIo1GrMplytZgMxA9OHwwoCWurKLeQFmS+UcAaAWgXW+qOMJMjqXkYEBvL9tAbp2+j9nrvolcilP57tgcgWxOqjwDDn58RWlmSrhbvYl0M2MJ7+HaXSjsH3ZaZYO5u0SPH7sE2wadslzdsk+oS7NxJ9Nz41z3ctUwc+3+WJbd4nXER7PWyt/vxxG3pUNHmjIWyi4/KfA4411xQnsUiNASfyh7hT5HGgEGaPKY8xUKbG17i2Bv+NAMnUoyYwkxgXVgALnnfieVAJElyjKbkCxFuB52oB0xoRmZ/y8DbC/8AVQD0MRETOwGY/mW1yePn86A81J9tA8bgiT0eBw/MD4UBDkfBSRYi4uDYX+QtwoCXCTI1rlwoFw2OAuLWoBKlTNG8SekSxkE8gHBHG3wqJanxEos79187HuHsMzquWTp+IWAvgNXqMRbhxrke5Tbwc+C4/VRe94VTER7PWzgeqnB6IjhLfqR7jMwF7ABowwrrt1FLDUzD9GOo3SIynNicouPzFGsazkRuMXsEsTbT1QGsSdXGIyGvY5jY1iRDWYrp2S296Is11E6H8w/vAVNzUZQM91JqQ+9b5KvqE2qlMbkXwFxe2HhzotLPNli+/TyHt32FhyKfa2R7AWJ/9z0Qrje7TbxmMb8/80i/zdUw+H7PVErHFkMbBFs6EFm8vI/G9diUBDkkLZMxJwta/wA7CgF+4Q6gelT6G5kiwBHLnQGQEahljDKzD0s1rqD4X86AgmEZ2jYhV4pYXubY0B45yqRfMDxBF7EfGgE+8gaxVpSFwIGOa3nh4UA4upRnzEGN0sWVQQPHlywoB+OWNnDYEg4kcLrxtcedAN/UpHJPm9XjhcsRYgAfCgGdUY2iX9MNMyhllGBW+Fm8TyogXQ7wac6X7e+0keUGZhtfpuct226Z75eGY5uIrhO78Us2xP2/XOmzV1wNn7PqlNzoyxRwqBLq0q2scL4WH4V3ZzIwNZFYxJEY4+CjgR48f3UA1LqdS2b28xzHCwN8Od6Abjl1DoulcDKMQrDmATj8vGgJwlaQOcokQ3LsUOIwByk+FzQDAQqM1uB9KfPxGNAKMQkIBtHmAYA8MOOPlQHmZIDlVPWTdsMPMUA/FJ7uYi6hWJBJww4UAoEi2QflxzHH1X40BZ7vRBpk7Jfb1qIizvLtt5TYkf8AuUPHwtXIZHFLM8Y1rb/My9zJt4TD8XUiqgK3dioON78L4435kV15RGQ2/atdvc66Tatv1G4amXBNPo4XnYkHwjBtXnevW7Mdq5JRW+2l0mdu3K46RTb4FU3Ve2nUWhQS76+19HxP6vc33XQ6WS3+zpVMmoY+Xt1WfW8PPRZUrr9CLa+86R5zc+nXY6bjjDtNJ8ml8w+m3duNucfXdV7n1RKhvLpti0X0mnBHIarX2YjzENPb4+75FqFtb85bT+7DR+IezwsPKnKb9FUXLL/4n16/8rPcendbp++EXTvTT7BBp5OnDPNqNdLrtRqS43OxkZkjjXLbAIg4m/KtzC2b0Ku7c2296Kilxa3p4WzXvXLcqbENmnDVvj/0PrVW2eAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUB//U+b2qVpNTO8jZSsrNcC4sSbC/LjQEJ4xmLZRIOJH8IGJuQLfKgJm179v/AE86arYN2120TXGOineAHiMQjWPzFeF/DWsQqXYRmuFJ9J6Wr07TrCTjxOhu8fdPe9x9mPqbY9g60jWwk1G7bdGuqI4G2r0f08/zzGtD6Pat+5lO12ZPZ+7LajzG08fOfvFGfGtPKqMzO16vtbvG9bMp2Dfej9zl1uk9p9t1kW66FpPfQKrQ6xYplUm1/wBVsPGsL8MdatypOFxbL8pOEtW/Gsfwoytyw05qsZQdVqe0uej5ze/uwkL93ZPcUBl2TQIIwcM3uagkDgefG1aHc/5D7cuhG1n3zP2V1lb2V5LGRsuQ5gwGFvI8r11BSjDJ6gwX3BxIHAc7kC3yxoCOxcKGVc3A5bC3MHxoBxZR6AQGIAvYn8w4AHyoCTCyepiRio4YEgC5GNAeyRyu5likCnKM8fA5Tyv4EUBIiUxxkekxPf0g8b4W+B86AR7UWVIyRxu2NiAeVziMaAitPkCKlowlwQq3YC543OJ+VAZ/oyTUt1d0iQwRzve3JDGhIJY6lCpsPwrSzL5W72JeqzZwfv4dpdJ3jv8A7Xqt77p9D7Nq5zpZN50Oi0SamTM/tfUbhPAGykg2UkkiuU7m3HYy25OWnZlJ8kU6F33girmMhFaKpLlkzj/cLosdAdXa/pV9zj3l9BFppf5hGhjWQ6iJZQMhZiLXtxrqcrx6x+HjfS2VKujXqdClxuFeFvO03WlNPGqmlz2zksDmF+OAB5DA1vmqQXVC3usVU2KZb5gfDHmMKAkJHM59vMEOS4uc2NuAA4H40AldMYmUvJaRhgjcbA/HAYUBkJUJjhZLZyA3lbDE0AoKyqQ4AIkYAjgRfCwOPOgI8qLKmQMXiZmN/Frjja3CgFywgp7XteggtGQb2Ycb4+dAMYrCSi2jNsV/p50A3J7akHNY5hhbC4I8yfjR6gWd+6WeOXrnpmVkWx6cQgC4Nvqp8T51xvcmVcJc/wDY+hHQd41S/Hs9bK/a7236RikJPuDXTrBZb3HsqWBPEAYWrsd0ooajE9H47rpw11BcZcozXazYG4Fh51mxuMVsQUbR1MfUttdHlsoNzdrA+APOoREdZidjEbbtpVnukRkT3CgzH/eLyIFJajKJs3UDp/NN6R1BZdRMABwUBiLCkdw83ulg+/0yP0Z2MjOVBHsBsV89LobHHyri+68q4vGdvrkdBnKpYw/Z6olaU9Lxe36jc35XI8bE12Zz4LGolLtHmeIXZRxLXwv4UA5NDZklK5ZlBOZTf1fjQDwy5mGa75yWXgASL4EcMKARJHIWJKhU9w3HBrKBYk8LUAnWotwmcIoW5PkbgeAoCMulliDsH9CrhmxB8ALG/HxFAR5VLgLKwHuKQr3DHE+IoB1MoBTKCqghQCbnnwwtQEtgrRrcHLchCbXBwFr+VAb71D25O0dtOlO4n86i1KdU6ltOmyiMhtOQNR6mkz2N/Y5Acaq8PmkbuNuYXZo7aTrXXWm54Tdu4J28NC/XRN0py/uO094frh2b7XCZ5EgYbSInZmIBfa2ZRfhgDfCuT7uprOMVX0vXL3NmngLFPR9UqcJ5gSHIXgAUANwOZOHxr6AcqS19uUtKQoZcvqXAEAY+k3vagJKKqvI8ds0gspv6fhfww5UBFkgmZ3COqs9zKwPFeOIva1AOKURFQtcKtw/AEXsRQEMuFFrAlcQBcAHH8b0Ay0jMy5FzLgCRiVI5UA4FLXXIWItcgeoX5ix+FAPiIMAuYEj1ZQL3t8LX+NALdmw92xF7ITgcfHHnb5UBcTuCOl5OxPYjUdWzbsuj0uiy6bT7OmnabUSHSLmSSXUELGoVb3Cub8q4jLnf+p4tWVGtdLlWi070dfKjo8WrXwdh3NqlNFKb3Dq5yv8AN1j0ptUaDpbtrtedMpXX9R6ibedRwvm9r9DSg3/+bNdF8DiLnvb8uKCUFy+NLnKn4m1DyLS45Ny5tC5jC7p3P683eP6Jt/1G37c1lbatqWPbdMo42EWkWIEEeNelrKMJbltezTlvy8eXLKpjPH35qm20t5eKuRUNLyl3cuhllazPL/6w+eYE+POrGu4ag+kQKqvuC4s1gL3tyoD7Of8AlKl/pu/YbgJOmMnja26jH8KA+xdAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf/1aNajQdtdzk1S7b1HvfS85kc/Sb1o49fplJPBdTomSQAeJh4VUu9j7XlW4XV6EtiX3Z6PxG97PCz1TlDtLaXLHTzCz243vVl26b1u0dZQGP0HZNdFLN8G0cvtagH/qVH1qzDRejO0/Ti6fejtR5yfp1yXu3GfZar910fMc/3LZN32uV9Fu+36vaNSpu0OtikgJwsCBIFva/GrKxiLd9bVqSkuBp9BqXbU7TpOLi+FUIka+ywCg5IrBy3HgMB5Y3r1PMzeyOse97C9riLcdEVyeA1EZNvGvLEe6n2X0M9LXlx410ncPurVT3cnkgDLE+y6FocP4RJqAbk3Jrmu5rTy/R58uhFv3g+a+yusrnF7tjDe62uWPAEjCwrqikJQki90IpJDIVBthfHDLz8qAiHTynNHexvcknAgDj8v2UBHlhyMsSlgEF2zWHK5+N+VAeoPSWwsVu9uHMXw+ZoBZQ5142JNgDfAfIXoCazOiNK73K2AW+IuDgD8KAh4SMks36akAekYXAGPDmTQCDeN0PtswUhjcWJ8cceHKgNx6EaGbrbpBC9g/UO2jJwIU6qM3JPifCtPMVXC3exL1WbGE99DtLpRZn7g9Ztuh739udVq5kg0Wmh2zVS6qZbxpFHusskkhIvdQAWPwrk+7MXLK78YKrblThbgqF7nDUcbbctCVK8FJM4H3i3na+oe5O/b1tWuh3bQamDRLDqoGbIfZ00cbAZgMQVI+NXXdnDXcNl9u3ei4zW1VPjbK7Ob0L2LlO204umlcRzghWiyXDH0l83IccTzq+KsTHCChRnFlICk42t5eV8POgJemGmCyxqSzKxJONz4+d8KAdbSxOyMFy5eITAWPO3Lh86A8QWR8zMUjcWLAAnE8R8eNAJaeysHQOFlYIScoItcHmMSfCgIcc74JY2dgzMvn8fGgMgroT7ijNmJDA4cDjmoDzUDMoCi4JtYXFja+I48aAxkasdSitGbSOigjAYsBa3ne1Q9TJWstF92a6ZOven4kIVo+n4kkgjIKBjqpza+GPiDXI9y6fBzp576EXveGvt49nrZwLVwRN0XFqCBnOvmjUHkFjAwPx41126ilhumJ6LjWTdIlayG5YHEYhWIFZyI3GK6f08Y2nqhiVXLq4yBcm/qItx86xIjrMV09Gkm9aRHVSjTICCDb845GpnqMoGc6kjji3vdoczKItTLGr/AMXE2/YeVEebLHfcAsH+XvYjUQIsgfY2jLgjOWGj0N1cDgRa9q47u3RYzGL0/wA0i/zevsLHZ6olXdMrjIWQ3BFuPE+JrsCgMo7KFtYG+DMMD/YaAiyzCMARXYxvYqOBJHA/10AxDOAxLIGzMGW7Y+f4486Amoxkchjlb3mCfBcLknxoBr6cahX9wvctYggWA/Zc2thQEgRwoQSoAtdiMSfMnAHE0BjVjgdzJG38ZuvHHy/pwoBCR2lDkhiptxvYDDA+FAeyZCWsMylbqb2AtcYAedAds3/qXp/UdiOg+nE3bS6neNl3F5tXta52nijYa45jmAFv1VB+Irl8BhL8M4xF6UWrcopKW42tn9zLrFX7UsvtW1JOUW6rdWs7J3vEH+RXaKTMVkB2ospsLhtqcXynkQKrO79Pq2Jfa9dG5mtfgbP2fVKWPKjIUQGSz5hKL2KjAEeZAtXdnMhkUoc5ZGYAogXifICgH4XcSLpmCqAAobhexwJvxoDzUB8i5mZwvMeHMD+qgGsrAgcXN7Y/DwAHH/VQEZlJwUj0qGtexINudAS107XWeNiMLuWwN1JxB/ZegH4x7McryBgrAhFGB4+PKgFFrqjxWLqtmUi2OHA/uoCJ62bOzEq/qfgbAE/DCgLU91WiTsP2D07Kwm+nLzHFRl+jXLfl/F4Y1x+SNPNMbv1/MX+ZfJYfi6isMhJBChfcYC4/6N8DXYFARBp8zpMjGN72IJ5qf4eZta1KA3jZegOst0hk1ul6c1se3spI3DWAaLTAHmdRqTGgB8b1XX83wll7Mrict6Pjy+7GrNu3gL9xVUHTffirldDKN0fsG3GE9Qdwdp08yqff0GyJJvOoU4WBeL2tOD4fqnGvH6jfu+5w82t+bVtcjrL8J6fCW4e8uxXBGs31R5z66f8AlYN0l7HfNOlv5zNll6cOv128HToZSRumT2oNPmEYWzXzOxN+VsdzC/E6Xf2OBRro43LXyI173sdCt7XC3TmS1crPrdW2eAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUB/9b5xatANXqSc2Uu2ZlB8+IoDFlc7qIxbU5rl2xKkcLYXHyNAbxs/XnW2zxHRxdSazV6Bcq/yvXlddpbX/8AYaoSIB8BVdeyjCXntStpS314svvRozbt4+/bVFN03n4y5HVGebrDpzXqR1H222jVOP8Aea/ZJptm1OPE5YzLpyfjFXn9PvWvc35LgnS4uV0l+Iz+Ktz95ajxx8R9ceYVtml7Y7jue1z7R1XvPTOsXWaaSHQb/t66yEssqkIus29iRciwLQDzrC9extuEtu3G4qPTCWy9Xmz/APkZQt4aclszcXVaJKq178f3HQvuqlZ+6sLNH7bvsOivGTdg3v6nEVWdzXXAfbfQjb7wfM/ZXWV0ZVD3YEqV9bKDwtfEV1ZSEFruciXM7t6s2Pw5XoByKAoze5eRgAAD5kC44WtQEuWANIZGA9CkNm4DlwwB8KAhHAMEcsqglxbh4C4tzoByPORmwBPpN7gi1uFvjQB7alVkYBlV7KD8MbcaAcaZVxZGUMt1B/vWwH7KAYEDS3kAsVFyi4Wub3tQGx9FQEdY9JnLa++bfZ7DiNTH/XWjmnyl7/1y9Vmzg/f2+1HpO6fc85HW3TqoUkfT7BCLEXAY6nUNY3+Nc33H+Rl236sS37yfMrs9bK2BMv58XJBvbjxNq7I58HFpGYWUN6gQCQL8RQCg8CgEjJw9djY+BNAIieRXkKoAeGIBwAvcc6AedJC6FZMoJLHJib4CgHCjBGBIZseNsDiATjQEGdJ1VWULITYm4FseOPjzoAWSb1WUEkYITiQ3mcLDyoCVArxqM3qZrk2/Nc86AZmky+5IASqPe3LjbhwIFAeupd9NPlKj3Iywsctwww8+FQ9T4iUWE+6WHUf5gbKZHLO2yRPcm1z9VqOJ41xvcZNYKdf6j6InQd5PmI9ldLOUSxlu3miZmzSfX6kkD4ca7NLSihju8RgOkk9veNOj3PrwN+eVsKzkRTQPbVA+n2fqMyjF9ZEY8f8AbOFYkR1mP6ahLb1oGJIVpkPI5bMuNTLSjOOivET+tI3PUu+hWvGuqJWx/wBkedRunmzvPe6GYdvuxsbuSG2hmjUcr6PRXtyxuK4ruwn8bjnubf5pHRZz8thuz1IrlI2V4tOEI8WxUgjE3wvhXaHOkiJrxsLG+Y3J4C9uJ/bQEZhNE7gWCSD839248+R4UBHLTuUCovqNyfAHAWBx5UBPijdXAYg3FwCACGP9gFqAJY5CjFZCBe4C2IJAvQCmMkYKjKwNyxwPEjHHhagI0ToFIkGT1EILXLWuLigFEpwjGQc0ANz+PjQHoChIwwF75j88Mp+VAJyyKjLYGNrHEYgjAWvepQLb967Tdm+1kisJF9valKgfxLtsikY/Cvn3d3/ucVxS9dHU5t/19n7PqlRE0rNdQpXiSLcK+gHLCkdYbqwvcDI44lsBj44edAOvklyI0ZuSGDPhxP770B5ZlZxcEgkNe9j54GgGfWHKLxQEKQL3tx50A6kKTB1Vs7MDicCLeFrWtQD8kQ9uNCt1sQG8ML3woCB7MsYWS+aO9rMLnhhxFASIshEgQOV4RjE4Ei9z+FAOSWjROFiLY8AfP4WoC3ncPS7Jruy/YxOoeox01oNLtsciuujn182qc6OIFIYo8igqMSXdRwrhssvXoZli/ZW9tuW+opaXrb6kzpcbbtywljbnsqm9VvRuf6nB4tz7Xbc2Tb+m986xnQXOq3zWR7bpjzuNLoM8pB8566V2sdd8q5C2vRjtv706L8JT7eGhqjKb4Xsrkjp5xyXuPvelAXpvbNm6Mje6h9m0ESzrgcTqp/enNvEPWLyazN1vOd1+nJ0+6qR5ifqFyOi2ow7KVfvOr5zne6bjve8S/Xb1u2s3mTMLy6+d9Q3lYylgPwqwsYe3YWzbiorgSXQaly7O66zbk+F1I0OQhvbD5QP0wLnwvj5V7GB9nf8Aylly6TvuOH6nTOHhhutAfYmgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/16Qa3pDY9bqNQ/TPcPZ9a7SsRtu7pNs+oxJ9N51aBjywlqpeZXrXvrE0t+FLi5qS/CbywkJ+7uxfBLxHz+LzmF3PoPrTZoTqN26b1y6V7sN00sY1WksOBGo0xkjP/pV7WM2wl57Mbi2t5+LL7sqMwuYG/bVXB031pXKqo1MIiGRla4U3c38Mb35VYGoMGQyFWUkxlcxJPI48/OgMjshvvWwRlcG3PRqCxtdjPHwBryvuluXZfQzO35a410lkPu2ObvCSQGK7DoAoHFLy6prEnGzE3rne6HyP230Its9+Z+yusrNI5VmyMcbFsMALG966cphtHzMyS3EpY4KOFreFAOe0EZ3BJtizHC/O9/iKAYeQy29u7Iy3uTa45jlzFANAsuBDBgCAgJW2HO/7aAfMnoDrlaMNiAfPgeXHlQDskatGuOQqylbjx/1DhQAHEIVZGC3NnPnbxoDwpHfMjNfNlycgaA23oYJ/jPou9jffNtObwvqo8bGtLM/lL3Yl6rNnB+/h2l0o7h91KCLr/ZQCxi/w/Fla2IB1epsBywrnu5apgpdt+rEte8TriF2V0srC9yyKTmcp6FJxIwthzrrihGQrZlVjly8bG/MYEHnQDkQLsVVgLH9MsL+o34XoBE0uaSFlBuoIwAscwtYigJDM2QvEMgSwMePLCw+FALRhKhZVBa9sgJJDcKAamyWs7gJh7lzYW4YGgGQ6rKFUBr4IoNxgOION7eNAPq+U5sVK5r4f18aAQHIUi6uCBlAsMGuCf67UA5EjIkAjYyZHVsx5Wa+IFQ9QLJ/dtB7HcHp4gkmTp2LI5IFj9VPf448+Ncj3MVMLcX/kfQi+7wut6D9HrZxggx9vNOJLEnXajLxC4A4AjHGuwWso47pgek2jj3qENEHLXUWJNiVYg+o4cOVSydwmaArHs/UWdBJn1KKtjexLGxx4fKoMY6zF9LlF3vbmKrYyJYBmN/WuABJFS9RmiR1irr1Hv3uHMjTsMt8pPpFr1CPJlke/OneHt/2EUHNfYmaQHAi2k0Iwt5Hnxrju7S/VYt78+uR0GcP+TYXo9USrxASZ2zZzJYMDYBbf6rV2BQHiyGzBnxdQTlGNj40AmSSyOxX0XsWPLzwoBC+2cjZgJbmwJs1uJwvQE1RfLYZl8TyPEeGFANGRnlEcRACn1SAm39PCgGNSQUyBSt7K7qLnje3woB8sZluCqqtsCAfUTgKAi2zoSWIe/q5cvHlQHtmys7ABLWvm4eIvwvQEkk5cSWLJ+mOKkY/h/bRAuJ3qjRexnadmJd2Xarqw4AbW5Fv28fGuDyBUzfE/a9dHT5o/0Fn7Pqsp26qWtmIVrG4JuL+dd4cweB4oRYP6i2UE8zhw+FAJMWeRMzARlhYAc+YoD2UkMgVPW5uG4eNx4m96AYkkBLC+Yj85RrWva1/KgGwJLlwDa1s3C4vYj4440BLRxLaME57Astz/ABeHyoAyxwxhizW45f66AbSSS5sf085ykAXtfH8DQD3pMaCxkviVIAvc8CP7aAtL3ob/AOQL7dnJV7aMIHvYH/go1Ax8AvCuTyX/ALLFrh/My8zHThLHF1FUCWJcgFX53OOGDWNdYUY8j+5aO/6gUMQSSLHCgJ237XrdxlGn2rQavdNSScuk0cLzueV8sasRXlev27Mdq5JRXC0ukzt2p3HSCbfAqm4/5cdT6MqeotRtfRmmkbNGd81kWnny8/8AhozLPzvYx1W/WrE9FlTuv0Itr7zpHnNz6ddiq3HGHaaT+7plzH18/wDK023YNt0ve+LZup16nmeTpw6+eHRTaTTxm255BG2oyvJf1XJRbYcb4bmFvXrtXct+zW5WSk3v1poXKzXvW7cKKE9rf0NLwV18h9aK2zwCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/Q+auoYvrpM4ytnkDILfluTjyJxoDL7RvO7bFqPf2Td9bs0jE3fRTyQZiMcShF/mK8b+GtX1S7BSXCk+k9LV6dp1hJxfA6G3HuTvWrRU6j2vZesIgQrtuehQakjy1Wm+nmvyuWNVyyWzb02JTtdiT2fuy2o8xt/UbkveKM+0lX7yo+c8Ot7WbsR/MNh3/o7VEevVbTrIt00qngf+G1ixSgeQmNZezx9ryZwur0lsS+9Gq/CRt4WeuMoPge0uSWnnMrsvROzT75smq6b7i7FvKxbhpJRtm4ibZtayJPG7KI9Wvsu2GASY35V5X8wuRtSV6zONYvTGlyOrfj4y+6Z2sLCU07dyL0rQ/Fevh0c5uv3aajP3fcLIc69P7eXKggk5tQbYg348K0u6DrgF2pdRsZ98z4F1lag5aWLMMjLcZRb8uOJ8fwrpymJa5Q4/hViR8T8TQCjI+UXa4VsVF7m/HwoBmxaS7qb29Ki3p8vnQCJcsgYZ7G5Li98CMSLcMBQAGWxUKt2wzWN7f20A2WCgqbkNcM5xsOVjYUAFy6x5mJcAgE42HGgH9PKiqMr2Jv6uRv4ADDhQG09BzMvWHR7IWLLv23EA2uWGqjPE3rSzP5S72JeqzZwfv4dqPSjvX3GwzdQ90ektm07KNbu22abQ6YyOFiWSfWzqmcgMbXOJsa5XufiY2stu3Z6oyk3xKKZdZ/Zc8ZCEdckkvC2iunVWwbj0lv25dN7xLA+47a0fvvpmZ4fXGsi5WKqfysOXGurwGOt42xG9brsyrSuh6HQpMVhp4a47c6VW9ymFBDsWtcA39scCbcTcftvW4a55G4DABbY+sA8xY/KgJDey+I9NhmCAWynAX54Y0AyspaaMZi2HpUX438DQEwLGqlsSMCtgDfG/lwNAQ5HSQIWBILkAHHECwuaAQpSMsuXLzBW4x8jy86AkubgjIQw/Kz4EmxPHDlxoAkNy7nGwuSBw/soD0u5VRC2RAyBlPHiALYCoeoIs392pVuvunVdcf8ORkKCCPVqp8R+Fcl3N+VuPfuPoRfd4PfRXo9bOGayVV6B0iR3yjcNRmFvFQb11qelFJBaGa90axfdoCvrYE3/wCjkYc69GRuMc2Qu2z9T+nMBq481+QDmsaiGsxvTcpG+aLKSSJ0yi3AZhyqZvQZQ08hnerzC/UW+MQSW1ElyPgBfH4VC1nmyxnf15W6E7BNGwUtsLsGJuTfSaE3Nv2Vx/drRisWvT/NIvs402bD9HqiVbZldgACWsc2F72PLAV15Qir4RhspUcvMkYeYoBDutlLIy+CEekkYcBxoCMBGFDlbMzAg2xzX53oCdG6OzRnMMhIDAXAw5C/n86AbnyxxsRdTgcLYHgMflQCFZZABIxOVQRa9hYXub/CgFyugT9MXYY5wLXvcD8POgI4ytmypYA3DrxBB+dAJMijLj+QkkgE5j4+dAbhquj940XRO2de6mXTPsm8at9DoIo5W+qEgMoJdSgUC8Tfx+HjVdazSzcxksIq7cFV6NFNG74Ubc8Fchh433TZk6Lf3dzwMsr3k1rTdku1iBiYkO12f0n1fyyRQLVyHd2dc4xS3tr10X2axpgLL7PqlQkmF5ruVBIUhuF+fCvoByxFdkZ3IJtxZTxx8SKAU0p9wm5ewAjU+GA4fKgFKQpLfmHDI18B5YC1AJKq7KQQgW9wOGXC9APEq6HAsuLYMDe/ny+dALRnARSTckD3PLmPlQDjOSrMzC97A8Rc4YgigI01hEw9SkkZ7YHlc/GgGjK5sbmNQMGWwDAW8jQFz+vtmbqPsJ2GiTeto2PS6PQJLqtdu2qXRxIp0uQiMENJIx/uxqxtyriMvxSs5ninsyk26JRW09e7uLjbOjxVh3MHZ0xjTdbpuc/gK+NsnbLaBbd+tNz6s1IF20PTm3/SwG3I6zcip5cRBXR+3x1zyLUYLfnKr+7CvrFSrWGh5U3Lgiqc8v3Hn+MOmttKL01272+FlIEe4b/qJt4nvzJj/Q04I8PbIqHgL9331+VN6CVtcumX4ifircPd2o8cqzfJojzEPce4nWm4wSaabqPUaHQ2y/y/bMug0wHCxh0yxKR8b1nZyfCWXtK2nLfl48uWVWY3MffmqObS3l4q5FQ0WYKEkY3Ejm8r/wARva5JON/nVkaZ9mP/ACkGLaXv3gMiydLhGHMBd1FAfZCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/0aKantfvc82qm6e3PZes4WdiU2fcYn1AxwDaXUGGe/kEqoedWbfv4ztduL2fvR2o85vrLrk/duM+y1XkdHzGobttO77FqRpt727V7PqFuDptbBJASPIuBe17YVY2MRavqtqSmuBp9BqXLU7TpOLi+FUIYI9lyli6m9zbCwsLHH8K9jzImXFFVgypibX/ADcTc0BN2nMd22dmNimv0rEWAU/rp+63nXnf93LsvoZnb8uPGuk7/wDdSsh7pQvIqpNJsWjZwt72WbUrmw+F65buU39O0+e+iJc94l+q+yusresYDAMSWkGKXNhyALV1pRktjYp+oMDYr5cxfxFAOKQYnygM62NjbADhY42/roCGVLZVU5snrkKXJva5J+FAKcK7uQTkYZlbAkXw4kUANhJYMRf8xK4kLzuPCgEPjls/5QM+BI52Fv23oD0Q5wGVgqg5jc43+HlegJYXL7amzHKMF8rny/DnQGwdFad2606TZ5FjY75tyqgxxbUpcgDhWlmabwl2nmS9Vmzg/f2+1HpRYbvNp2h74dtpZZ0bKu3tLOzWVAu5Shi5Nhh4muI7tx/smJS0vx/UR0ebv+42W9Hk+szj/e/J/md1HJFKk0MyaJo3hZZUsukiGDISLgg3HKui7qRccstJppra1qn8TKnPWnjJtOuroRy3MyDKTd2AzZcOJvXRFSRM5VyM+Ki4Y4cL0BI+plClQyurWzKwGN7fj40A/FOGVI3KqQxu7CzDOeA58POgHZplMjRot4Y8ozrfLlI+fGgFTiME+5H7ZiLBOBVwbm2Py50AeyrCy+kKAUIviTw+NxQEeXUsryMma0j3UjE8bXHhQDyKzRXYiPKwsqtcHDD8QaAchU/U6bKbj3o86mxRgXF735252uKh6nxErWWb+76OSPuZsoZDGX2CIInG6nV6nEW5E4Vync5NYSfbfQi7z9/z49ldLK76uWWPo+CFsYX105S+BBEQJBBxN66vdKaGpmN6QkaPc4AvpLvlFz/eVrjAVmxuHmwTOu1dS3sA2tiRhcm92bDh4isURHWYzZJTDu+lkC3YSoQL2v61H9dTPUZRM31J7v8AON3eU3dtTKJGAOW9z8rCoR5ss938ilTtd9v11MRbZnyy4Zyn0WhsV8L4Y1yPd1frMZ2/zSL3Nfl7HZ6kVXVMxSzlMQ1uZ8j8a64oiPJNJFJiMGJFwcwNr4n50A9GBKgVs2aNmYg3xLAEY+duFAeOkJIWT05xdmAAJxANr+OPKgHJGNkcQFHZyBGOJUAXFvjQCWmjeCKVinuPdXja4uMbX4igIj6qT3Wkjygu2DEWC3GIX8PCgGZJma5Mg/vHlz+NAewOQM1yQ2FsQBhzFALbMLEG4Iuth8iT+6gO+dTrH/y89C6YTwyTrusryQLIhmEZfWkExqSykAjj4iuOwMJf5BiJUdNhaaaP4N06HEtfSrSqq7Wrd/iN+7vaN17K9sVfUqI2O1qFFyELbW5I+NV3dtf3jFOujxvXRtZu/wBBYr6PqlUY0eOM+4AQLHOLG/I3PP4V9COUESws5Q50FlBGP93mThQDDLZgqnK97nicb8L8qAWWAXMslgApxF7C2N/G3C9Ae5AVX82F7JYDHjiKA8ILRoqktInre1yADwOHD+00BIgxlBGRlPqYcbEYflPHDzoBLsuOV8ouAGOJyg+GN6ARMARmJzW9IKnEXthYeX7KAj+3ltYlkwYE3Atck4YnCgLRd4EkHZbsLCQscQ0AaF0tjfRRMSMR42rjsibea43j/My/zPRgsPxdSKwkM4bC3BkwxufG1r12JQEiD/egjI4IzOvgVPgb3w86A8kZLlUkClmsh4ki98Fxv8KUBuGh7edabvDFqoOndVDoXB9vc9dl0Gmt/wDbtU0SHDwNVt7OMHZlsu4nLzY+PLkjVm5bwF+4tpQaW+/FXK6H2H/8q3ppem9P3zibqHZ971Ook6bOo0+0ao6saXKN0sssoUREsWNsjNwN+Ve+FxXxFXsTilqcls14lWujhS1nlfseyotqMnwOtPDq5D64VtngFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf/0vmxq4wmtldgAwlfIDY8L8DjalQbltvXvWW0adtLp+pNZqdCBhtWsK63S5R/CYNUJYxfyFV1/KcJfe1K3Ha314svvRozbtY6/bVIzdN56VyOqHz1f09uUbf4l7ebVqXewk12ySS7NqD4nLEZdOx8vaArxWW3rXucRNcE6XI89JfiPT4u3P3lqL4Y1g+bRzC02jthu7Idt6s3npLUuMq6TfdvXXaYECw/4vQN7gHxgrL22OteXbjcW/CWy/uz0fiI9nhp+TOUO0qrlj+4mbf2t6ln3DbNTsGr2PrPRx63TvLNsG4w6mVIxKmd30kvs6kWFyR7eFYXc3sxhJXVK26Py4tLV5yrHnMoYC45JwcZqq8lro0PmN8+6aVZu6oAUZNPsekSOVSCGHvalgbWOBB4VVdyv+v+3LoibveL5r7K6yuzJlkUmyE2yg4qQB442rrSiHvbT1u3qLY5QLW4HHljQDBsY3ZkxtbKTa/Ll+6gGQjNiB6MhTKPhbEnhQHoR1weNVONmPG3PCxv8aAeiGFic2YALbGwtjxoBLpYPwsDcEWBIPPzoBWnBYyoGUELmJPj4C3nagJUXue4b3X+6B4/CgNl6Nmii6z6VX22N972++VScBqI/wASK0c0+UvdiXqs2cH7+32o9J2P7pXiXrnpto0DD/D0SyAixN9TqDdiBz53rm+49PgZU8/8sS37yfMqvm9bK22PrVUUWsWsAB8sByrsqnPjwjDHPawvaxAGHLlhh50A06RDOVKBwD6cDh+296AZbTI7XWO5SzFgbAsQDQCpoAr5s2OBUnAWA4YcwTxoA9glszHMGN1twuQTbzvQCZ7yRxCQBlB9I44DjywtQD4WWQI6gJkWxIxFuK/2UBDWB1H6hshBGe2HjiKAkLljVSJM2Q+lALYm+JItQE3TOjPG1goSRGKnDgwNQ9QRZv7wdUJ+5HT4Yh/b6fiyEA+tfq5ybX8jXKdz5Vw1zguPoReZ+qXo9nrZXPWySP0hGkYYRHWzfUE2xPtDKMeNq6vdKaGpmJ6PDLukLKLXcKwW2K2OBvWbG4e7C0v8p6mGVlza6PN+XEEtcfOoREdZi9hEse8aRtPZZVkTIRb++vjcUlqMome6kkjbdd0OUoq6iUtmHAAm6/jzqEebLTd/dT9T237AByoaPY5CFxwA0egW+PjXJd3JVxWL7f5pF7m6pZsdnqRUx5EdsmKAn8/wOBt5V1pREd0DMzK+d2FrKLE3wwoBUUE/6gDWZgLLbwuPxtQHk9mkjuir7dgjcbDhcixoB2RWmJ9wXK2CgHG5OAJoBloiAiO4tfPfEH+lqAW+kzJGti1rkC4BGOAthc2oD1Y48LBI0ZWLg/HxN+NqAfWKMraPKbkWYW/dj+6gE5SCoUfkJ/MARb4njjQEeRgsVhEoMoyk2xA4EGwF6mpBcXvNNBF2Z7V5EYn2dpvlX04bbICbrzr593ep9ZxXFL10dVm1fp9n7PqlS0sYmaO6rjytzuMDwr6AcsNKsmUsxVcikm+IPiPDxoCFGM7KbjHE2th40BIRQqlmHG4KqBw5eHE0AwQQTfK9hiCbAi/jjagE+1IM5ye2WBClRfDzHMcONALjA9wKyi4UqWuR5/0FAPRhWLK6GyjA+P8AXQHkiKiZM4y5vz2FyL2w/CgEvHZFVl/hNhfE44X4240Bbjr/AKZ6g6y7Ndjl2DbBrJNv0C/zBmligigi+jhUSzTzPHHGpZSBc1wmV42zhszxjuypWVFrbdG9SSbOmxuGuXsHh1BVotO4lo4ThZ6E2Ta1c9UdyNi0Lp/vNv2FZd+1QJP8RgEemU//AEaum+oXbnubE3wypbXP434Sn+EhH3l2K4FWT5tHON/Xdr9rkRdu6c3vqyeMZRq971ibdpm53+m0Id7HwM1Q7OPu+VchbW9CO1L709H4R7TCw1QlN+k6Lkjp5xyPuRvukZ4un9v2no+ED0ts2gijnt56qb3dRe3MOKj6JYnpvOd1+nJtfdVI8xP1G7HRbUYdlJPldXzmm7vue6bxIZ963fVbxOx/9610z6h7XHAyFrfKrKzYt2Vs24qK4El0GncuSuOs22+F1PsV/wCUkhTS9+QR/wCs6Zsedrbty5ca9TA+xtAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf/TojvXbjrfbG1ev1HT2p1u2tI+XdNvKa/TFb/+20rSoot4kVXWs3wlx7PtEpb0vElySobc8Bfgq7La314y5VU0UyXYD/cyk5ZQcCCDY3HEGrHhNQbb1SWzXbw5YYG1+NAe5gvqJLlgbfLnQGQ2CGL/ABB0+7P+XdNDdlGIX6iO+PwrxxLpan2ZdDPSyv5keNdJ337rmgHeWV4QQkmw7Y4KglRjqL2+dc73Pp8AqefLoRbZ/X4rT5q6WV1ylmka+cH02JtgRw8vjXUFKDObKf8AdOTlY/D/AEUAhwTIFLXPLww8KAfib02ALMwxPl+7lQDcjAt6CPy4x2uTyufHGgG4kW8a2ZUzZmJ4mxBsP3UBJsgsQyPlK/pA2NzfG9AJn1KB4ywS+Y+6obEC1r4WsLcqAWJmEgtcxyetTxNjwHDyoDbuhWP+OOigxI/7925iMMf+Jj58q0sy+UvdiXqs2MH7+32l0o6r91Usb9x9pWA5VXY47kkWVzqNRe9uPgK5vuS18FOn9R+rEt+8afxEa+aullcVjkytJjIpF8Bbh5j99diUAJZleJmKtgwdsMSf2W50AIxVFQrn9s3UefxtQEnToFIcOsbMCxvwsbW/DjQCJFeWVnaQZAL5/Pn8BQCpg0aqFcnEZjfGwFuBoBIyGNFx9IxRRwH/AEvHCgCFo1d8xsipgCOZ+VALaSMlHWUEx4kHlY8bcKAjSJEzPm4gfwnNxoDxUfMiZy/qUBRwN2Ao9QLW/dpCIuu+mUDM7t03EwzEY/8AFTgDDxrke5saYa5wz6kXveB1vR7PWzge4RZehdKR/Hr5y3lZQpx+VdbuopYama90ZdN1isBIrFkIPDFWxr0khXQxew+jaOqMsYu+rjW9uF3PD8KxpUiDozF9Np/35orEE++ma4/2hfClxaDKHUbN1XEI9+3jjl+okJPiSM1rfO1FrPNlh/uHh9voTsJIrvZ+n2OYngDpNCRa1cf3ajs4nF9vrkX2cOtmx2epFUvbDHNKxNxhblbE3rryhHlKe0FDKit6uPgPxFqAkmSFg6iTM2WwPHG18ONARY8rWY5i2GYgXw+HOgPWc+6rI182Ulx6bjzv4UA5LFcemTGxyqcfO4v8aAcQu0BjaZVOX1DiceNjx5WoCKQsbFVS6Xzq3McbAg/uoDxBmlMzsBbgvnbDD4UB5GHkJyh7OMwv/DyoBicPHG6s97DFPym/HC3gKlAub3dlik7B9rGjP6mbbPecWPq/lsgIw/fXAd3Wvq+Jp6dfvo6jNl+gs/Z9UqM8rIpIB9WKg+fwGFd8cuR5ZwkahvVK5D2JOUKSP2YcKAkNIkoRVyZM1llzAj4/6KAYdUMeZXDMtmDLwOBBw/dQDIADSFQUzYsTY2+Z8aAlowygr6rL+oy8DfmBx50BGexJYGyixscOP7aAVmZUW8hIJylTxPyoBZBdiAmVR6Lk+PH40AyzBYQGJfKb5BjgDyPzoC0XdqPTN9vn29RAn3RpA0wsSSDpT+a/IWFq5HJWlmuMpv8A5i+zGrwViv7aCrahY7i+YEfwi1hw4fOuuKEUwsD6rhLE8v6XoBWcqgPuYA2IPE8+FAZXa9n3jfpxpNj2bWbtMLKE0cEk5u3G+RWH9leN/E2rCrdnGK4Wl0npaszuukIuXEqn2n/8rLpLf+ldL3vj6g0ibfqNZL04YtC2ohlnQINzv7sUbu0d82GcC+NuFeWFx1nFV9k9pLdo0vA2lXwGd7DXLNNtUb3KqvhS1eE+tVbZ4BQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQH/9T5zabcdftm4Sanatfq9t1BmI9zSzyQtcMTcmMqfxNeV6zbvR2bkVJbzSfSZ27k7brBuL4HQ3Vu5HUWuy6fqPT7V1nBeztvehinnAHIamL2p7+fuVWvJbEdNlytP0JOK+7pjzG2sxuvRcUZr0knz6Jc4htx7a7ip/mHTW6dLTsP/etm1ia6EW4n6bWgOOHBZvhT2GPteRdjcW9OOy/vQ0fhHtMLPyoSh2XVckv/AJCz0T0/ugU9Ndx9l1ErkZNs32OfZZ7ngM8yyac//day+oXrfvrElwwpcXNSX4R8Lbn7u7F8EqwfWucQO3XXuwbxse4a7pbWPtSbjom/m2jVddo/TqEOYarSNLGALcSw86l5phb0JRjcW1svQ/Flqe5KjIWCvQkm4ulVpWla99VOpfdoGXu3I8MKoW2PRekXy2E+psQMMLHjVV3Pf6D7cuhG7n3zP2V1laFObIbMWwTKxOJviT4fjXUlKSGQM5TAhm9R5+eAJBoAfKoFgqixAvYn+v5UAkJc+4Gs+UWUfw+Nr+INANTK812VmvGAQlrEX8fHCgGEhmbMMgX1AghgCbY28R8qARFq4jIPcQXPoWYE+niBcf2igJEmmEjrMjDKDY3HO1hz52oCWiLHjlsSMpk4gXOHEW8aA2LpCD3etOjje6/zvb1YLzvqo+Hy8q0czVcJe/8AXL1WbOD9/DtLpR2P7mNJqtX3N6f0EMUus1Wv2nTxaDTwR53kZtVPGsYRcSxbAWrm+5TjDATk3RKbrXVoitPFQuO8ScsVFLS3FU5WcA12163aNZLt+5afVbVuMIGfQ6lWikjFgQGVgDiCDjyrrrV6F6KnCSlF6mnVFDctytvZkmmtxkYwEyyuZDHG6jIMCQwsTa2GJ5V6GBHSdY0khLesNZXtc3wxF/HzoDyJv0/UFNwfbTkTwseHjagEvE6yXkIVW4RgcTfyoD3ESsgNx+Yrwvc8BhQEprKBchWBxJN/9VAMLmbNmBBvZGYgAi/H50AlcwLekFSLW+A8bUAADgwCn48OWPKgHF9y8WSwvKhNuV3GYVD1PiJWtFq/u+mWXuJ0+FssUHTcATLiRfVanAkWxrle57rhJP0+pF1n6/nx7PWzhMmabt5pgbsY9dqCQMWOBt+6usWspomv9JxOd6gKKVAuxDYenKwIHnjWTJeok7dBbZ+o/ZQrbUxtJm5gMSbVijGOsx3S8JO9bcAjKwlQhmGH5141MtRmjIdWv7vU2+i9wdQ2RcSPyioWs82WQ+4Wdp+3X28OoUuNgcT2IsQNHobA+Hzrku7z/WYtb0vzSL3NV+nscXUiqJ/NdrE3uRwN+P8AVXWFEJW63IQcPS39XxF+dAexr/eAsCVYXAOIPwoD2Mm9n9GIsrWxFuI/dQC5rgZl9Ixs2bhhj40BGIvEpzWZzdWIxBtaxoB1FaFbShQCDlk53FjwB8qATHL7UzmQj4cQTja/PzoByECYyy+6VBzBFtgeX7uFALEftQossjKUDe8wYDMeXDHytQErW7Huml2aDfdRtmuTZp5fY028GFvYlf1nIkpAS/ob8D4V5QxFuVx21JOa0uNdK41rPSVmagpuL2XqdNHKWl7v6eR+xvasu3rJ2327AWVW22RlB8TXC93or6xiqb0vXR0uat/AWa8HqlV7AKUtnJBQRj8xNvmeVd+csRJ9L7oVI7LmIyA4/AUAmR4NNCEYe6fy+2Lrc3ve44UAxEzajGNQFgt6Q2FrYDG4oBSQSs2VlKC5JKHD43oCYCZFsWLKBdjlyg+Q4cD+NAJwSyXVgFsGIvfG3PnhQDjov5woLJYW5W+IOGNAJdQEX+6WIYjkT4WP9VAMBpM6qgJVRZy3qxHMf10BbjuntG7bv2O+3vbdi2XVbprm0wMen0cEmpmI+hjUMVjVsLk2NrVxmVX7drMcZK5JRVdbaX8T3zoMbanPCWFBNum4q7hxAdq+pdFHDJ1Trdm6GQ2zjfdwii1XC+Gig9/UfjGKvvrFmXulO72Itr7zpHnKz4C4vLcYdp6eRVfMJbbu2W0so13U+69XTKCWg2fQLoNM3K31OuJe1zxEN6h3cfd8m3C2t+bc5fdhRfiJ2MLDypSm/RWyuWWn8IHq7Y9ts/Tfb/Z9LNFb29dvDS7xP/0v1SkCm/hDUfTb1z39+cuCFLcfw+N+In4y3D3dqK4ZVm+fRzGN3nrvrHetOsG4dR6xtCrZV27SMNJpowRYhYNMI0t/1a97GVYSw9qNuO1vtbUvvSq+c8ruOv3FSU3TeWhcioj6y/8AlJZRp+/qgG4k6XzMTe5y7riT41YVNU+x9AFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf//V+e2/dP770/rZot/2XX7NIZGYHWaeSC4ueBdQLfAmtfD4uziFW1OM+Jpnrds3LXlxceNUMIV9QuCIxc3Ficf4iMK2DyEplYYrhnIBJwGN78jjQDZDXIYY2F6AzXS+7bntG+7W+x7rq9pmbWadZW0U0kJYPMisrZGUMCOVa+Ls271uSuRUlR60nucJ7WLkrc04trStTpuljvu5fT/5uw5HV1Tp7RZlAAAtPqrLa3AWqg7ouuCr6b6EWeeqmI+yusq2v8JP8YLBxYGw5W5V05TCyvqAIIjxJtiTfG9sPjQCEytcEenPgThbG9+V6AWoKgGxMvNgRYcsfG9ANlJAiNbAA3FgBYYczz86AX7j+4wZQoJIVgcoIN7fjQEVkjnfNKlijlgHAOdTdjawF8RQEon1RsP1AylghXAG1hhw50AtSsi5fzFgA5uCThhYgW4UBsXQyFutOimylTBvu3NGCbDHVRi9yL2rSzL5W72JeqzYwfv4dpdKLO93ZDB9wHayYITNE+2ZcmN0/mUuIbyJri+72nJcSu36iOjzV/3Gy+z6zOLd+UY92OqXlZcpfQl1bAi+jhF74CxJwroe63/W2vtesypzv5y54OhHJ2kcG6IAzr6VvexJx5c66AqiMIxM7ByU1IxlCG+a98fnwoDwI/uMjBmjjA9PPA4j8TQD6shCCI+s4Djhc2FxwFhegGGy/wC7HoZD6iDc/jzoB1Y3DMMShxIIsRb4UB4q3uLEnxwwtibHEUB64FhcgkXstrYDmeQtQDJV8zuGAABOQ42tcWJFASYbBoSRbK6WHA4MLH5eHOoep8RKLN/d28cPcTY8c5m6ejIKhQo/4vUEg254k1yfc1Uwk1/5H0IvO8Drfj2etnEJSsfbzSKHDZtfqbhv4hbjy4XrrVrKSO6a/wBJHNvMDRWjUsQxU2uMrHKeHOsmidxknbZhLs/UftD2surjD2Ns12NwfjShEdZjOmJEXetvAyRssqB2HL1Lw/CktRktJkesXSDqbf2OZg07+leVlHD41C1nmyyfftVTtz2CQMGvsjscACp+i0AGYA4kDCxrj+7i/V4x+n+aRfZs/wCRYXo9SKpOrFiFsuHGx4C1reNdeUJ4gsAGPDH3BbDhyHhQD5AvcjMq8FHC3mSLk0AhFazFQWZf6sDQCGjKhSzNxJOAANAOIQQZFGWNiAwGOPG9vjQHj+25JiBJUBgwNwBa9rnE0A2kJkQSSu65cJGGIw5fKgHIpHVT7aA6VgQgBuSbYnyxxoBx/Wsa2T3AVIYm+bmSLW5CgLGdSPJH9sfQ2ncmSKXf3ZnAGT0y7gS1vC1chg1//oL7/wDGuiBf4j/qrXaf5jbu80fu9je1sZW0efayozWYKm1uVJBwHDGq/u8/7vivteujazb5Cz9n1So6XLtIyENYAFsePlb5Cu/OWEu4yuEF1AGTgcpDXuLWtz40A3qIoZQqSMpyWb3GHBSbEAmgFRSHI9kMd29KEhSb2tgB4AUAEyOgGQKcSLCxyi3G9vCgHLOrsrKWXAEDAm2PmOdAeZRe59S3GQE2ON8ePjQCBZg5Gb3M2Fx8MTwoBwjKCzDH8xU8G5XOFAeKVXOjYH0sv5cB4X86At13l3fcdD2G7BRbTvGq0MGu2oR7lHpJnhEyrooGWOUxlcwBJsDhXH5TZt3MyxW1FScZaKpOml6ql/jrk4YSzRtVWmj16CniFGvIliznNI4BuScTe+P412BQD6A2BZbg2ygm3HjzoDzBvc/NnDenDjgMTwwoBwDMVQKWlkxWFfUXItwUC5o9Cq9Q3aH2p/8AKm2Dfdn0Pe7U7vs2t2rT7k/Tbbe+rgeETCMbpnMedVLBcwvhzrws4qzebVucZOOujTpXfoetyzctpOUWq6qqlT67V7nkFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf/1qCaPrnrbZnn0+3dS7hDovde+1yTNPpmGOBgmzxkf9WtDE5XhcQ63LcW9+lJfeVHzmzaxt+1ojNpb2tcj0GRPXO1bjlbqboPZNxdwQdw2oSbNqyP7x+lPsk/GGtf6Zct+4vzjwSpcj+LxuSR7fGwn7y3GXCvEf4dHMJO39td4VW02/b30lO35Yd10qblpgTgB9RpDHKAOV4TT2mY2vKhC6vRbty+7KsfxDYwk9UpQfCtpcsaPmJX+WG96679K7rsXWS5Rl0+0bjCNUTbno9UYJ7nwCmsvrFqHvoztdqLp96O1HnI+AnL3bjPienkdGawNg3/AGHqPYdLvWz6/YNUdy0a+zr9NJpizGeMDGRADY2sRW08TavWZytyUlsvU67j3jwVmdu5FTi06rWqbp2j7pwy92nSWT3pl2LRFnBvmzS6gkHh8K5/uYmsuVdPjy6EWneBp4rR5q6yup90sSQQLj9PngMPDwrqykANaz5rZiQliT5nDDxoAZTIqszYccfjYcaAdOVSigEekByPy2HE0A2WIbFWMnBLk2PPib2tjYUAnMtypbNfGxNr38gMTQCv02bLmUjiptcEnllPCgHgGIFvSsaE/m5EX4k+VAMCSRsAFkLcyeFAbT0UmfrDpSOQFmbfNvBJ4D/iUuB4ca0sz+UvdiXqs2cF7+32o9KO7/cjrdTt3cbprU6PVS6XWaTZYJtPqtO+WSKRdXOwdWHA3GB41y/cq3GeAnGSTTm0091bMdZc94pOOKi06NRVOVlc9fuW4btuGp3Ldtw1G6a/U5fqNbq5GllZVUKt2Yk4KAAOWFdhZsW7EFC3FRitSWhFBcuzuy2pttvdZBJVmuoJIOUHgSAP3V6mA1lKo7La4HzPIg0AuRkK5jIA9rkAluNrC4PnjQHhiyAOCSM3EW5fPGgGXBUj05he6pw8ePwoCUGLAC4a9hfgCQPOgPCcowPBuR4C+I/fQHhzXszN7jfG1uFAJcKZLZbZQcwve/IE34fOgEoCzowFyHXhfxH7KPUCz/3YxrB190wyxiJm6djZhaxt9XPc+JPxrkO5iphbip/yPoRfd4HW9Ds9bODaudW6IiRZLsm4zkqOIugOP41126ikhqZhejSDusJkJsCSoGBzZWt+NZyC1M92Eo20dUBswP1ceT4hjYGsSIazG9OyMN70VyQBOhJAH98Y1M9KModRnOqZxLvO9lWEivqpSeNiBdcPwpHWebLG/cBAE6E7DiOLKrbCWLKMoY/SaGxwwrju7K/VYt0/j65F9nD/AJNjs9USrNrq4FgVBykX4/v/AArsChHsMqsoyLwOUkkjA3w4UB7dhlBJKk3VSbG3G1Ae8PUCDjg18fAefCgGZmJKAjAEYgYqb/IG4oAVCcoN7sQTbgR8T8aA9MaxtlaTLxve9sPEA0A4xu6IjAxkMbhr4X4W4cqAbC2DXGFxmtcLf9lAPBlIYDAi62Phxv8AjyoDJvv29PsUWxS7xrp9k0shm0ezvMx00bHNdljJspu7HDxPjXhDC2o3XdUEpvQ5U0vw+A9ZX7koK25PZWpbhaLvKqt2X7VzkiQBdrxGPHbXvhe3EDjXDd3f+4xX2/8A+xHS5t/19n7PqlRLyKCwUOoJAVybg8LXr6Acqex+5LmTODZc1r442FvxNAeyWa7vYEgWJxJ8PG1AN5o7BrgE4k3IK/Fhfj5UABhlxLMrYtbCxPAgWxNALDEITlYWwVbm+Xyx4cMKA8kjVihX0kCyjncXN6A8Z8t1ZvSLXAvax5X4WoDyz4ov5lIu97jwHxuKA8ObJaQECzesHiCflQFm+7qTv2M7Auk/6c2mCxQIczBvo1wAte5C8PCuPySqzXG1eivJ4xfZjR4LD8XUcd2ztp13uenXWxdMarbtscAnd90ybZpLnmJta0KkfAmr+9m2FtPZdxOW9HxpckasrIYG/NVUWlvvxVyuhLk6L6Z272v8QdxNqSVBZ9D09FLu85YG+EqiHTg4f+0IryePxFz3OHlxzatrk8aXMZ/C2oe8uriinJ8uiPOIbeO3W05k2/pTcupZVHp1O+676fTn4aXQhTbyaY1Hw+Pu+8vRtretxq/vzr6pPtsLDybbk9+T0fdj+8JO5nVMIMGwfy7o6FQAq9P6OLRvlPDNqLPO1/OSn0TDSdbu1dfpycvw+T+Ej6jeSpCkF6KS59fOfWb/AMqDcd03Ne/up3bX6rctU0vTN9VqppJ3a43b+KQk1Z27ULa2YRUVvJJLmNOc5TdZNt8Ok+wNehiFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf/XolunbTrqNtZrtHtEfUO3xyPk3HY9TBuiBbnEjSu7r4nMotVXHOsJXZnP2b3ppw9ai5Gbry6/SsY7S34tS6NPMc+mE2l9yGeGWDVo2UaTULke4/N6GAItVnGSmqxdVvrSjTknF0ehi/WSA6qq43j8PG5qSDx1jA9caswAKWxIPHjypUHQOkOv+uNp1uy7bpeqtedqn1+ljm2nUTfVaYxPOgK+zqRIi4HAgXHK1VeNyvC3oSlK3Hao9KVHq31Rm5hsbetyilJ0qtGtcjOh/c5pptJ3TmgmQfp7NofZBwBQSagEgnHkMeJqn7lqmX09OXUWHeF1xVfRXWV4Z5ZGlYLcR2C3/NiOXO9dYUZ4GKxSEBi97Ro1rMcCbC3zoB0GQlc6hQR6k42PO/40A8Aqrb0g4WtjagGRctmwMdsHJtjbha3KgCzKwKkWW1zyxtf9lAJN1GZrKGNha2N/jQCWsQojJVn/ACsOFgOV6AYBlBFwLcnHHxwoDc+gVkm6x6MClYmffNvKFvVY/Ux2vwrSzP5S92JeqzZwfv4dpdKOw/dLFqoe4uzxN/vP5FEQyniBqJwLn41zXchNYKaf9R+rEt+8jTxMaeaulld2z2LOLHKbtY2v+ArsjnxphK5BiK4AlUBJPHAD5UB5o5jM7x6hCWsTmtiSDa2GFAP5ZPe9mMBzluynkDwJwx+VAJVip9qQhgozKbXF/DhQHrvYD8pUm5w4cuVAe+6uUKVC3N7sxx+VqAXlzMxLKFIuptxPIAkAfO1AeKJFKn+HKbqCeR8fCgAOuNyytYE38/L40ApHlV4gUUBpEDLhjdwPwqHqZKLSfd3KF7k7ErEAwdOQgAWxP1WovYVync/5WfbfQi7z/wB/Hs9bK1asI/SKS5wjrr51VbH9T9FeHAXHn411e6U0dRjOkADuunDWQZx+bHMbN6RYnH416EbjPdhRF2nqYgqpGujC4H1YtYD41iiI6zF7GofdtKryewrSpeVsbfqL/dN6S1GUUbFvkijdd5iIEajUzALbhZjgcKiJgyz33ASu3bX7e5VAu+xSJmNuI0ehvjXJd3fm8WvT/NIvc19xY7PUiqoJB/UAQcrc/H9ldaUR5mYo3thhdbgnH5edAe5Gu2ZgGCjKSb3NuGPx5UAnOIwmbLcY2xXj8qAQ0nqBCBTe4BNx8fCgFsygMSQSLkYY35DhQCLahkecANdbkHAqP9GNAOKIxA07D3BkLIcbEeHI40Bj431M/uG2SNcccFB42v50BKBJOU2LZeRJvw/DG9AN6n3/AGmKghFFyBgb/CwNEC4Pd3TalexXaqZ2VIj/ACzInE//AEukINuXHEVwHd2LWb4pv0/XR1ObNfAWfs+qU9ld87oFFxYixuDfCu/OWEqZAc7myrbMi8xQD5KBggNr+mx4kHhe4/C1Ae2kylMAW425j/XytQHtvTcWLMMFuQb3/fQC4iAQJCMy/nQ8BiefhzoDxxa7KFvYEMMTb4fGgEZpBIiuqrGwIaYf3uFqAbAkZ2UKcScwk8RwxFAORSGVY/cUYE5ieQ4YC9qAtt1p1D1R0j2S7La7ZNzk2XWbrpEik1kKx+/7KaQPZJGRily35kIPia4TLMDZxOa4x3o7SUtCdaa97U/CdLjMVcs4KxsOja8OrmKrbjum57xrH1e+7nqt71L+oarWzyalrH/akJIrt7VmFlbNuKiuBU6DnZzlN1k23w6SKRZQQFDWuCMSMfCvQwGmkZHT3QiREkSajCwPzoDObN0t1T1HKU2Hp3cd2FyHkigdohbmZbBAPi1amJx+Hw3vbkY8Daryaz3s4W7e8iDfEtHLqPtF/wCVh0xvHTWl74Rb3JoE1mol6cB0Gl12m1k0IjG5/wC/XTPIIic2AJubHwphcbbxNXBSot1xcU+ztJVF/Dys02qVe4mm1x01H1trbPAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKA//Q+bhLaTXTajQyvpp2ma2qgb2ZFYMbEMhBrGcIzWzJJreelc5MZOLqnR8BucXcjrcxjTbvuUHVukWwTT9QaaHcowt+CyahTMvllcVVzyTCt7UIu3Lfttw9XRyo3Y5jfpST21vSSl06ec8HUHQW5gDeeh59mme6ncOmtwkjVTbj9JrhOh+Adaj4TG2vd39tb1yKf4obL5Uyfb4e55dvZ4YOn4ZVXQSP8KdD7nkXYu5UGgmkAA27qfRT7eRfl9Vp/qoMfElay+MxVv3thvhttSX3ZbMukj4ezPyLlOCa2edVRK0/a/r3btdtW46fZjvm1afW6Wb+c7FqId104CzIbs2keUqoAxzKKiebYWUZRc9iTT0TTg9XpU5gsBeTTUdpVWmNJLmOk/dnEY+60fp9z3Nh0LKSQRb39VYg1V9zlTAU9N9CN3vA64n7K6ytBjSxygMH9LHAG/DCuqKQR9PICbvmJxVr2UY2wvQCczenEkk2zDxxtyoCSsbAoYycuUDKxGI8T+NAGX1mwvhYAY2wsPhQCivpynNb+EWJPG9r+F6AjSQ+8QGIABByA4Yc6AUyhyuQMEBPpHPC1xwwI8aAfi08aMS5L5mzZScQRgKA2voay9bdGsBYDfNtsBhYDVx4Y1pZn8pd7EvVZs4P38O0ulHYPudkMPXm0xyqwdNnW8hbMTfWag3vhwuK5nuN8lP/ANj6Ilv3k+Yj2F0srZJPJKFyllT8uFjmFxe/hXZnPgim5IuFBzFzYFQMbWPIcqAWI4RKjKxDN6lkGFjzuLGgJYMUbM5Nnyf7w8wBgP3UBGYoMCpcNiTfG1/2jGgPVAkcggFDxB5WPljj8aA8yAKcCHfjlOYcybHxoBwuSvqxZeItxAHM8rcsKAaVLEOTYrcmMnAXOPCgPJLnK2LBsAMPM4m1qAkL+m8VlMjrJGRY8syk1D1PiJWssj9251L9w9gaRMssuwR+kEctXqeIrke5bfwc6+e+hF73hS+IjTzetnAtTpSOjY53e5GvmRVvaw9pQeeN667dRSR1MxvRsXubnEFazAlsG/uqxrNsbjDp/Tt/KeqDmayayNjdvBiP66xqRFaTF7BCsu8aWI4q8qA+q1xnFTPUZR0mW6lilh3ndxnLhNXKpfmcSR586hHmyzPfhpl7edhIZYv0V2VijA3w+i0N8RxNcf3cbeNxnb/NIv8ANqLD4fs9SKuSqbqwJOY2BBuRjbhXYFABGZfaJsbC9+QHgMKA9QZWIJJBsfeGLcr2HiKAUWLOrMPQtxkA9IHMY86ASIgASFDFbFCTdjhY3HKgEZlAF1Lst/VfC1seFASI2jQOrNZWF8pOBA8B50AiVIvZA9QjUYQjwF+OB53oBr21VQsZzH87IMBbgcTxoBklkN0Z0YkglRewI/KORFAPNqrhhILMuBS4seOPnhUoFvO7xY9j+2jsrLHJLtmVC1x6dqcNYedfPe7lfq+K45+ujqc2+QsfZ9UqZkjKsGX1LbK2PEcL4DhX0E5YiNp8gIRmb1XzcQMQbXFAePEkuU4q0RuX4E87jyoB1B+XNjbAMMb3HO3I0AtlNiSGYsOJ+VrDwwoDwKxT0GwOBYG5A40AzIDHlAzFiFU3OBPI4f20AjKzk4kqvFbi/C/AjjQClhdLFiJCTZQxtYnGxvQCsiIUEahwDjwFj/poC4HczpnqPqDsz2A0HTuz6/e9T/LlnfT6OJpWRfooQrSlQQikk4sQK4nK8Taw2Y4yd2aim910/ierfOjxtmd7CWFCLdFucSODSdstZthEnV/VnTvRzn/eaLU65ddrVvxA0m3DUuD/ANIrXQ/VYz9zbnc4VHZj96eyukqfgXH3k4w43V8kajEkXazZ8pOt6i63myqAsEcOy6NzfjnkOpnIv/sqaiuYXdSt2lw1uS5tmPSTTCw86b8EF1voEr12miYjpbozYNgKYLq5YDumtHgRNuBlQHzWMVH0l3Pf3rlzgrsR+7DZ52yfjtj3VuEeGm0+WVegwe8dV9XdQhP8QdSbhu8Sm0Ojn1DCCPNbBYVtGo+C1t4bL8NhvdW4xe+kq8uvnPC7i713y5t+HRyaj67/APlIRRRabv4sQC2k6YzKFAscu6nlW4a59kKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKA//0fn91B0f1V05PqX3zprcNqhaRimqn07/AEzC/FJgGja/k1aeHzDDYjRbuRk96unk18xsXcLeteXFrwaOXUauSpIkViwubNf03txw8uFblDXI8zLZGJuubEHgcoxvjgTwFAJb23IkZrM4vl4WIHAUBlumdRqtDv8Ass2i1M2ilbcdKpm08jRSeqdARmQqbEedeGKip2pqSTWy9encPSy2pxo6Oq6Sw33XTyP3bImPoTYdB7UfECP3dQVXC1q53uc28BV+fLoRbZ/T4rR5q6ytasPURZcwzA/w+ZFxjeupKUcYC4YZrBsDyvjY4Y/CgIsxUqpJOXMA3hh43OGGAoCVFJmjUnDnktawNrCgFkDEEgsRYAYcsLE+XCgPGVgbuHJvYAcm53+NAIcXCKVBJIu2Obne4oD0EDNdQxU3VRjywv8AjQC4i10UFgbAm17/ANPAUBs/Qlx1z0YI8Qd924kWuTfVIADbhwrSzL5W72JeqzYwfv4dpdKLKd9NubWd9u3Wl1OR4dWdpieCRQwMcm6SIVZW9JBBN78a5LuwpLKr+mjrOnB4iL7OafHWt3RH1mce7/bPptj7rdSaHQaWLSaGKLQexHpohFCQ+kjYlERVUZr3wFXXdeU5Zdbc5OTrLS3V+U91ldnSisXJRSS0aFo3Ecf91cTcAW/K5Nhmwx+WFdAVQznTKWuoB/3gOGHIUAFypzICoIAX9l7edAeM4ZkY4uMY0bEHEW8+eNAOZTiP4hfMTxLC3EeFAOOCQFtctcnkw4m44XHGgPIi9je4NvzHh+AoDySQmYqgsBdcBx8je9ANuMtwQSOLt4Dn/aaAkJMHYXk5jBTcYMLDHlfjUMFovu7lWXr7pmaEFlbpyLIQtwzLq9QSwPleuT7nSUsLcp576EXufql6PZ62cHnUP290UmGG4ajC3O3GutS0opYamYHpFcu76dHvcOSMLfwNYVm6EbjHNohMWz9SGRSt9ZEU/wDTOHxqBDWY/puMtve35jYPOhUkcLMKT0oyhVchler2y9Tb+oByrqXLMBexy4GoWs82WU+4OaMdA9g4sxjkg6dYSLwN/o9AMfAEDjXId25KWJxdPP65F7m6pZsdnqRVB5Q5ABEhW9he5tzuK64ojw5lQsrEBuJ4kHw/1UBIR88YKjKQCGUX5AfgRQDAz5ibEhbWDGwFzzNwKAckBPA4WJDG4xsP2WoCPJYLiAEucTyZbnA+fCgPTKcFBJU4Y+FsPgf6qA9DAFF4S2xLc8aAUkiXKrlsRYE8flwuLigPc3uFQuYluJFyDc8B+FAWK6r6b0em+3PtlvaaPTafdNdu0sWq1IhRZ5EH1+X3JAodhdAMSeHlXK5fK485xKcm4qKpGrovJ0pai7xSisustJVbemmn+LdN+7zxzx9he1IYhizbZkky3Wx2xyBVZ3eTWbYmvp+ujczWnwNn7PqsqAlgrMhIxDELwxHiOd+Vd6cwNg3bFSQVBDcgR4UAggHKxUMM/K9iL2x+dAOEXtdTZgLKl7ZjhxvQCrMMXNwARnPjccOFzQBwtYg4YHy53oCFM4aVQbkhgUcD1ZeFgD4UA8MfRjgQPSTe4PEXoBwkKMeV7g2vy4cudANqyqCLZXGINjmN+NxhxoC1Pd7cNwXsL2EiTWTxR6nQqkqRysqyxrpEyJKFIzZSDbNe1cfksVLNcXtJaHo4PG5i/wAxbWCsUetaeQqSqIufPZRx8Bf5V2BQC2KL7cYN8hBDgerE2IA5nnQEq4N48SRYWF73ve4oCTp4JtVMml0kEms1LEhdLEhklY/7KqCf2VjOSgqyaS33oRMYuTolVn2t/wDKr6X6j6c0Xe6Xf9j1myLuUnTjaJddGYZZRGNzzN7b2cAZxiQL8q18PjbGIbVqans66aVp4dR63cPctJOcXGuqp9ca2jxCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/S+eu39TdTbBrdSux7/uG1Re6xeHTaiRYWxvZocxjYHwKmtTE4DD4lfzbcZcaVeXWe9nFXbPu5OPEzY5e4D6+NpeqOkdh6jIJQ6t9L/Ldc3i31O3mG5A5srfOtP6QrfuLty3wbW3H7s9rmobHx7n72EZ+DZfLGhEgbtbuSOc3UHRWpk/v+zvekzX8R9NOB8mp/cbX9O6vDbl+aPQP0k/PtvwTXUyWnbaPdyD0x1n071XKwt9ENd/LtYL/lA0+4LpyTysrGsvqqt+/tTt8NNuP3obXOkR8Dte7nGfh2XySoY09IdT9K7/sX+IOmdz2ZV3XRGPUazSyLC4E8ZBSXKY2HwJBr1eNsYi1P2c4y8WWp6dT3NZgsPdtXI7cWtK3OHfOt/dUD/m1MxN/+4duFrWvZpxh+2qXub/167T6EWHeD5r7K6WVvMWaUWAsP4h8PDzrqikHHRsjyguhjay5jiTcfHgDQEaCRFV2ODNxZje5H9lAA1AinOdgySIbubnI1sMOPHgKAySlXiHrViFsth8744UABAMxFhlW5K8MeYHlyoBNrqVsGYHj/AGfGgEZZWHtKLsAbWAsBbj8hQHhQx3Z2zBRgPMYHAi9AbD0hI+p6t6W00Clnl3zbVXKxUX+pj4+OONaeY0+Gu18yXqs2MJ76HaXSd579b9u3TndfondlGn1Oo2LbdJq4veDNEXg100iCXKQWGZcbHHxFcr3OtK7l92DbpKcl4HFdRd5/ccMXCS1qKfI2cQ696r3rr/qnX9W7wulg1uuhggk0+hR0jyaeMRobO7ngo511eBwUMHZVmDbiq69el1KTFYmWIuO5KlXTVwGiypMri1zZeBBynyN62zXCCF1Y5kzBiBitzfw4kYGgJ80DIM4jYt/dxBy2wPzNAQoo2vmX0HOLjAcAfgaAnJ7YJuvrYgRSnEm/H448zQEiYK1mJUkfmUjytiP7KAZAAIfEhmKhTxNvE8r3vQDL+lw+DMAcy8+WJxxoAkb3bDKzLaz4YKRj4XxtQDaxqGjPFg6gObHmONHqBZv7rWcdfdMRooRI+nohGOXq1U+JGAHCxrj+5S/SXHv3Pyov+8Xv49nrZxvAdvoMxGY67U5Lem2BuL4iuwWsoomC6T9sbzB7qsSbhMQfXZrflArJk7hM0OUbP1F7ysb6lBDc3s2Y5eHD51CMY6zGdLlRvW3582T3EuCwN/WvIAE1L1GVB/rD3P8AEHUC3BvqSCQOZQefAVC1mDLDd/by9C9iZJEs8mxH3LWJb/hdEQbkXPib1xvdhUxeMXp/mkdBnPuMO/R6olXvbym6oXIwVBy5V2Jz49JIHXKLmy2LtyI5n8aAcFglgbreysvC/hbzoD3It/bwBQ2JPCwxuDyoB+QxgIHs8V8pUA2JJ4XvflQEB0LKoT0eoEobWtwGHD50AzBG2YoIyQT6iMML48sedASpoCiqPbvckRsVNrXwI5+IoDF+1MgIAIDYmwxHkuPh40BNjhmZQAzIWW2exwH9MKA6PvHcrqPXdtNh7cT6fbjtnTk3vbbqIY5F1TG05JZjIVI/Xa9lFaFnLbdrFTxKb2pqjW5uatHBvm1cxk52I2WlSOrf3f3na+8Da5uzvarXzHPAi7WoSNiuS+2ScR42w4VyHd2n1bFadNZeui+zevwNj7PqlVBMs1lwzC/K2IPnXfHLihFKAHzFgo9ZAxGPG5HiaAUoYsHZQVPDCx+FqAUozZgGwINvK3Pjy5UB6irmUkKqkHDw+N8bUBG1OpWISYiRzHliQAg3FhcY+HjQDMUgRVDSBrqePAHwF+AtyoBEAzyGJS0aE43N7EC/C1ASJIyyOCrBkYqVbgSPAjzxoDxFACAWBsflQFpO60Ms/Yz7fNJDDJqZn04EMEcTSOxGl5KgJODcq47J5KOa4xt0S/8AkdBmCbwWHSVX/occ03abrObTLrtz2YdLaGS/t67qPUw7THlP8QGqZJH8fShq+nnGFT2Yy23vQTm/w1XOVkcvvNVa2Vvyaj0nv+H+gtoa279xk3YqP/cunNFLq8f7o1er+mhA8wGrB4vGXPdWNlb9ySj+GO1LoJ9hh4eXcrwQVed0XSR4OoehtulaHZOgjuLnD67qbXy6oZv730ekGnj+RZqj4PGXfe39lb1uKj+KW1LoJ+Iw8PItV4Zuv4VRdI5rO5HWc0Mmk0O5DprSISo0Gw6eHa4iMARm0qpI3xZz8ayhkmET2pQ25b825v8AE2uYiWY32tmMtlb0Uo9B9X//AClpZp4e/s+omfUTyy9MGWaVzJIxtu2LOxJPzq0jFRVEqI0m23Vn2LqSAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoD/0/nHuOn1Oj3LWRa+CbQaqOZk+mnRoXvcj1I6qbVjCcbirFprfWnoJlFxdJKj4SHIM4LH1XFlwtbHhWRBjwSpC5SBm9LcL+IoB1kUoLRH1A5gwBHla9Kg3Ho7rLq7p3cNsj2vqHc9s0Ums08eo0EOpcwPGZUDK0DFozcE8VrQx2Aw9+Enctxk0npa06t/WbOGxN21JKMmlVbujXvajsv3SD3O6YbKUDbFoMMQ3+91ItiPLjVF3LltZfX05dCLPvCqYqnorrK6YtIzk5fbsEy4cRhe44V1hRg658Sc/IWHA3/0UBjwSDkykDNYNe3mRQDjxK0YYKbm+BOB8LUBK0oUo0YDkn1G35Rw5/CgJGdQYlKk+4St24A3xvjhQHgmiVnhzDPgSL4C/CxxoBX5sgEhvwI4mwGN/wAaAxs41AlbOuZQ2WIjBTf40BunbhW/xr0cBGQX37byzE8vqY+Qx+VaWZ/KXexL1WbOD9/DtLpR1b7oY5tN3C2rSDUSalV2SB4nK2J9yedxkU3IGPP8K5vuQqYGS9N+HxYlv3kdcSn6PWzgkAkS7NmMhGZixxAtgPwrsTnx4MjRlsbBgABxv4UA0CgiR3BVr4W4E2JPKgG5ZJziUujXsVOVjw5XvQDasxezYcWsCDbja/CgIzErkAYvIDgxOAHnyoCYHlkjsL5lxZ7YN4W4UAotIP4rMq4tYYWHL8KAbzxC3uBs7i7MLfswsL0A4QHGVDmDsJAgPlfj8KARGT78IysAZ47+Au6i39VRLU+Ilay033aEy9yNlEsagJ07AFSNcqgDV6niAfLGuU7muuDl230Iu8/9+uz1s4LqZQvb/SR4C246gFb3sbX4/OusT0opoLQzX+kGzbvA352DG9scMjYn+2s5DcY5s0jPs/U2YFrayPxwGc/h8axIjrMd03Nl3vQWZbLOgTn/ABDE2qZ6EZR0s2DqkJL1H1A5XN/xTeoHwWx54VG6ebLD9/ndu2n2+lkXMNkZQyAKzD6LQn1EcSK5Du8643Gdv80i9zX5ex2epFWUBOV8rDK+YueV+RrriiPWeFB6/UxuxtiDc8xxGIoADEXWM2jy3CNYk/s/ZQCv1WZGU3AGGH7MDQEWeVnYEg+0SP0+DeNALS4DsHLWylQLYW+NrUB6JJRbKMx4q2YAY242tQErOSVjnGT1elVHnbjiKAUmX3cpUqLqFIxx8/lQHuckyKovbFx8Dw86AxeoEsYBBcxcUJF1x5XogXD7qQyjsP2x1bTvO+rO1uYnBBRRt8yXDC6kGxtz8q4Hu8l9YxL39rR9vrOozX/r7P2fVKcyKwkcLEQGayi4vc8BzrvjlydCJ/ZzzNkINuBzZRbjQEgyJG2ZnBC2FycMPDA0A17sYiEy+tXNlHFsb8BfxoB02zO9mIQY5ccbeFAYpkWSUkAkMSQxPqufEUB7IFjb0qwFx6SeIPKgFQKXzMyEE4EHxtQEwguMhfjgLYWbA8OYoBKZnWO+GXAWva1/6Y0BbLuN1V1D032T7IQ9Pbvrdkm3HbFj1c+hkaB5I10kbZBIoDAXb+Ei9cNlWFs4nNMX7WClsy0VVdcnuajpMdfuWsFY2JNVW5xIqLqNRrdbqZdTrpZdbqnNjqtRI08jm/N3JY/jXcQioKkUkt5aDnJNydXpY3JlQnKjBbg4nEipIFQqWZiyEE3BB/ZQExiMuR5coNhe4Wx5caUB9nP/ACltNq4tu75zz6WWHTzS9NrpdQ8brHLkG6ZvbdgA1swvYm16xVyLbSabWtV1cZk4tKrWhn2GrIxCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/Uo1J3M61gMug3Dezv2iV2VNFvUMW5wqASMo+qR3W4/usKq7mS4Sb2ow2Jb8G4P8LXObsMwvxVHLaW9JKS5yIep+jd0cR752+Tb9QSb6zpjWy6M44FvpNV9TD8gVrD4LF2vdX6reuRUvxR2ZdJl8RYn5dqnDBuPM6oWNh6D3THZ+uv5Xqn/wB3oeptDJphc8QdVpDqIvmQtPi8ba97Y2lv25J/hnsvnY9hh5+RcpwTVPxRquZHs3arrsRDWbVtcfVO32uNd0/qoN0S1uJTTO8gH/SQVnDOcK3szk7ct6acH+LRyMxll95KsVtLfi1Lo08xp+3aXVaLftq0OrhbR6pNw0gOn1KNG9/fjAUo+UjHyreuSUrUpJ1Wy9WlajWjFqaT0Oq6Sx33buX7uhWjClOn9CpCYnGbVEk2+Nc73P8AkPtvoiW2ffM/ZXSys7t7eEhxOAZf4bYY866gpSEzTBygPqzEoguTjhyoB3OtvWuaXgByvjy86ALflsSy2AIxsSb0B6sYOdbkIRmAPBjyxFueNANyxHNIjsocC6PcgNc4i2ONvCgGY9vkdTKJbZbjK3E5eXhjwoB4LPHFeM2ViQCOIPgOfnQEiGN2jUa0n2mIaAXIPp42NAbd0LJBp+uuipi/tCPfNtIGN8o1cd2w5itPMX+lu9iXqs2MJ7+HaXSjsX3X6jTT9x9k1ujlJd9hi91wDcMup1I5jwteuc7lTUsHNrz36sS37xRccRFPzetlazLIWX21BV0yuvMseLBv9FdeUA4rvGpicXkublDgLHAXHhQEZ9UwdoyuOJAxNwLWwwscaA8BnsSJFD5crKBgLY/EUA2knuFV9N1FrgXt4C/jQE5lKqAY19QAUHAY+fDnQDyRqkWWx9y9gSMRYm+B+QoCPq2VoVcKMwYqwU8cvNRx+NAMSJKsQexy3ICm4IBxv8KAfhwBlk9IFvG5NyQbUAkuTKry3Vg6kqBxuwPOoepgs591iSDr/pyQK2eTp6NgxBOA1U/A1yHcpUwlz/2P1UX/AHi9/Hs9bK/6yd4+j44CLo+vmZHFuPtKWU8Pwrr90pIbpi+jZWj3SHKDmZsmNh+ZWGF6zZG4z3p/UONp6nupAfWxobkHizG37KxIhrMVsE/s7xpZbMQsqGwtj614XNTPUZxM/wBRGZt13lnUXfUytMguQDci2FQjyZYzv4Pb6C7ERPnT/uJmW+NgdHoeVcd3ZX6vGP0/zSOgzj3GH7PVErLExdRG2AJvFxxNrfCuxOfIZEnuJGFOOAtw5C/zoBTqyzorg4t+c3y2wF7m3KgMldGfLkHtRnKy8SeGJN6AjOgSQvlBVvTdvG18PH5UA1OpQXKgYeGJoBhJZHZvbZVAWxsL2HDEHwoD0zSQ3JIdFX0yC5OF7i/jQEiPUNlEhUgAnKBc4cBfjQHjtMueRAuR7qhJvl5+oYG4NAM6iQmL2wSqlR7yj+JhzI5D+uiBc3vLq9COwnafb4Z/93/KjLg1gf5XIWPDkTXB93pp5tiUtzb9c6fNYtYGy36PqlQcmnORmweOxRuRwwNr/Ou8OYIjfXJMVla7ta4N7G+I44fKgGzo5Z3dC4Rlxcm//o8+HlQDa6X2nZZJLrHcMcRe3JeV7mgJaRsVEjEKbExgXwOHG54mgEBLAfmDscScDifLHGgPboMucZwVGbkQfn40Ah3fihIiBHqsbeNza9AORSFQWku2diUC86AfYEAEjOCCFy3ItxxtQFpO9cjN2J+3iU+1EibeVz/3mGiiGBuLXtXJZJ/2eMXD+Zl7mXylh8HUiuuxdFdYdSK8mwdNbjusTWvqNPp39lRfDNOwEajzLCujxGOw+H97cjHjenk1lTaw1275EW/B16jY37efyogdXdX9PdOkAe/ovqxuetXHgNPt4nsfJmFaf1V3PcWblzhpsR+9OnMme/wOz7y5GPh2nyRr0jDSdsdrX0xdQ9ZSJxJMWzaK58cv1U5GHipqKZje3bdpcFbkufZjzMmuEh59x+CC630DsXcWbQEP010vsHSoU2i1On0n1+sY4WLancG1Bv5qFo8njc9/duXOBy2Y/dhsrpHx7h7uEIeCr5ZVPrv/AOVh1H1F1InfXU9Q75rN6lifpldO2rmaURBl3QsEU+lL4XygcK38NhLOGVLUFFPeVOXf8Jq3b9y66zk5cbPrhWweQUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUB//9X5uSmFpNQ8ZWQJK91vcqb48+VKNAZMZYkD0EDMYweNr4eWNAQJApjv7mUgi5UY4A3tb8KAkaB9RFPDqtNPJpZomDRyws0bqV4etCGvhyNRKKmqSSa3npJTcXVaGdc2Lud1xPufT+2btvA6j2ubW6SL6Tf9PDuhRXnRbpJqUeVGAOBVxY1UYrKMNsTlCOxKj0wbhuPzWk+Q3rGPvbUYye0qrykpbvDpN2+6yYHu7KLsANl0Ch3wa2fUY4+q586ru5zrgK+nLqNvP1TFfZXWV0QRshdbMFxyNxBwv+FdSUoGIs1h+mbZinjY8MOHnQEB1Ux4SZSCBdRjh4W4250B4s1shDZVAsBe7W5mgJkM4TOctmC3PHAgGxxvQHrvppCPcU57XWQcSeNATE9tbZTZzgzA4DyPwAoBp9THE6xshBAzC3gR87YUBBdjI62CkkmzNYhsb3N8cOdAbJ0Xp/8Axd0nGxPq33bVdy18oOqQHKOfiK0sy+Vu9iXqs2MH7+HaXSix/fHZYv8AOftvt+sg/mOl1ke2Qa3TtfLKku6yxupxBs6VyXdStrKrzi6NOT8KgtJfZ34+OtprQ0lyyZyjvbt+ybH3O3zZuntsj2na9LptA0W3wZjGhl0yO7LmJOLG/wAavu7mKuYrAQu3JbUntVfhaKvN7ELGKlCColTR4Dlcz3BdLtGeFgAWvb+yrwrSJcFAwXOThcm5APKgJEMMcnqKPJEoy+ocwB6gAOFADpFEyJ7LZjfMzAKeRGAva+FATWyTQxC97WBK8yDa3jjagF5AiHJcoZGKryFzzJ+FARzaUZzlSzFWXC1yRa3xoB50zOyqzHMpDA8D4EcKAjyxskV2bK9x6eNARXkzNkWMBgwBwtz/ABueVAWb+6WSWLrjpsSgpN/hxC6E+q51c4tbwrje5Cawlyv9R9COg7x09vGnm9bOA6x3/wAIrGUDF9dM0jkXy/orlseIJ512O6UUdRiujxl3TTm1/WFYMC2Fm4eB86zZG4z3YWJ2nqYZPza6P8yHAEte3gfCoEdZjNhzx7xpXjj91lkTKjguD615E0nqMomwb/KV3Td7E+3JPOyE/EnGoiebLCd+zMOi+xkhQmFthJQk3BJ0mhLBb3rjO66axeMT8/8ANI6DOaeww/Z6olao3ErREfpqTa4FgfA4V2Zz5JEMi52BsAto3+P7BQHrxqyIqt+a6r7nHEcaAUjZmKKuCvYMvEk/6RQA0KZ81yXMjEtyNwLA3w872oBjWSRliQgkCKBkFjxxI/A0B59NEwZliYsw/TJGA5Zgw4/OgIbAZwuRnP5JA/x5YcCaAUjXkKLfHC97qoI4eR5UBKeUBcblwfWoXgDzw54UB2/qzYOnl7B9uOo9v2OKHf8AddweHdt6XN70yAa4BW9Vh/ultbwrm8Djb1zNsRYlJuEIppbib2S4xOGtxwFq4l40m6vlOgd5ttOm7Ndqpy5f3/5UvtG4/wD0UWcg8OJsKpe70Us4xXDteuiwzZ1wFmvo+qVDMRQF7gqSMWNyPhfljau+OXJSahI0YSKRYj0cQLAcfiaAmK6uoexCygYX9RBPEG9ARphpQQXuUAJUDHHwIwtagPV1Cj0ouUZbhBgFIPG/woCC0wCgL6FIsDjYj/R5UA3cSSpdypWwY/wnjYmgJcUeb3CrhRGBc2+NwQPG9ASFQHKCgAIzZyb2w438r0AyzxqxCtma4zDkTfgPhQFxuuuqNx6b7EdjNdtEei+vk0ghh1Wu0MGsaFRpQ2fT/UJIkbEgAsovauGy7CQxOaYuM9qiepScU9O7SleI6TFX5WcHYcaVa3UnubldRWHqPqzq7qlVHUHUm57sIwpSLUaiRoRxFkhBES/ALXX4fA4fD+7txjwpKvLrKG7ibt3y5N+Hq1GkAfqqjPkykYgWBF+fwNbR4k2JMzMUbKEFy1uFj4DjegH1VTlUxixFwxNyLc7jwoD7Lf8AlJtEYe/wjcOyy9MCQg3ANt2wpQH2OoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoD//Wo5q+4m4bhqNTH1T0/sHVNnb/AInV6BNNrDibn6rRfTyE+bXPOqj6PCHuLk7XZlWP3Z7S5KG98fKXvIRnxqj5Y0Y22u7Ybq7e5od/6NmcBJDppYd40QY4AiOb6ecD4M1NnMbWqVu6uFO3LljtR5kTtYSetSg+Bqa5HR84zF0Dot2JXpnrTYeogbNHt8uoba9YM2FvZ1wjUn/oyGn1SVv39m5DhS9pHlhV8sR8Ep+6uRlwN7D5JaOcxW9dDdY9O/8AEbz0zuW3aYf7jWPp2+nKgcRNGGiPD+9W3hsww2I93cjJ71dPI9PMeF7CXrPlxa8Gjl1GO2Nyd52VoXUf946L1XuoKzoRmPCvfEL+XLsvoZ5Wn48eNdJ3j7rYZJO7ckspX3Jtk0TyWF7Wl1A424Gua7m1+A0+fLoRcd4PmvsrrK2pEEZg2CBQFjGI866opBz6h/dJOX2wMjKOHgDbmcaAZX6eRigzSoPVlA4csaATqIT7wjAzWS8arYCwGF+IwNAJSP0XH8ItlvfG5ww8rUA77ZZ8CQRd2JxxPC/7aAW7KEtGjGRvSrjwxON/M0AJBJFlPokfgytfhYWsfLH8KAiuCsilXyOvCwtYjDkbcaA2zoLUFOtukGliuE6g215HFrn/AIqPAfCtLMnTC3W/Ml6rNjCe/h2l0lkPuP3iXQd2+hd9h0qauPRbdotd9Ix9sudPuE0gjLi9gcpBNufCuW7p2/iMtuwrTbclxVikXeeT9jjISpXZSfI2Vz646nm616p3HqVtANsbXpBGdKkrTANBGsQ9TKt75b8K6TKMuWX4aOHUtpRrppTW2+sqMfi/i7zutUrTRr1KhrJBIMTL+XjyuRxF/j41ZGmEaWupiJuRa/Aj/XxoCRpnlLTIUVQDmGPDww40A+0sQKhyFymy5rWB44X5Y3oBoWCyMuVmzjKFAygC9+WGFAR2kZc4jZhmkZwqG1gwAte/x+NANRxS5l9YsuOW97242uMbeVATI5HkF75SHbMw52PjxoAmdGtHfK+bKVxxFrGgIKxGHVQguRnkQMoHEFxe3wveoep8RKLNfdhr45+4GxRR2McOxRRJISGZv+K1GN+NjyB4VyHcqSlg5tf1H0RL3vEmsRGvm9bOIamMnoTTv6SZdy1GVgcbBAL3+VdfuopYamYXotQm6QhhnViVAB4HK2NekkRXQxewhV2jqj0EltXGFN+BLHGsaEQ1mL6cjP8APNGTY/roGF/9oVM1oMoGY6sb6fqDelbLhrJAF5er1fKoWs82WH7+axNX257EyKxjlTZnilUEFQBo9F6gBgoPC1cb3aknjcYluT/NIv8AN4tYfDv0eqJWSKIQqrs5VWIBbnb+grsSgJxfOuaM2CkgW4G3+ugIspeYSBSIxG9wTa/AY/E8qAZQyxMSWYXtnseBGOIwoCZEwzG4DBpWeQ4E2PDjf8aA9VokUiRkPqwFhcnz8RQD4ckFkXMV45jiSMPhhQGPjLuC8kY/MSGH7bn5UAhUynMUZSDdc3G3+mgBhIwDgFQ11sLWzf6qA37cuutTuHbfYehU2eOEdO6v6ld1OoZ2kZhqfS0TIAATPe4Y4iqfDZQrOPu4zbq7iS2aaqU3fs7xYXse7mFhh9mmw61rr17nhLFd8NWB2O7S6TIDLENpclQAuO1Phj4Dma5vu9KubYmO743rot81jTA2XxeqUtMkjqQf0YyxcRjkfDjfCu8OYJMaMYyqBGUgKXYWtz5YnjagPcjQSBjmkgY2yrjhfwNAeyRhxaP0lOC/DhbDyoBGQGyi4RrsCSeeH40BGaInO2UnIoLOpBsw4/10BOMSCKOSRSzhSUKDEAXIvb8caAQkyKjey+aV8MxwtxOBvhQDgcSoub0lVyqw48uPHG9ANLAcqvYZrXN8b28cKAtT3ZE8PYrsFCHUwpps8YXBmLaNLnxtjjXIZHX6pjOP8zL7Mvk8PxdRWPT6PU7lMmi0Glm1+ofAabSo80jHgLRopb9ldbOSgtqTSW+9CKKMXJ0SqzeE7VdXpDHqd92+DpWAAldXv2ph20ZeIOSZhM3jghPlVZLOsNXZtt3HvQi5868XnN1ZdepWaUF6TUeZ6eYbi2jt/tWZt065m33VEerTdN6FnW5xsNXrjAgxHEI1Y/FY677uyoLfuS0/chtP8SJ9jhoeXccuCC/NKnQOf4q6O0QjGwdv9NO8AIGv6k1cu5Sk4YnTxDTwDHllbwp8DirvvcQ0t62lBfee1LnQ+JsQ8i0nwzblzKkeY+vP/lY9U731Lpu943V9Imn0MnTn0Gh0Oj0+i08PuDdM+WPTxoPVkW5a5wrcwuBtYauxWstbbcm6b7k2a97EzvU2qUWpJJJch9bK2zwCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/X+cuq/wDe9SUKqfcdchxBN7DnQGNaMtaOYgwxk3IP76AXGsd3UflDC5K4WviKA2baureounCzdP8AUe5bM2Fk0eokiQ484wch+YrWxGCsYj3sIy40q8us9rWIuWvIk1xM2jbe4+4btue1p1P0x031TLLrNOi7jLoF0GvVmmQK/wBVt505Ygm93VgTxrQu5VG3CXsbk7eh6FLajq82e1zUNmGNcpL2kIy0rTSj178aHRvuvhmg7sQwyOZGXYNEHmJuLGfVWBFuJtewqs7mprAUfnvoRuZ+64n7K6yuh/MSrKpUWyNiGNvjXVlIQ2iZv05SPZVvUQccbXoBcYjDusZsBazW5XxA+IoCTK8PqcnMQpKgC18ef40BAJV8TkjJBEY5m/j4eNAPJFYKDcsWyLY+YFreN+VAekhI1axDM+BHL8ONAKtOVurKbqVZiMvEWJHGgG0WK5Ryfd4DiT58TQGz9EwZusukVHqz75t4KZcB/wASgxPwrRzT5S92JeqzZwXv7faj0o7d90MRPXGxxsqosfT8IBVsxsNTqPzGwsb1zncdUwMu3+WJb95NOJXZ62VsICACOzBhdSP6eddic+IdkZg2BLgGxviRzvQC1eUqAAji9mQ4Ww8eVAIMZjcJI3qkuYxx4KPTxoCSY42Ksy5SBY58Tj/ZQCyi5WUKbG6n4Hjhy40BB1OniZBYlStrhPzYc/6qASsLMcpLAuAS3MDC/HD50BNhRUCJG2XDAnhh5UAxKkrrIVYBiSQOAtje48xQHqKJV0r5wzZ0HmbMMSb+VQ9T4iVrLEfdPpoou4OxqDYNsEbFhyH1eoHG5rju48dnBzX/AJH0Iv8AvI64iPZ62cmZVPbrSKowTXagseJ4HC3HG1dmtaKGO6YHpNT/ADmARKWUEswtay5WBONqyZO4SdthEez9R+wGe+qjaW/IBiSaxMY6zG9MRqd627Li/uoSCtr+tamWozRL6zWJupeoHub/AFBNhjf0DlzqFrPNnf8AvdpUTt/2LK2AfZiT5X0eithfzNcX3YjTG4178/zSOhzl/p8OvR6ola2DPqMqSDLEozgeHlfxNdmc8SIwyxuGYWU3w4kYc7+VqAjywLmaRSSQP1F8R5nHnzoCMYAzxh2cKPV/s4nEm9AZFI41YFRe4ysVH44ftoD1442U3AUsbeoXthbA+VANT5EXMQ0aKvPhxAsKASsc0WNlcsTYk3yi/IXxtQCHfElypC8HxsD/AGUAoPlCquIQer4nG9AemFOIIL5blR4Hy+FEC3XeiFn7K9q5SiqRHtSXQ5sP5dIRgQLHhevn/d5f3nE8UvXR1Oav+32fs+qVEEcSZmka6f3svjjX0A5Y8RZCWMNgjDKwY4AYcOPCgFM7KyK5JFwCgGU38eONAesgDOLELmsCMOIJA8eVAMSRhWbOwVMVxx8wP7aAdikjJKSKF9JIZPLhYigJDlCqgNcAHMmXAi1v6qAg+1E6q6H9YHgcMKAlRiQhy7opkOJ44g8LjxoAkuUTIMx4ZebY/MXPhQFvu4+6Q7D2V7D67U9ObX1M2q2xE0Ee7e/LDpmXRxEt7MUkKyMQbWclRbhXD5ZhZ3syxdLkoLa/hpV6XutOngOkxl6MMJYrBSdN2ujRwNc5Xybun1zPG+ih30dPbaRb+WdPaeDadORbgRo0jdvIsxrpo5PhU9qUNt7825v8VVzFPLML7VFLZW9Gkeg0yeU6lxPNM2onckyyykyOwsb5mJJN/jVikoqi0I03pdWY724nUMv++DenlhzqQSIxKQ7uyqX9JPE3HmOF6A+zX/lMW+l78W5S9Mi/jhuvnQH2IoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoD//Qo5r+qOi901M8e99vtPodS7s38w6c1kuhZiCQWOnn+pgJvyGWql4LF2/c32+C5FT/ABR2ZdJvLEWJ+8tU4YPZ5nVDcewdCa8W2LruTaWJP/A9TaB4ASeA+r0Z1ER+JRaj4vG2veWFNb9uSf4Z7L52T7DDz8i5svemvzRquYVP216wMD63bNuh6k0igsmr2LUw7igB4XXTs0ij/pL8amOd4WuzOTtveuJw534vIyHlt+lYpTXotS6NPMc71MWo0mp9jXxSaTWRj1aaVTGysMMVcKRVpCcZrai01vrSjSlFxdGqMyOwq77/ANPRq2bNumjAS4Ay/URjC4POvPEP+VPsvoM7Xlx410lifu2dR3gclxHfYNvHuE/n/U1N7X8K57uiv0H230ItM9+Z+yusrNK4Z1VgBnF1A/iy4WvfxrpynPIi0ZZVt7eY3J4m9uNASmC2zem5P6YGGNuAONAQWzMyiVvXl9QQ3s1jQCHBhDD3DlFw7LxOHn43tQDvreMsFdXTG97gi/G9uQ8aAdaaNozYe4BYswHC3GwvQCWlSL2/aAcHG97YefnQDqSe8CBlBubseJUeNqA2voR83WfReUrkG+7apUnAk6qK/Lh8q0sy+Vu9iXqs2MH7+32l0o7j91zoO4GyyKyFhsEeAxF/q9RfyvXPdzH+jl230Itu8PzC7PWyr7smcAk2sBI1+BNuXPj411xQjeVUcDEm/pVuJPHNbjjQCoyhcmVbg2BBwsp5jx5UA3Ksl48/oAwxHDDHzFASHyuuR3BlYehrkfPGgFxsSpR7hr2z8SRe3lQDc0hXKwUyWNowp4nHifhQDCu7PnytGmb9RycV8ASMMaAketRf8y3IV7ePDHGgElTGSAMuAzZTgLHEeFrUA8qoyISViVWU5RzNwQcKMFlvu5RR1/06UFs3TsYmUYYDVTgX8ePGuR7m/LXF/wCTqRfd4PfQ7PWziUloe3umyXAbX6gEHA4AgG9detZSR3TAdJyOd5g9t2ykkMSc3pysSMb2NZNB6iVt04fZ+o/YLC2qjWW+NwWIIF+FQYx1mM6YlI3vbwGOb3UBJe4HrXlUy0IzRN6yjCdSb6Ywwb6h7kYC2UE241itZ5ssp38iiHQfYNEYJl2J8jDAEjS6C/L9tcf3Z+Zxb9P80i+zj3Vjs9USrLm0hyrbm2WwLDz5115QiVUqFyqDnFvEk/CgPJBJZgvqlZhlhH8XDwvQDSymwQxtlz4yfw35YcfjQE5TipY2IwZQPIk3x8qAYJBf3JfTEh9KFsORvQDeou2SzgrhlW1/ThjjQDgHpvMl2ICqx8McxuPDCgGQRkswNgbBzhyIGJoBQCquYFiz3CKTbNbne1rUA6XXIFDDI6nP4gi+A4HjRAuV3rK/5FdplRkuP5WCwNjc7VJx8sOZrhMg05vift+ujps0+Qs/Z9VlOS2Z2YEZkA9wEm58fiK7s5kYfVfmUKCA3LhYc/O9AKzRLIhCh3/MyjgAOB+ONAJLCZ1VGJCi8gF7j42x8qAYkkbPlAeLA5Vve4wuDQHpjCqWLkkkiy8Lg8caAkRZjYSEGKy5Te/q53FqAdkZkXKmUvyPC/l8KAh+lA0r+k5ixPLjhgccRQEgyAKiuywm3kONjwuaAtR3mBP2/wD29Mq+2E0gDpm/KDo1vxHO3AVyeTaMzxa4fzF5j/k7HF1FTXZVDe5IbcmPHD8t7+VdYUZtOw9JdV9RAfyfp/X7npsovqoYX9oHiS0rAIB5lrVp4jMMNh9F25GL3m9PJr5jYs4S9e8iDfg0cuo2R+hBt116k6w6f6cdbltMuoO46wf7Ig0AlscP4nWtT6s7vuLNyfC17OPLOj5Ez3+BUPe3Ix4K7T5I16SKz9rtpcyrBv8A1jKpzSNO0Wy6QkWtlRPqZyDjxKm3hTZzG7u27S4E7kuV7MeZiuEhuTm/BBdb6D6/f+Vnvui3nS97k2/pja+mNNpH6bKQbf7zySe4u5m882olkdyAuHC2OGNbmFw0rNXO5K4351KLiSSSNe9eVymzBRS3q87b0n1qrbPAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKA//0fmhNIPq5yCXVZXOYjEm5wt5UBJD5ZA1wWNyDf1Wx8ceNALiebTuuq0skmlnidcuqico6mx4MpB88KiSUlR6VwkptOq0M3fTd1et4dPFpNdvA6m24DKm3dQ6WDdYSBhh9Ujuvh6XFVs8nwre1COw9+DcPVouVG2swv0pKW0t6SUunSZbauqug9fvGzNuvbuPZtd9fpWj3DprXzaVBKs0ZVm0er+qiK3xIVkw4Wrxv4TFW7cvZ3tpbL0XIqW4/wCKOy+Wp6Wr9ic1tW6Oq0xdOZ1XQbp92EjP3dc5Akf8h29Y2F7YPqBfnhVf3OlXAfbl0I2s/VMV9ldZWtXGcENnVfUWIxOF7ftrqSlMhnyujFgWJPPED5+dAFiVzKpurL6ib8b8eHHyoCOGRSHzGz4FiPzEfxfKgCRxchxmCHBib2I5cudAFzcrgFBubk2oBDs11sQbm6obm9/H8KAQJLKoP5QeBBx8SeVASYmlVUBRbYMqg8L+FvGgNk6HlydZdJRyNlZd70GIAuqjVJjfHnWjmfyl7sS9Vmzg/fw7UelFge+a6feO8nQW0a0vJt+5abQ6TW+ywVnhl18ySZXAJBseNcd3UxErOUX7saVg5NcagmX+d2lcx9qD1SUU/DJo4X3M2DbOleud/wCn9kjkj2rQnTnSR6iQyyATQRynMxAJ9THCuoyHHXMbgrd65TalWtFRaG1qKbNMNDDYmVuGpU18SNLRj6szBbfxXPDhhVuaAiOYZk9f5T6W8vHDEcKAmiR2VmGUsFsbH1NwBAHwoBhFkDpMABGcys4NwCpxw43xoCY0hRLkWaRQQCt7cDYC3O1AQpGlX28yku5bHxUYeQwoBOZkYMBlU4Le9x+N6AksSXkVpAchKSfwhcMbXoBDMti2ALAKisOOGHHhQCh+vJGjHNMWQRY2J9QBtewqHqfEStZZz7tXePuHsMJJBi6diDZrGxOr1Iy3t5VyXcz5SfbfQi87we/j2etnBtZPn6D0uK3TXz+kDHFAeHzrrd1FNDUzBdFkPusRLZFUlgQOJythXpJmK1MXsJV9o6oGexXVxkC3EhjhWFaiGsxfTj/9+aIYD9dMxth+YVM3oMoGwdV6gv1BvZBB/wCIkGGOblbz4UR5ssZ38US9u+wWqlJMJ2FgzsbAH6PQG1sP2Vx/dvRi8YvT/NIvs202LD9HqiVdMhLIHYBfypmxsScLcK68oT0EYKv5gLAE8RfxN78KAQ8je2hDiQMzIDbmtv6CgGWZo0xXEWEjcrfjQEtXeJ2Ei+gkhUYX4jhfxN70AajPkKKCxZbjDFgTjY4cKARGHjZ4yFUopWXG4BA4E4igETTXUqSqjhlGPPHn58TQDUcmcuc9if4DzHEcOdAILNe4A55bm9vPzoDqu7dK7HtvZrprrbTR6lOot53OTTa+czFoDAralbLEVsD+kv7a53C5peuZvdwjp7OEU1o018Xd+0W97BW4YC3fVdqUqPe3dzwHZO7+rEnZTtgXYZl/lmaHA2H8tfEgeVc/3clXOMV9v10WebKmX2Ps+qVNjdzmcAOrsAhva4Av+6voRyoxI757uFLPlIccTf4WIoBJdmZjwzEBmtz/ANNAPXJsbjN+YG550AnMvpLpmJ9QUm5JGHM0A4ZfQCXILYLzsR8vC3GgFxL6ljQHBlDR2Ax8Re3GgFFwEZbWDWuGOHhz8qAZ1DEKFuDjmU8sLYc7fCgIqsCLhrn/ANnY4G9h8sKAuZ17uXTOj7Fdhz1Tsuu3gR6BTotBotYuhQyLphjPKY5nyWbggBvzrh8uV+5mmLVqUYtPS2trRXRsqqVd+p0mKduODsO4nJU0JOm5u6HzHBj3J/ldh0j0b050llvk18ej/mWuBBwb6rcW1BB81Va6N5WrnvrtyfBXYj92Gz0lR8bse7hGPDTafLKprW8dWdVdTyqu/dR7nvJBUDTarUO0QHEZYriMA+AUWrbw+CsYf3UIx4kq8us8LuJu3fLk3xvq1GBuqI6hQq81J9OBtW1Wp4jUzWjC3BvituGFvw+FAfZX/wAo1g2m7+kMb+70xdOS4btgKA+ydAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf//SovqtR2u3TUTqdr3/AKN1hds8ml1EO7aQkm5Jj1H086j4SNVS45ha8mVu6vSTty5Y7Ufwo39rCT1qUOKk1yOj5xLdCaPXuD0v1psG/te66PUzPtGtueXt65Y0JPgshqPqk7Xv7FyHCl7SPLCr/CQsFGfu7kZcD8R/i0c5hN56R6r6f07tvfTe47fp8THrfYLwtm/uzxhoyD5GtnDZnhcQ6W7kW96tJfddHzHldwd61pnBpb9NHKtBqSNG7ggBcBYA3wsOdb1DWJu0gJum0jLcjXabKLC9xMhNjfnXne93LsvoM7b8Zca6SwX3UwiPujpUBZr7DpDmY8T9RqrKReuW7lKmXU9N9ES67xOuK+yusrioIdUHh+o5wY34kknlXWlEOsbNb2jmRrs3PwvfC16AX7gEbowIwJUra+PK/n8KAjXUkEj28iBkBub2W4B4ceFAe5i7NIVILL6r2IviDiaA9tmYMqqVW7CwsRhw+dAIcXAvGoCflBxBJvdsD8saAejVZFLMpLJYE3w5Dh50BJVBmREIUBcSSDyP7PGgNk6I08f+Muk/0s5G97ZdmP8AD9TGTYCtLM1+ku18yXqs2MH7+Haj0o7137n0ey92+hN2n08v0m3aHR6+aKIhmljh3CZ/TmIxKi2JGNcf3Uw8r+U37UaJzckq+lBaXynQZ3dVrHW5vSopN+CTOGdy9+0HV3WW79RbTDPp9Hrl04EesVBKGjgSI39t2FiUwxwvXT5HgJ4HBwsXGm410rVpbe6U2Z4qGKxErsE0nTXxUNG9tlISP0kAYg4+dWxoEX2ZQ7gRgLYkKMMbHDHxoBL3WytGym4AIw4cz4igJKStC6IQGCkEKCQDc3uQL0A7LMzTuR6cxUrELnEf7XhQD+pl9tSQxlWRrotgSl+f7aAXdQfXYGRR5AXPx4g4UBjnkaX1hhdjmItyB4LjjQEyFo/aA9TFz6MxBtzv8qAkxJfUaZiBlWaIgYEg5wbg1D1Mlayzv3h6X2O5ewNn9xZun42DEYgfV6gFbYfGuU7nqmEmvTfQi7z91vx7PWyuGuiydIRSK4W2tmEi5rZh7QykC1yRzrq90po6jFdH3bdYACQM4JLErhY4DxNZsbgbCpG09TkP+XXR3zOcQC3DxPhUIiOsxewhn3jSIj+07SpZ3OQD1rzIpLUZRM/1JEibruoQYfUShVIxtmN7+ZqEebLTfcDpBD2x+3xGbOzbM8mWwyqfotDYY2va9ga5Lu6qYvFvfn+aRe5q/wCRYXo9SKo3VCpcDDifM4XA5WrrSiIE1xKcjH0kswc3FsbAEeVASIJVsys1wn5TzGYcQL8rUAp5TC0ICXDAFcBYcLXvzAFAezsUWMe8zkMWaW17XsBhQDJ1BGmiQr6sxvIGI43oCHIT6JWx9w8FwOAsCcT+FAe+3IwJERBANv4cbjAA+N6AchilVL2C/wB88AfjegHPZZihUBS4sfl4cPjQHVN66v2bcO0/TPROm0usj3XZNbJrNTqXWMaZsx1LZY8rlv8A1wwKjgaoMLlN23mt3GNx2Jx2UtO1/Dr0U/h3y1v4+3PAww6T2outdzd/edu7v6SFOy/a8DTWLDaXYOxuUO1v6ja4Fzeud7uL+8YrRR+N66/cWubv9BY+z6pUlYQiMU9NgPQ9uRwr6CcqDRRuV9Ja68mxwHjQENsruFIBVTlBPHA8RY4UAohpFP6YzWBI/vEeNvGgPb8hYkg3KqOB+NAJzBkETXRY1zLe9yxtcYcOP7KAdhkVXUsjLZMLYhsTa4oBTsWx9vPmObLy8rgcaAS9zGXUFQcMbWIwJNvPh+2gGWXAOBlBsQguBm52xvjQFoO8cax9muwxILLJt6kobMotoYRbj4muNyFf3XGvh/MzoMzf6LDrg6kVgCLZyxxa2Y2te3wrsjnyVoIZtbqYtNotJPrNQ4Ij0+lRp3ckmwyICb38KxuXI247U2orfboucyhBzdIpt8Gk3sdterig1G8aHSdLaWUh/f3/AFcO3KRytFI3vN8FQ1VvO8K3S05XXvW4ufOvF/Ebiy28lWaUF6TUebXzHr7H2+2wK26da6rfnAPvaTpvQn27+A1WvMKn4rGw51HxOOu+7sqC37ktP3YV9ZD2OGh5Vxye9FfmlToPr1/5V+t6W1Wn74p0v09q9kghk6b+p1Gt1x1s+pLDdApYLHFHHlynBFxviTYVuYW3fjV3pqTepKOylztuvCzwvztSp7OLjxurfQl4D63VtngFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf/T+bWrC/WajJ68sjknmDiLA86AUwAV0CqlwSWtxNsD8uVAZLaOpeo+nLjYOoNw2lzgV0mokjjNsbNGDkYeRFa2IwdjEKl2EZcaT59Z7WsRcteRJx4mbWvcbU7iyL1X0r011dgRJq9Rt66PWledtXt500nzOatNZTG37i5O3wKW1H7s9pclDYeOc/eQjPhao+WNB/a27Tbvuu0CLRdS9Ga5tdpfbiSeHe9A7+8mVCJRptQik4XzPbzrC8sfahLTC4qPXW3LVwbUXyIytvCzktEoOq3pLqZvf3SmUd3ZoJsyyR7Joh9OxuEV5dQwW/gLnlVX3LjTL6Pz5dETc7wuuK+yusry+USen15BdjfEEDkRzrrCjHxZLgARlhfORa+AsflQEY3RGjzkuwtcf6qAEgLkvcZlB9XHDDAE0B4YMhsrMwN2Ck2B5A2oAjZcuYelWIDXF7nADj54UAsx5sxAN3a4Hn8ONALSAxOyypdSuVbEkA2PgPj86AfijUSMc4IvlN8bH4H40BsnRo1L9a9JLFJGM++bflzXOP1MfGtLM1XCXuxL1WbOD9/b7UelHYfuoeT/AB708jEJNDsUaErhw1Gova3z41zfcevwUq+e/ViW/eT5mPZ62VtsjFgSbKAUHH5/trsTnx4SRhC5Nwji7KLAX/GgElhIgIS6yYK1/VmJwuLUB5Ggldo8xSwsq8LWte1/6GgPdQqByosTe5sbWIFr38x4UACONbMCq5rBwed18xQDTRt7UbYjG5DG5Hw48fCgHIokcAMSzrcopxIJ4i/HDjQDf0ioyquVnkw9s8Dfz5UB475Lj2sr8nFycL3saAkwagKY2dszBlZbcbgij1As3927PP3E6fmTKIm6fiZPUTlYauciwI+Ncj3NlXDXP/Y+hF73gVL0Oz1sr3rdPK3R8M8jelNdMEVbcTEoJNxxPjXW7qKaG6Yno2Jpd0iyXzK2bGx4KxwrORG4z3p/TyHaep/USqayNmuAODML/trEiGsxWwQ+9vGli9QzSoBa399Thh5VM9RlE2DqWPUDd92VyjOmplI5AsCQGvbjjRHmyzHfrUqnbzsLBLYsmxOzMCTj9JoAAa4/u1KuJxfb/NIvs4VLNjs9USqTzHP6rSJxK8R8MK68oQyZ0zGMRrfKWOJGbyoBxNHEgbNijAEtxx/Z8KAaZC8gsc9zexOF/AW8KAeyASMrNYtlAdje9ziRx/CgG3SNMuVQQMbXtjfwtbjQEkxIYg+cBVDZiLYk43IP4UBHQlsrlS7C6XJI9Rva5xoB4SIZBCR6yRdVsRw5YCgGyY3Y3a4UlrAYj4/KgI8xPtYv/wDbL3xANhgKIMuP3nOpk7J9rJozGkSLtaY8bjbZOa8rVwHd1N5xit7x/XR1ObfIWV2fVKmqGMTB2XOCeHDHwvXfnLDAjRUbjI2KLYkkNcAY0AwNM6CN3GBwBBviOAxGHzoD0fpgKMGLGxIvckX/AHUAzlBLhQV9vib2sePPxoB0aXMHGYkOCXDY3B+PG9AJUNE97nKLqQCb40A9Hdcze4CrDAf0+NAeSgAemMC/rCHAYN+3yoBLZfbVka4sVY8CLnHDlQFs+u9P01qex/YvWdXbhu2k0aaMHb/5Xpop59SfpEUxB55I0hVQt8xDeFq4XK3iI5njPYxi6y1ybSSq95Nvi0HS41Wng7DuNqi3EtOjheg4avU3QW2rIOnO28OtlUC24dV66bc2P/4rpxpdOvwIaum+DxV33l9pb1uKj+KW1LoKf4izDyLVeGTcuZURH1fc7rjUx/T6fehsW2kZf5ZsMEO1Q5ThYrpI42I/6RNTDJsJGW04bct+bc3+KpEswvtbKlsrej4q5qGlZpJJpNTLOZ5ZB6pZCWYnxLNjz8asklFUWhGm3V1YmVRYFYwA12y8BgR/QVIPsx/5SeT6TvyVa95Omb8rG264WoD7GUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUB//Uo7qto7cblqNQdo6z3DYtXJKzfQ79oC8YzMbZdXoTKLX5tEKqXicdZ8uyri37cqP7s6c0jeVnDT8m44v0lo5Y16CPN2y6teET7PBoustJFi0/T+sh15sMcYUYTr5hkvRZ3houl1ytP04uP4vJ/EPp156YUmvRalza+Y0fWaLWaHUNp9w0U+hmT80GojaKQW4XWQAn8Ks7VyF2O1BqS3001zGnOEoOkk0+HQRmzABQApIIYc/IftrMxMpsBC9QbAVjXMN00DEHH/4mPj5XrxxKran2X0M9LLpOPGuk779141Ld43aWP2iNg233ISDxRtStz48DXO90G3gFXR4z6EWufL9V9ldZXAFC7C5zNZhkvw4XAt/VXUFMD5gACPcEbEEeIvyoAKEsG9shDj52HjfjagFoxB9snJhc4cOJANANztZhnyhnWyuMSbcreQoBCTKpSR29MZuCVsA17AigH/cUtZY2V7KfeHgLk3w/fQEebUsJY0CvmQkhifzAgG3DAUA+pd5A4wOTNIT+UHg1uWFAbZ0VOun646MaTMQm97e3C5FtTHe3AVo5p8pe7EvVZs4P39vtR6UdZ+6iV5u420ySWZTsUKhQwuw+onsTYcedc53IltYKb/8AI/ViW/eRUxEez1srog04UgOsMhF+GGPDG2BrsTnz1DkaWN8pRAM6Xtlxx8eNAexxuyF42tGCQWv+X40A/C8YVSYzJhe38Wa2OPyoBgvEJCzRnPYKI/h4UA5I8cinIRH7bflNhjfhQHuZVQEsqZfynixN7ceXwoBKSiF3JxJAXAYWN78PCgPDqGcoGiFwDiDyB8hQCXkX1EG4IwLeq3j5cKA8jRC6EWRc6g+IOYf0xqHqBbH7u09rr3pdCAoPTUROUC4vq9RjhXKdz40ws+GfUi8z9/zo9nrZwLcI1foLRyLYr9fP6vGww/dXWLWimg9D4jWuj0ybvAMEbMQbYenKxt/or0ZGpMc2WNk2fqbMSubVx4Y4gscPP4VgiI6zHdNQ5t80FlADTpkPC/qGBqZ6UZx0cjNj6vKJ1BvSj86zuCg4C6jG37ahazzZY37i4bdA9gHIUNJ08Streo/R6HmK5Hu5HZxWLXp/mkXubOtmw/R6olSwyRsRYYA5ja97eFdaUQ4ZAqDAuy4sL8OXDjQDo1ROYOmUMAuHGxA48P20A3GVCoGdUDcMwuLjxoD1vVKt2VMQSLjiBfn+2gPXmgcEFMMVMluBtwoBULR+3l9osoACuf2X8eIoBuzSSMIicxF2XkScb28OdAJTKruMGlFwceQGPjQCIwpUSSyqFYWva+YgcgL3twoBicRBW9oAZh6ZQbcfHljRAuL3f1uXsN2pgl4r/LPbAswsu3SYm1rGvn/d2Vc3xK7fro6nNlTAWfs+qVNcO0ZIJN1zNfA2HG3PCvoByxCnmZIlQBggAL8mLcx8KAlCb3FErK+QnM0V7+m9sMOFANvMhiWPL7ZcApGcbMAflhQDDSrdizcP7y2xPjQE27IguQuQDJGuPxHjzoBgguMwXMSAysMB58fCgBlICJ7dnB42NgLcLUA4f4ndmK3tbHgvjagGrM0YERAa4ZWxJGNwSbUBabu2Zv8Al/8At6R4QIk0gyS2PqP0ZY/sYXN65HJq/VMXvV/MXuYUWCsftuFVxhYooQEfEH8fhXXFEKYDE5bf3LWHDzPhUpVBs+0dFdXb+ivtHTGv1sINzrhC0elRfFppckY+bVoYjNMLh3S5cinvVrL7qq+Y2bWCv3VWMG1v0ouV6DOv0PottbN1T1zsm0DhJodBI+8apMvENHog0anwvIK1vqk7nuLFyfC6W4/j8bkie3wUYe8uxjwLx3+HRzn14/8AKxTpGHTd8Iuldbu24gSdONrtfucMOmWTMu5+37MMTyMowa+dyThwrcwrxLq7ygt5RbfHVtKvgRr3lZVFbcnvt0XIlU+tdbZ4BQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQH/1fm5Nn+olzm4WZszf9YkAUAI3tzRzxlopEYmORDY3F7EZSLfjR6VR6gtDqbrpu5PWmn066STeX3vQgZf5dvUUW5wYXsMmqSUqP8AokVV3Mmwk5bSgoy34Vg+WNDdhmF+Ko5bS3peMvxVJX+KeiNzATqHtvptPLhn3LprWz7ZKfP2JvqoCfgq1HwWJte6vtreuJT/ABLZl0k/E2Z+XaS4YvZ5nVEnbtg7c7jvO0arY+u9Zs2pi12mdds6m25kvkmRsi63QNPGSeALRqDztWF7EYy3CSuWVJUemEuDzZ0fI2TbtYecls3HHStEl1xr0HTPu30rnuyEkchpNi0TquYEgmfUnKfVxBqu7nqmBp6cuhG3nzrifsrrKyKHsoZsEYBmHIcgPCupKUfJUuDay5jZRwNuHpFh40AlzmFwuY4gjDjywF6AECmykC5H5zzIxF7jhgfjQDbRqwIcKGdQQwGLWx9XhQHg0iqxzyMDxvccQOI40BBDayCRR6pVZiDGjZ1YA2/1X8aAybRJIykxgzBsAt8BieN+VAO3yqWVsyKAzAYgg4nG/K3hQGxdFmJuteicMryb9t6xYDD/AImM+q+IrSzL5S92JeqzYwnv4dpdKO89/un5N/7y9FbBppYtH/iDSaPSvqpEzJG82tnjz5RY4DEgVyvdPEewyy7dlpUJSdOBRToXmeWfa42EFo2klytnCeuOmJOiOqdz6Wm1abs+2tEsuvhQxq5kiSZbKS1rBrHGuoyzHLHYeN9R2VKuitdTa1+ApcbhXhrsrbdaU0+CprXtoZncqHlZbOHtwWwHD9lb5qmNd3haSMqoQnAm9iLcBhja2FAKQ5EwNy4Icg3Ivh5WJxoB32FDK8a3LfmZxw+fOgGyFLM7elALqPE8fPjQCAFkst8q5cyhicvD5/CgPc4ldXykFlxjK8cfDne9ABUMFVFHEC4uLEcz8OdAeNZhbIyr+YsScfAA28caAchT3HhWxBWSO5sTf1i2NRLUyVrLVfdzK8vcbZi49adOwqQxvfLq9SCbKcK5Tua64OXbfQi77wKl9dnrZwy4ft5pze//ABuo9sgXvgb4cK6xayliYHpMRtvUBmdha5S65fWA1hgWvhfCsmidwmaHI2z9Re8xW2pQxYWuwY5fjjUIxjrMZ0vY71t4ctkEiXJQC3rXnmNqmWoyJvVTX6n34Na41BL+XpFYowZYz7gC8/bX7fMwIWDY3Vb2a5+i0JJFr8rDHnXI93nXGYzt/mkX2ar9PY7PUip59TZgpBGKL/aOGNdcUIphmsRGVAa5VicL3sT8POgBstmIAUgWY24WxtfGgAlXUL+X2FBDHAte1yLDyxoAXI5sxIewIJxPgPiaAWELR5Mqk2/UHjfC44+FAKKrDYRBjmBBVhYY+XHC3hQDBf2nJQg5sVub8fCw48BagJemQtFJJJGt3zHncDE4cMKAca0UcaxoXVLrDwsL/C+GN6A33d+3mq0fbDae5Ee66aWHdtx+hj2YxH3ImBnXPnzFTjDwtzqqs5rG5j54PZacFWtdD1bnhN65gHHCxxG1ok6U5d3wHdO8UUMHYntZnWys+1mUAAsXk2xySfma5fu+65xim/SX40XOaqmAs+D1SqQILmJMG5uowyjDC1d6cwNyRpLYuC63BktjlBPGwNARdXJLFGogQqpNhLGMVAHDyNAJggdhIZ5CDcZAHDHliRiBa9AOrpliIdmOXEi4uT4jjzvQDyrlU5lVcq+lVHMkre9j8xQCCPV6UwIsFF8Df91qAdZlKkC4sRlYf2igEviFVRZw2C4HMLftwoBn2mkYSO/pjwXEfCxxFAXJ7m7Htm5djewq751VpOmdFFoFn97UQ6jVyzX0cSmOCDTqxZ1FiczKvnXEZbeu2syxbhbdxuW40ktL1uT0eBM6PF24TwljakopLebro3Kf6FfBJ2m2hUWHQ9SdcaiE29zWSw7JoiQOUUH1M7D4yKa6PZx93W7dpcCdyXK9mPMyp2sLDclPjpFc1Xznh7i6zRMp6V6X6f6SUC0c2i0Q1WrXwP1WuOoe9ua5axeTwue/nO5wOVI/dhsrlqT8fKHu4xhxKr+9KrNZ3nqTfeoSW3ze9fu7LbJ9XO8qqcPyjNlUfAVvYbB2MMqWoRhxJI1rt+5d8uTlxuphmAyhUAVlYZVwxFvKtg8j7Kf+Upm9jv6WOHudMBRzFl3WgPsbQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQH/9akGq6M2bV6iY9M9wdj3N2dhHtu5GXZ9VmJJAC6lfZJ+EpqoeZ3LXv7E48MaXI/h8b8JvrBwn7u5F8EvEfPo5zC7z0L1hsVtVufTmuh0hXMm4LD9TpGU/3Z4DJFbzzV72M1wl97MLkdreb2ZfdlR8x5XcFftKsoOm+tK5VVGnCZUvd8/qOYLj8QbniKsDVC1mtiBYEBhYnzoCXtBD73syyZEDa/SqjMb3/XS5IxFh5AV53tFuXE+gyt+UuNdJZP7s9xj1HdxGiAVY+n9GqMhBDWm1WIPzrmu58lLAVXnvoRcZ+qYmnorrKyBgmUXAIFio4ZiMLAV1JSiiylwQwuOIZbgX5W87UAj3Aly7Zsz3IGOHEg3oBwEZcgZlUi4BAuwPDH5eNANlYgFS/qW9zlsAb+Jvw/roABCuzK5YO1yiniTibcb48MaAQMwY5wZGLFlBADIQCPK/40A7gfaclVJRsxAscRY+HjagHFY2AvfIcCLEi/7KA2LohhH1j0mzO0gj3vbbmMXI/4qM5b48bcq0sy+Vu9iXqs2cH7+HaXSWV706vT6Hvd253HVa2PQ6HRJt+r1OsnJtFHHuEpcsccLC9cb3Ztu7lGIhFNuTkkt1twVDoM4moY+1JuiVK+CTOHd3922bf+5HUe77HrYt10M30h0+4QE5H9rSxRsozAfkKsL2rpe7uHuYfAW7dyLjJVqnr8plRm92F3FTnBpp00riRzV7scrOwDgB24g4ggfGrorRuL03iOMKD9N2sW8bWw50AFAkryZseCOBfhw5YYUAe8WUKwULwJ5Ek3w5C9AeHMqspILkZVtY/08aAbWF5DmIu6A2BN7C3C1Ae+w6XAkJD4Mqjlx54fhQBGVBYgYpcENyB+FAOMgJZgSBlxPEAg8TQBBaJ0v6WZ05cLtwNQ9TCLO/dvJJN3C6eMEX08cvT0eYOoXMRq5/VcXrku5rTwtyn9R9CL3vAqX49nrZxLVuF7f6SMgXG4ahcDwNuA8jXXJ6UUsFrNc6RbNu+nd73zkD/0WxrNqg3GPbRO02z9SCRi2XWRBPL1Go0GMdZjumpSu96ANYqs6BQTx9S0noRnHSZjrP3f8Rb7LCVFtRIMcT+UcrcqxWs82WN7+zJ/l72EjMLQsmxuJLqFz30egxGW+BtwrkO7bri8XTz/AM0i+zdfyLHZ6olVUjxNuBBKgDE4f1V15Qi8AgQC91s1zjyuRyoBlAWu0bMP4S4AOB+NAKGlbKwzBxa7HgcCOfGgBMyN6vyWyi9j8BQC7lCGJU3wTnh8vjQCjIZcwbAMMV/MWa3EmgFRoI4xchmW+RCL/icKAaQG/vMzLOfSRxAwIAW1ASCuZVVr5AAct8Rblh50B2/e+oun9X2C6Q6a0O86Vt823d5NRrtiBb3o4s+tZb3UC1pFNwedcxhMHejnV6+4NQlBJS3G/F/c+Qur+ItvLrdpSW0pVa3d3950rvIyjsr2siJd5GO2s2UXQ32x8ADgBj+FU/d3/t8V9r10b+baMBZ+z6pUWM3uc/uhrYAYC3xx/wBNd+cseO2dXLOLsLEXB4EH+rnQHkpAa3th0UKbDhe9+J5fjQCULqpDuxDN/vAMqi/G2B/dQHgVAlme9iWbmbnnzwwoB4ZA5eN8gNrem1jb8tuFAIMqKwJzBpCDe1hl4ePPxtQAMVdWZSGY4WJbH+EeFAKMi5BZswIsCcMeNgaA89wR52B9DLcthclTz/qoC0vevWQarsX9vl/bjfTaD23Un1Y6GEZjhgLiuSySaeZYyO8/zMvcyVMHYfB1IqopYr6gEIwsDcfHEk/ia60ohYdYgubMDIB6rAC18Tx5+NATNDoddukraTbtHPuWokOGm0kMk8v/AEQsYYg153r1uzHauSUVvtpdJnC3K46RTb4FU3g9tuptJFE/UD7f0dBKt1l3/WRaSQcLW04Lzn/7nVY87w8nS1tXX6EXJfe0R/Ebn066lWdIL0mk+TyuY+u//lZ7VsW16fvgm0dUxdTzyP03/MJdNpJ9PBEVG6BBHJqAjS39VzkAFud63MLevXau5b9mtysk29+qjoXKzXvW7cKKM9p7tE0ufXyH1qrbPAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKAKA/9f5s6qNV1M92LEyOTJxwueNATtn3/fNidZtg3nW7RNc+4dHqZIQTyBVGAPzrwxGFs4hUuwjNcKT6T1tX7lp1hJx4nQ29u4m5axFXqjYtj6wws8u4aFIdWQPDVaQ6ea9uZJvVesltW/cTna7Mns/dltR5ja+oTn7yMZ8a0/ejRjp1fazdr/VbL1F0bqGADajbtRDu+lXD/2GqGnmAHgJTWWxj7WqULq9JO3LljWP4UY7WFnrjKHE9pcjo+cmbX0FtOv3bZtR033C6f36OLX6V22/WNLs2vyJMhYLDrVEbPYHBJSTwFeWIzKdu1JXbM4+K9KpOOp7sdK8MT0tYSMpx2LkXpWh+K9e89HObl90Esc3dRn0qMsB2PQBVP5lPuT8uIv541XdzKfTlTz5dRtd4a/F6fNXWV6ZFVr5yzHH3BjYW4murKQSDmAAszXOcXv8KAXlAUZhdx/Dwvzwv5UA5diVZbqij8pAHyNANkknIshyniAMQLcv66ASrsXAAAL8LG3Dy53oD0NibxgKB+QnAeNvOgF+5GAS5bBfST/eIPM/CgI6lTluzKn8VmuCL8Ta1Abf0Pb/ABj0goP6Z33bwBYD/wCJjP7edaOZ/KXuxL1WbOC9/b7UelHafud1KJ3A2NVYKE2KEBjiCTqdQcb+HnXN9x/kp9t+rEt+8nzMez1sriXCu34gjx42+F67I58SZcRnbJmY25WB5UAWVkkABfDB1uRh+6gPC4dbLGHIX8ztc42ueAoBfoMasg9RPCw5eN6AbZCTcY8m8bjHhQDqEqthgpJs1ib/AA/CgEyeoglcY8AQcAPG376AZAZlIKfnPqUfmJ/00A+XElmAyMCMo4ADnhw5UALG7vdhkJkF+d7sMLUeoItF928LR9wOmIiQZF6ciZmvbH6ue1/wrku50aYa5/7OpF73gdb0ez1srrrNSf8AB0emdMrfXTMrC5v+mpPwtXWbpSx1MxPRkgi3SMgXZiUwXkysOFZsV0MV0/qP+6eqBlYiTVxq118WJ/qrEiGsxXT8iQ7xpZD+VJUJ9JOGdRUz1GUGbB1G0k+7bxIU9sHUysFzY3uQBy/CkTzZZn7goCeguwcqsAknT7FFH/4JoSReuQ7tRpicXXz/AM0i+zd1s2Oz1RKqgEAK4yx5sRexIIxx44V1xQnjPmKkJ6oz/vLYerGxv/XQDarclGT03GC4X8TQEoOxCnAYZccSbYYnGgGHUsSbWe+I5Y/1UAoDLlH8IOPA4jzJoAfIHZVRXVAcxOAoD0MJJQ2VvSpuoOYXJwwAAoBJdEB9YXG2S+NvOgFiU2Ia5FyVIHytQHjyiPTtdgpf8b+A4m1vCpWsFt+8MiSdke1cigK9trFsDY/y2QYjGvn3d1/3jFfb9dHVZsv7fZ+z6pUJ8nqJdhJc3K4Ejma+gHKnsbxZmEl/UBYXBucOXnQCzIGF7FiVv6ja3jbzoBJdghcr+XB2zWzE+YoDxWYC4IUpxtwN+JP4UA4MzKQr3Y87C+HLHlQAxDFQynDi9gBjwH7aAQwYElQLcif7eFAJJUl7Esl8FGOFx+6gFFCgGQl817IMQD8aAtr1z08Op+ynZGKHctq2dtt0SSbjuO862PSacK+lAGQtd5GuPyopbmRXCZbi44fNcX4spNvVFOT18i8NDpsXYldwNjSkkt103OfwHEP5J222kj+a9ca/qnUILNoemduaOHxsdbuJiv8AFYWrpviMbd8i0oLfnLT92FfWKb2WHh5U3LgiuuVOgS3VnSO3+2vT3bjR5kHo3DqPVS7rIMcD7K/Tae/kUIqHgMRd97flTeglBcvjS50SsTah5Fpccm5c2iPMQdw7idb62F9Km/TbZtzLYbbtSx7dpwPDJpFiBHxvWdnJsHaltezUpedKs5csqmNzMMRNU22lvLxVyRoaOzLJLK5YyMxBZrlmJwvdjibVZ8Bpn2c/8pNAmm792a4aTpghb3thutAfY2gCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/Qonq9D2w3SbWyaPe+oOk9U0rX0+7aWLcdIDc4DUaNopbfGI1Uu7mFnXCF1ei3CX3ZVj+I31DC3NUpQfCtpcsaPmG27a73ronXpnd9k61RjcfybXRHUoq8jo9R7M9/EZDUfWrVv38Z2u1F7P3o7UecfTpy93KM+y9P3XRmp7ns+6bFOYN62zW7TqEvmTXQSwMbcCPcC8asLGJtYhVtTjNei0+g1Ltmdp0nFxfCqGOaVbXRuKg3JufiPjXueZkNiEa7zsBuFtuejIZmtdhqIzzAryv+7n2X0Mzt+XHjXSd7+6XSw6XuvMISzpLs2hkFuK/rakWucTXM9zFTL/ty6EXHeD5r7K6yt2XMdQzl+VmwsMMeBxrqykPMwaOSLODmNibD0KLH50A8vtrlIfMQLZyeNuB8qAeWVWAVTfMob1Hjx5UAgAlixLBrWMYJC2A4487caACFNnwtgAAScQeB+JoBmV0hC4FmZhdeJA8uVqAHJKor4KSc6cTfLccfKgGUjVifbJJDZSt7gE/voDdegIlPWfRkeoUvfe9uEoJP8WqjHyrSzL5S72JeqzYwfv4dpdKOx/dFpoZO4Wzvp5GOmOxoM7XvddVqEsMOAtXNdyEvgp01e0fREuO8lfiI181dLK6SIIlsZFxT0IxNyMPxrsjnyPkjlPqLC4y573sScbj4nnQDejLaeYo7+hrqGIsoJODUBO9kS6kqbpEFDe4ODFv4fl5UA1b22YxC8VrZf9rhceJvQA+YgZUuwOIGNzw4CgDNJY3YkLb3LnKAOXxFASMliHKhi64WPDxIJwJFANAx5kszZwrA8SRj40AGRl9JZXBHptbHiKAVGgMsGRyf1EGY8hnH9RqJamSi0P3eTZe5WzZSLL09CsdyMANVqeA4Vync51wk36b6EXef+/j2etlbtVIv+EI4yiu7a+dka59A9leHEerwPhXV7pTR1GN6PNt105azASDFjbKbN6hYcR51myNxhsLo20dTABWJ18ZUEnDFrMPhUER1mM2Jgm76V3j99UlQmJsL/qL/AHRektRnEz++y5d43n1K6vqpiGJtcFjY+VQjzZZ3v7+p2y+3wkksuySK/C5A0WhIP+uuR7u/OYten+aRe5r7ix2epFVswjbBr3wJOFrcB/bXXFEBYmNi7XuuKqL25i4HkaAUvttmyjOlgCScBgMfx8KAHDoY0Uesi4UMVPncG9AMEu2U+qRcLNYjz48LeFAOFmxyr+YEKfPjfDnjQHq6dHhkIYiZR6rcSeNiPPCgAye3pL2CSyrYRcwxvwx5WoCBBALPJK5JbBV4E4cb0BJQrfLmCAKQS7cD4eF7CgF6jSl42Ie8hT02vY0QLfd34dIvYvteBmfVRnbElDXsubbJHIA8DxrgO7tFm+Kp6fro6nNq/AWfs+qU8khdnLXb22y5STex54/vrvzlhpMi3ZGJdWADn+9e1APSS5HXMt1ZsG5c7348KAcyLgBchvym9+RwHOgFkYFAbZQA7qxvxw/qwoD2NigH91Bg7GzHH99AIaRGwB4qDlJJGPAj40A0ciSxyK2cKCPaJwynC9AeJlkkuZDIAWsVFja/9VAe6fMqxhgzZWuFNgPnQFoO7Om0+m7FdhcsgZpoBIxJtj9ClgB8ziPnXH5Ev7pjeP8AMy+zKvwWH4uorDdY5Wym18XUm4uPOuwKEWXjYrErXdluqXJLcsAMTThBt23dvOs9ySPX6Xp7VwbclydduOXQaTKf4jPqzElvgarb2cYO09l3E5b0fHlyRqzct5ffmqqDS334q5ZUJv8AhDpnb5V/xH3G2xnu2fQdPRS7tqFt/CZF9nTg4/8AtTXl9QxFz3OHlTfm1bXJ40vwmfwlqHvLq4opyfLojzn18/8AKsbpIaXvlB0rDvWSGbpz63Xby+mDTEjc8ntwaZbRBbG93Ym48K3MKsTpd9w4FFPRv1ctfIjXvOzoVtS4XKmnwLVys+uNbZ4BQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQBQH//0fm3P69VP6Cre64dAALrmPLnQEYwwZwoFsfSosSCDxzccMPnSoNr2zr/AK22SFNJoupNa+hHpbatU31ulYEcDBqhJHa/gKr7+U4S+9qduO1vrxZfejR85tWsdftqkZum89K5HVGYbrrp7XusfVHbbZde4t7u47M0+yaoniTbTs+nPzhrx+nXbXub80t6dLi56S/EenxdufvLcXwx8R82jmJ+27f2s3Xc9tl2jqXfOldYdXpsm273ok1+mZxKhCDV6Eo4LEWBaGsbt3HW4S2oQuKj0xey9Xmy0fiJhDDTkqSlF1XlKq5Y/uOlfdtGv+a8KpIQ3+H9C0kakFgzT6q6kgEE1Xdz1TA6PPfQjbz91xP2V1lZvzEDL7bKbEC2K8fnXUlKJMcIbIAVDGxjBuePMnwoBlgUCjhZrZRfgePG1ATcgYI0n5gMbWBHl+2gE5fUxxAAufG3O1uGFAesQD+ZbtxaxJH9OVANMgWxdSy3wc4/ADAUB7kaQoxxNzlNr2HhbnbxoCTGVBVlsua4LcLg+QHhQGzdC5m626OIJud+27HxYaqM860sy+Vu9iXqs2MH7+HaXSjtX3L6HWT9zen9r0X/ABGp1u2wafRwFlF3n1s6ol2IAuzc/wAa5fuZONrL7k5OkYzbfAlFMuu8MXPFQjFaXFLlbK7b/wBP7v03uuo2XftN9FuujCPqNIzI+RZEEiWaNmXFSDxrrMJjLWLtK7ZltQdaPStWh6yjxGHnYm4XFSS3P9jHJHiWJDMLn21GBIHMEeeJ8a2TxPQ5D3yAAAe6g4E4cBQDwnNyqj+G4U4Wvz+GJ+VAMPI2ZAhOZuFscb8DegPUcZyz3PLDn4cPCgFN6VGJCjix9RBHDGgBTmBVCMPUGxuPnwHnQAVCWDD1gEqzYEnHnhQDT+q7XNwfWwHDj/XQEqxDIqvkAeNvE4MPIVD1MIsp92+jMXcHpyNpCwbp+NixtwOs1NiPnXJdzI7OEmvTfQi97wut+L9HrZwbUwKvQ0MipjLuM9nFrkBABf8ACut3UUsNTMP0YAN1hEgNiTlI45srW/Cs2huMXsKou0dUFizE6uPIOV8x41iRDWYvp1GO+aK6mxnQWFv7wwqZrQZQMv1VpVTfd6RQEKauXKotlAb1VCPNllu/enaDt/2DcTMBLsbSBW8tFoPD41yHduLWMxj359ci+zeX6fDrej1Iq1KtzHa5JvcDG4vywFdeUJ4CpFiQY14XNscPhegHAjD12spAbIwupItjYDGgGwwLDK3qJuBYm55XoBbZVBuWBbAHiBYchy8KAYLuqYZlUG1hyJwFASFlKg2AIK3te1jx+dAePKWX0YuwuJeVsRQCR+otsmRQt/cFibg8zjQDDRm1roVBJBIxPK54XPyoDYdX0x1FoOnNu6p1GjKbBvUxh2vcWkiJlce5dcoYuLGNuIHDjWpazCxcxEsPGVbkFWSo9C0btKbq3TYnhbsLUbrXiS1PR/vuFo+78Tr2K7XymQuZZNsN7jltbqo+NcX3dVM3xT7fro6HNn+hs/Z9UqUremRc1hgLG/z8a785YYkRWuFXLYi6geJ4lsKAQ3HI65iD+mtuHl/poBYHt4nDlka5sPLhwoBZUflDC1jgOAHP9tAJVFZQGv42JFj5GgGdRcGNLnKSBmsABjjwoDzIuMr4Hk/LniQRQDgjjAugIBNpGBGI58eBoDy2cggGIKbBlFgQLeXlhQFye5W2dOa7sr2Ek3/qc9P6KLakYPBopddPqHbRQq0UMcbRqpUC5MjqPjXEZbcu28xxfsobbcvOUUtL163yJnR4yEJ4Sxty2UlvVro3P9Su77x2q2dQm19J7z1hqYyP+N3/AFw0WnYjn9JtwzkeRnronZx13yrkba3oR2n96ej8JU+0w0NUJTfpOi5I/vES9z+ooI0HTWi2nomCQZR/ItvigmUA2I+qlEuoOHPPeo+i2Jut5yuv05Nr7qpHmJ+oXY6LdIdlJPl0y5zTNw3Hcd4nbW73uWr3TUXv9TrJpJ2HEX/VLfsqys2bdmOzbioreSS6DUuXJXHWbbfC6kVYkVLoCDgHcEC4wv5A16GB9mf/ACkzfT9/AFyqJOmArWtf07rQH2NoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoAoD/0qNarpjpLX6jUfyDuHo/deVsu2dQ6Wfa5s2bBTqFGo07eA9a1UvH4m173Dya37bU193xZczN5YWzP3d1cU048+mJC3Ht31tt8B1jbDNuO3i5/mm1NHuOly+PvaNpQPnas7ec4Sctn2ijLenWD5JUMZ5ffiq7O0t+PjLmqaAc0hKKAJIG9aMMrDiF44j4VZrSqrUafAIaXJZcodlBDulzj54eNAZPYULb5sQUEs256JeVvVqI7X5V44h0tT7L6Gelry48a6Swn3VEju5IVu5Gw7e7FsTmd9Qbiub7mqmX8c5dCLfvA/1X2V1lbg5UlGVjmH5fPCwLeF66opB1pFJHrAN8BytjhcY4UBHxmA9uxMbAkngQOFieGNAPwE29sWd0F3K3Pq4m/wAKAkEWFwtlZcGBuccBxoBJGJCnKb2bMOIHw8KAQy/ly/lW1+NsL2w+NABuqtZsubxNzgBfC44UB6hXMoJBCgA8/PHhhQG0dGMkPWfR+pmIRId824kgXOOrjzFVHgK0sx+Vu9iXqs2MJ7+HaXSi0PeDTafXd/e1v04E/wBW+zuDwLA7q9/SfKuR7sbP0m/veP6iL/Oa/HWvs+szkv3LaaLS95OpkwhL6bbZUgINlDaSO9ieNjflV13VSWXW0t+XrMrs8dcXLiXQjg3v3NmOd2AtY2Jvx+FdCVIhZjILBCzR/lIuBwN/w50Atw5JufUQLnlhjQDecu2U4XNi5sCCbc+PD8KAkhM1wFJQAhZB+XL+2xPnQD0kTKyqQefqXnYX+fLnQDcaAekm4IuFthj8PGgEOHec358CL8PEeFAeTKU9QIsozBB5/PmDQHkc5zoMmDEWJN+J8+fnRgtJ92sj6vrrpZ3tHJL05GpQi7Ko1U5GIOINzXIdzJOWGuV/qdSL7vAkr0Oz1s4dImbt3pcyjMuv1JLHgMOHztXXrWUkd0wHSQCbzAsYDrmJOUE2GVhmPGs2xTQStthEOz9R+2fcz6uMtYE5bMbk/CoMY6zF9MRI297eQFdjKpdBfH1Lw/GknVGcdBkesVP+JOoZBYKmpawIJBug41C1nkyx33C6lx0L2Jhyho4OnisMgsAwOl0IFhe44ca47uzJvE4uvn9cjoM4SVmxTzeqJVIyGRstil/Ve98bXxHL8a7AoB+SMiO9wTbEjEHzP4UA4mYxDPgVvYm5OI/roBoR4M9yb2JIABsTbH+hoB+SFrBityQQIgDflcAWvxoCJJgM38f5chOJBGF+XGgEB2k9QwAJJW1sTgbAcPhQC/XZAQXjHMGxFjxoBC6gMWdgVXg3EW8iDxJoBxZFfLnkCqtmxubefLyoC1vWW2Iv2s9qdSYsyndpHfUsCvpcbiFX9gIsa5TLklneJe64r8pe4uv02zvVf5jM96W0a9ke1GgWQCWT+WSPEQSoB2t7kvw44VW93qfVsVT0/XRt5tX4GzX0fVKim6r6wM2FjYE3tY44YeVd6cuNK2IYSAemx8MMOJtQHpVrgC+bNfiTjfgDywoBVuBDZSAA9wSbDiflQCgAMArc1CEWGGOPOgBgVB9NrKGaxJsLYHDhQEIq8r50yZbgkcbMON1POgFLKhuQ2UAgWP5gOWB40A48oUZhdioOVl4i4wFseX7KAQpci1rqRgTcAW8B5UBaDu8C3Yb7fmXMVfSjMuBOZtIASP8A0K4/JNGa4xcNfxF9mOnBWOLqKq5vbzWUtcYfLnhXYFCO2aUhk9sICDl5BlN8QR4UBmdm2feeoJmg2HaNbu8qkD29Hp5JyB55FIA+JArXxGLs4ZVuzjBcLSPW1YuXnSEXLiVTcpO3m57cUbqjetk6PXG0e4a1JdWuHD6PRDUTXtyZQa0PrNu57iFy7wxi1H709mPSbX0+cfeSjDjen7sas+u3/lYaLprQ6fvjHsHUWp6jlMvTn8w1T6BtDplNt0yDTiWRpHB9VyyrysONbmFuX7lXdgoLcW1tPhrRUXgqa96FqNFCTlv6KLwbp9ba2zwCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/T+beoRRr5wxAJkfKpNxz+PCgHtNuGv2hjqds3DU7drs2ZdXopX07gX4Zo2U4153bULq2ZpSW80n0mUJyg6xbT4NBtUPdDqieERdQDbes9OfRk37RQ6qS1+H1ChJwf/olVv0TDR02tq0/Qk4/h0x/Cbv1G89Fyk16ST5/K5ybF1B2z3UZN16L3PpiYXB1vTu4DUQ48SdJuCsfkJxU+wxtryLsbi3pxo/vQ64ke1w0/Kg4v0XVckv3mQ2vpTpXX7xtGo6Z7lbZqWTcNLNHtO/aafZ9V6ZUJVXPv6Z2NsAJRc8K87+NvwtyV2xLTF6YNTWrwSXIZ2sPblOLhdWtaJJxevwrnN5+6kAd15GtlDbFoMpseTzi1iD4VXdzf+vp6cuhG13g+a+yusrmVUTAMQL8FJuOHz4V1RSCpcI5Qze47flYCwVbg2+dAQo3ZUOOYG62J8+fxoBtpWSUSot/QY3jv+YWAx+FAZOGVHhb0AWwbmRh4WP40A8ALEgX9PpAxtbA3oDwLmDAYKp4DCw/Ze1AN+3HgCwETLgBiSRyoBqV4omKrhIwsB4W4caA2PoZH1vWXScLOY4ZN921ZAvEgamPD5Vp5i6YW6/Ql6rNjCKt6HaXSdf8AuT9jTdwNi1Oi1BVdPssYAVyrZhqpziRit7A4VzPcjxsFNta7j9WJcd49GJjwRXSzgkgj1s8s7SNNqmt7mpkdnOAwF2ONhXYpJaEUDddZDl0RPquLDC1jcHlieFhUkHsemCMpvYsQBh+2gJmoiUJb3CpJzFwCL3FrfLxoCGkK4BiGbOLWPx+dAOrqACBmDpKQSOIHHnQEqRlZQxVcCMrA8SLeWFAIx9JLLnLEmTDAG1rX/CgI8mLnKMrJfNID425UANnIDM4GRsmUC5N/G1qAFCl0UW/3qAobA8R+GNQ9TCLOfdppJoe4nT0UynOOnoC0eBwbVagWABIF65LuZBxwk67s30Ivu8Mk78aeb1s4sf0+3mmIFg+v1IJHEEA244c669ayjijA9JyOm9QBGLZrqSw5ZWJItbwqWS9RK2+f/ufqP2Xz31MayXHAMxFxUaTGOsxvTDsu9bcQzMxlQBSABfOvG1S9RmSusIR/iPqBVX8uqILWuLZBcX48qhHmyxffzTyxdvewM0n+7m2JjFKSDf8A4TQ35n9tcd3bg44zGJ+f+aRf5vJSsWOz1RKuWDHKrZM75c4Fxe/l/XXYFAD53uDja65F4NagHlIZLrlUE4Rkg38xfE248aAWcucKbFMxaIcx4DgfCgPZpxHlIVQymwUYkXPG9ARPRIFVmz5WUk/9Ly4CgPIogJAfdyi+AXG9rHlQEqeBcq2ayucVta1/PGgMf9Dcqotf+HDx52xoCYmjXLZyrKBZlxx/oaATqNRn0C7fFqZV0tyUgMrFU43HtnDG5xqFFVrTSS26ULV92dNB/kt2y1Gm1B+q052tZXViVJO2SXx+Irgu7sv7vio8Mn+NHT5sv0Fh9n1Spq6ixIkFlUlTbxv4Gu+OXJYSHKHU5SB+m1rg8Bb99ALSMZhZv1BYtbAfE8KA9SxvdSRjmIHIHhw8aAAQri4DNax8PHww+NAYzU6gkyxxKFzgoZRyF+Xj86A9jkyhQq5bDJa+PM0B7AbTMXvIBe68b4fjQEqRQI2zyBlzfpn+IC+H7qASAAI72sQfn5YXtQFvevdii3nsh2LTU7/tHTel0WiWXU6zdpniBDaYWWKOJJJJWBOKovDjXDZdiXZzTFtQlNt0pFV3d1tpLlOlxdpTwVhOSikt18G5us4QNN2p2hSNZ1DvvW+qFzJHtGjj2nSG54fUa0yzMPMQiul9pj7vkwhbXpNzfJGi/EU+xhYa5SnxLZXK9PMRW6/2jRSZ+mO3exbTIPSmt3Iy7xqr2wIOqIhB+ENYvLLl331+cuCNLcfw+N+In4yEPd24rhfjvn0cxhtw696y3pjpt06l1+o0C4fyyCT6bSZbflGn0/tx28rV74fKsLh3W3binv0rL70qvnPO7jb91UlNtb2pciojXXRAkhLrkY3TCxF7cfOt+tTVPsx/5SS5dH34PjJ0xjfHhutAfY2gCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgCgP/1KQantzrtTPq5emuotg6uSSRiIdDr0g1eUn8p0mtEEt/JQaqJZxbte/hO1wuNY/ehtLlob6wEp+6lGfE6PklRmmbzsG+dPSezv2y67Y52wtrdPLCD5hnUA35EGt/D4yxiFW1OMuJp82s1bti5ZdJxceNGuCKTN6WLoSSMvDDwrYPIcN3VVMoJAOHC1xjjwoCZsiuu57Q0Ts8g1+lKXHP3kth5GvK+q25cT6DO35S410lj/ur08ul7qqmoN5DsGhbMLkELPqv21zPcyLjl9H576Ilz3haeKqvNXWVuAytI1757eq/AEYjnaurKMSWTHEKxJUnHl40BE9qVXFmLDNwXhQDjeqNELXY3KqOOPG3jQDmnkyKwY2QcVUZmJPPD4UAt9QEMRObKpPuWX8wBGINvKgGRuSe6UAIjNsp4N8/HjagJKTRyAMwCqtwzNhawwFqAiS6eMEzQyEpI4V0AJKgnGgN17dIV646Jid2GffduIBFhjqoxiRjatLMvlbvYl0M2MH7+HaXSjrX3U6VYu5u2QKsWmRti02UKLRqTPPmtzb1XxNc73KVMHJb0/yxLfvE64iL9HrZX2MKisoY2VSxIFr8ceJPz5115QDiSExE3AOYeq2AB5jzxoBAd1iEa+thYEHHkedjz5UBHZUJLLKyyAZmBsAAbeOJoBCnKyk3YMpJLWN7/LCgEtG5WwQqgIZ7cf8ARhQDsSe5HY3MY/3YA/LfA4/soBcyiIetCFAsotbj486Ab+oeMIEZcoBwPEH4fKgHQ/ukAgqbLdr5jfHEcuNAJF01EWZycs0ZNudpBc/OolqfESi0H3Wyx/5j7MY2OVun4cSMLjVanj4ca5LuW08HOnnvoRed4VTER7PWzguplP8AgLTgG4TcdQtyeN1BthXW1o0U0NTML0b691hsQgUlyT5KxtWcmRuMVsPr2jqjLILpq42I5mznhWLZEPKMZ05J/wB+aKwCkzpmxP8AeGF6m49BlBGw9TTX3/qByTf6txl/MbqLYWojzZYPv08f+W/YJFchl2ZzIfMaLRc/jXHd22njMZTz/wA0i+zZUw+H7PUisSKciuWvjgluJwOY+FdgUI22pdQoSygrhmP7RzGFAeF1eT1+p3GW45Hj+FAPmG+VmU3I5Lx58vCgIbLI8pIJaZSCzAcvMUAv8ge65WYXBsDfxtegALf0mRkBXMy3A5cjgOVASImyMpiJeM+osw5E/PlQDyMfdzZrq1rqw8Lnhha1AJD5ncFiLDMPHCwuaAgauNTG0udQecRFmYnmpBxwxogXH7sadYft87UagokTy/ywySICsjEbfNYMBhYLb1ca4Pu+n9WxL7fH5eg6fNX+gsrs+qU3kicyj1OTKwxK29LDEm3413hzBJijggQxK6ySg3ub4nAWF/CgPJNdHHmIB9JsBfDC+F+dqAZGuWSEBbrMcWIF1AxBIFATDMpLWLIWFkuuAw4nhxvQEAepzIxsL3ciwXE8cKAVKJHJKktiCSMONAKiT2wTI98xtzufjQElSpuFAK3ykA8Rzw+NAJQBAoJJIu4AxNr8j40BZzvJptTD2S+37ObaebbwVtckW0UJufiCa4/IotZnjG9/8zL7M2ng8OlvdSKqqgzyH3DbmG5An8TXYFCOSe5JdlfORY3AsAaAXAjBshZpJZDZYlBaRr8gouTxo9Cq9QWl0OgaHtz1nq4o9S2wSbTt8o9G5bu8e2adl5kPrGjzf9W9Vd3OsHCWyrilLegnN/hqbsMuvyVdnZW/LxVz0PsB/wCVlsGm2HTd8Iouptp6g1M8vTh1UO0yy6iPTZRueUPO8aI5a5tkJtbHiK2cLiZX6t25QS1bVE34Ktrw01njesq3Sk4yfBXR4aU5D611tngFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAFAf/V+bmqObUTiNM6GVwwYX/iJvflUp0Bm9p616x2BTpdr6n3DSaG9m2+SU6jTsDf0nTTe5EQR/s1oYnLMLiHW5bi3v0pL7yo+c2bWNv2tEJtLe1rkegyx692zWi3VPQmx7oJCPd3Db1fZtWcL3DaQ+0T8Yq1vpc7XuL9yPBJ+0jyT8b8R7fGxn7y3GXCvEf4dHMSBpe027mI6ffOoOjNXLYfT7jpIt20gJwH62kMMwHn7TGsvaY+15UIXV6LcJckqx/EY7OFnqlKHGtpcqo+YyW29rdy1G6bZqOm982DrTRJrNNK8e17iiapUEyFmOj1n08+ABwCmvO9m1uNuSuwnbbT8qLpWj/ijtRM7eBlKScJRmqrU9OvedGdF+7GRZO7jFJMyJsGgAdscPd1JGHLjWh3P+Q+2+iJtZ98z9ldZWouSLQqWUnK4N8fM+FdQUpEaIZ2UnKGN3Y4tj5DjhQAZvbTKSVjNvUbcDe1AOBlb22uASotx4C4oB6Nc7OTa7KBiLWzDjf4UAzMixs6iNmhl4Y+kHjccfwoByLS6cqyun6mOV8QBhgbeXmKA8OjBQXwdiRa+H48caAVB7ekCmMNLI/52sbXUkDKSceF6A2TorcQnWXSM8SCQw73tzs1iLFdVHhatLMvlbvYl6rNjCe+h2l0navubn1W/wDcTpmLTaUz6zU7NBptNp4VZ3ld9ZqFRQLcWLWA/ea5nuTergJylRJTfF5MdJdd47bWKjFaW4rpZX3ddl3bZtwfb970Gp2nc9NGnvaPUo0U0cbKGTMrgGxXEXrr7V6F6O3BqUXurSignblbezJNPeZDZWhBSNrRAscTcnHjhwxr0MCC2dnJRg0TAsGxIBw4XI86A9VYiuVY2YheIxYggeHDE0B5GslwXjOQD48Tib0BkpI8iI12yta5BxF7cPx8KAdUgxFF/JmYFbWPpv8Awn40BH1IkeMRWIdGYrcg2X5Ym96Aak049sqsgMyXY2viPACgFxkQozXDyG1ieHP54UAgq8bA2vZlYMw8CCeNQ9QLPfdUiTdedNkSAg9PR5iQR6hqpza9ch3Kf6S5/wCx9CL/ALxe/j2etlfdasg6SEkZJiXXTCcYEA+0MpF/Hyrr90o4amYro9mfdIFU3s4LFbYLZrnGs2NxhsIl/lPUxzM2XXR5h6cAC1yfhUIiOsxmwmaTeNIsBzStImQC399fG1J6jKJsG/xK25bvZ75NRNYtcljmOPzqInmyxff1h/gfsVGhEmXYXLqVsLjSaEWxrje7Dri8Y/T/ADSL/ONFjD9nqiVkjJjID8JfzX4jzHLn4V2RQDAgzSL67RAZnvyA5EjyoBbxWdJEIeH8xXnYWNrm9ATwXzmU8c3oc2/KLeHCgI8tjIQL5s+U4EA2A4ngaAb1UWSyqC7kGw42t8/KgIKKbsZY2PpxOJHiSRywHOgBh+doRZ8pOW9xe5AN8KAkRMyghZB7ouzXvhflb4UA9JBmDEkh5CfdTNdWFgL+I+FATtw6f37S7Nod+1e0auHY9cfZ23d3hcaeYjOckT2CkjI3C/A+FeUMRblcdtSTktarpXGj0lamoKbT2Xqe4Wo7x7zJP2U7WaL2EyaZdrKhc2ITa3HMc71wvd245Zvik9za9c6XNoJYCw9/Z9UqYmtUqVRc6iwIAtlJ5ePiBXfnLDA0cWcmJiY/SMpuGF8cATa2NAPLpIQ8hlXNGo9GJufPD9woCMyJDIWjiJJJESjiOVzxBt4UBLigVY8V9bAiTMcbngflagGLgKoJ9Ix4EXxxsKAbM4jeNQ1nCqEt4H40B4wznOTZ8LIQQCPC44YigHog8agxKfWfU1r2vxIt/ZQDuZWNkOVgTnBueHG39dAXD7h9Lbv1d2P7Bx7NBFM23bbm12p1Wqg0mn0sbaSNVaSbUSRqLlbDnXEZdjLWGzLF+0b0vQknJt7T1KKZ0eLw872EsbFNC01aS1cJXyTovo7ZkB6m7lbe0xt72g6b0828S3ONjOfp9MDhxEjV0Tx2Iue6sS45tQXJ40uYqfhrUfLuriinJ9S5xmTfu2ezui7L0huPUc6Ae1reotf7MLY4n6TQKmHkZTUPD4675d6Ntb1uNX96dfVJ9thoeTbcnvyf5Y06Rpu5nVUSNDsUmg6OhOAh2LRQ6JyDcWbUgPPieZkqFkmGk63VK6//ACSc/wAPk/hJeZXkqQpBeilHn185p2p1m47hK2t3DV6nc9ZK15NVq5X1Enmc0hY4VaW7cbS2YJRW8lRcxpTnKbrJtvh0n1n/APK+7g9A9DabvZ/jbrXYejjucvTi7cd83LTbeNSYV3L3fZ+pkjz5M65svC4vxFZmJ9Wm+4PsGn5+9/QCf9LqXaxw+OpoBH/MR9vw/wD66dvf/rn2r/tNAeD7ift+Y2Xvp29Y8bDqfaj/AP5NAH/MT9vx4d9O3p5f/wAT7V/2mgPT9xH2/jE98+3w/wDqn2r/ALTQHo+4fsAbW75dvjfh/wCJtqx//OaAP+YbsDYn/PLt/YcT/ibav+00Af8AMN2BsT/nl2+sOJ/xNtX/AGmgD/mH7AXA/wA8+31zgB/ibav+00Af8w/YAWv3y7fC/D/xNtX/AGmgPP8AmH7Af/Zz7fY//wAzbV/2mgPT9w3YAWJ75dvgDw/8TbVj/wDnNAH/ADD9gD//AFz7ff8A1zbV/wBpoBf/ADBdhcP/AJbugceH/iXa/wDtNAeH7hOwY498OgB8epdq/wC00B5/zDdgcf8A5ce3+HH/AMTbV/2mgD/mG7A4/wDy49v8OP8A4m2rD/8AOaA8P3D9gBx75dvh/wDVNtX/AGmgPP8AmH7AZc3+efb7Le2b/E21Wv8A/lNAej7h+wBwHfLt8T//ALNtX/aaAB9w3YEnKO+Xb8t4Dqbar/8A7zQCh9wnYNvy98OgDjbDqXauPh/7zQHh+4XsCMD3x7fg+fU21f8AaaA8/wCYfsBe3+eXb6/h/ibav+00Af8AMP2Avb/PPt9e9rf4m2rj/wDlNAJ/5ift9/8As69vf/rn2r/tNAe/8w/2/nh3z7fH/wCqbav+00Af8xH2/wD/ANnTt7hx/wDE+1f9poD0fcN2APDvl2+Pw6m2r/tNAej7hewR4d8e35+HU21f9poBS/cF2EckJ3u6AcqCzBepdrNgOJP/ABPCgPW+4HsKou3e7oFRa9z1LtY4/wD4zSoGv+Yj7f8A/wCzn2+/+ufav+00An/mK+33h/nr29v4f4n2n/tNAKP3Efb+CQe+fb4EcR/ifav+00Af8xH2/wDH/PPt9/8AXNtX/aaAP+Yj7fyLjvn2+I8f8T7V/wBpoBX/ADDdgSbDvj2/J8P8TbV/2mgPB9w3YE8O+Xb48/8A+Jtq/wC00B5/zD/b/wD/AGc+32H/APM21f8AaaA9/wCYfsABc98u3wHj/ibav+00B5/zEfb/AP8A2c+33/1zbV/2mgPf+YbsDYn/ADy7f2BsT/ibasD/APlNAef8w/2//wD2c+33/wBc21f9poBY+4PsGRcd7+gCPEdS7Xb/APeaA9P3B9hBie9/QA549S7X/wBpoBP/ADC9gb2/zx7f3PAf4m2r/tNAH/MN2Bw/+XHt/jiP/E21f9poDz/mG7ADj3y7fD/6ptq/7TQAPuH7ANe3fLt8bYm3U21Yf/nNAeD7iPt/Nrd8+3xvw/8AE21f9poD0/cP2AHHvl2+Hx6m2r/tNAK/5hOwdyP88OgLgXI/xLtV7f8A5TQAfuE7Br+bvh0Avx6l2ocf/wAZoBP/ADD9gMP/AJcu32PD/wATbV/2mgPD9w/YAce+fb4f/VNtX/aaA8P3E/b8DY99O3oPgep9q/7TQHv/ADEfb/8A/Z07e/8A1z7V/wBpoAP3Efb+DY98+3wPh/ibav8AtNAej7h+wB4d8+3x/wDqm2r/ALTQHv8AzDdgeH+ePb+/h/ibav8AtNAe/wDMH2DLBR3v6ALMbKv+JdquSeX/ALzQH//WovunbfrbTJqtbBsZ3vRK7n+abFPDucBUHiTpHkZb/wC0BVXDOcI3synsS3ppwf4qLkZuyy++lVR2lvxpJc1TRZdO0U0um1CNHqIkOaCUFJVP/QYAjzvVnFqSqtKNNqjo9Zi3H6QAjBbNgMTa2OI8zzqSB2CNY3RZcJDifHHEEkHDjQGf2NEbqHpySSztFuWhvnHH/iYzcX+FeOI91PsvoZ6WvLjxrpO5/deZk7wakOQ5TaNBcr+W+fUcM1zauc7nfIfbl1Ftn/zX2V1lc0mDKcy2ltcW4kAeHK9dSUpI9oF8j+o5MwDcRe+IGHKgMYw/TI9sMc1gMT5m453oBt/cjKe4LyNZrE3wNrC1APxyuAbHAqQvHEEWINAOjUSK2UZGvZbG1sOBA87UBM9+yWYWjABubWbjz+PK3CgI31E7yKNOS8YUG9rWNr2oCK2VpEWU5QT6gTgAcbX5X5+FAbh0RCX6y6QiUEqOodtUAn0lhqoxjzNgbG1aWZfK3exL1WbGD9/DtLpRZ3vnoE03fXtgkQMHtHaMpVc1gd4lYWx5Xt+Fcl3b0ZTfrubfqIvs304619n1mca7/wCsl1XdzqKRpBlGm20Kz8TbSRg3uBzJq27oyrllp9r1maOfKmNn4OhHH5MzJ7uCOxuCBgL8bc66QpxhVkkQj1BwRmseJN/ljQGQ08UlmdiodTkyAYZTyPiKA8khnzxZGXIt8AAlifLlztjQDqlmRY3XK0JCkEhrY4c+NqAU7oVclhE3ukPcWxGN/wCnjQERJo2AUnO2Y5bkXsTjf4UBLYKzAtlCAFVwGF8PnhQDM8apFkGNzfM3E25UBjgTLKI84HqW3I/mt+yjBaH7q9PJp+tumVR/djHTkarNf/77nvga47uTGmEn/wCx9CL/ALxSrfj2etnANZA7dIQyBh7Ka6cLzuxiW+PK1dhqZSQ1GM6QjZ9zgK+so+cXF7WVrnA1mzHcZ5sEMjbV1MDlYLrYnYgHCzHHj4msRHWY3ZIWl3fTRhrFpUANr2OdeVTPUZQM71Eko3jdlNjK2omEqA/xXPC9RE82WJ+4DTNF0R2Mmaa0jbBZoyfykaTQ2x4Enwrje7MdnF4zt9cjoM4dbGH7PVErFp2DlGaxCm/ljyFdkc+ZFooxmJ4yCwQ8L8cL0AmZkCqZQDjZ2FhYW/dQDcUqPIxMoWziw4ixww+AxoCR6XNlX0rKwItzsLkXoCNMNRqAzxi17IrXBuR5XOIPlQEgQuwILL+oLMyriR4ZgcaAxzRSlxc+hWyo6YXA5fIY0A2mZpACbRk4rxubYm/9tAPyO6jICqZTmFxi3O1vDCgLEdWTS637bO1sEkpH026yDIFuvDcbEYDljXIZbKue4pehH8hf4tUyyw/SfWb53s0CRdkO0epSMRmRtpvIDZxk2lgo424i5860u76/u+Jfa9dGxmj/AENldn1SmsqIELNhIHyZDxw/MCPne9d4cwLR9QsbGG7g45jxPLl/S9ASYtSGyXa81gWvYEYkWHI0AmXUSCzBACQAwa3PgfLzoBgTPa+YYrlJHEi4PEfvoCJJI2GYXOF+QHzoBYR1eMvHmjbFPIG9xccPGgJkEat7zMqkKMCcFvwuaAdP6YRnLFHTNc8DyoCM0rOwVVstxkIt4+NAWo7sIZvt+7BiXIQ8TFAfzKRowD4i2ItauQySv1XGPh/MX2Y/JYfi6ir0uT2/USUAXKLcPE2vjhXXlCY8xskiPkDQuQy28jY28L0BMhRC05cLlRfzE2XjxJw4UoDYdn6a6j394hsex7jvIdTdtJBJKmHjIFyj5nCtXEY7D4b3tyMeNpPk1ntaw1295EXLiR0bQdL9OdM7fqY+54Omn1GpQ7Vtu066DVamMRo3u/Uppnk9snMuUMQcD4VV38dfxNHgtS1uUXFPe2dpKu7WnAbcMNbs+/1vUk034aVoY0y/b6JtRDOd/wBUkh/Qe0i+zxzEMGW9+OIryazdpU2FyaTKuC0+UMj/AJc2Mkf0vUfpYMZAXbMG5Cx4DzAqXDONdbY2sD6Q5J/y3RIImg34mMWBRpAWJP8AeuLn+nGsVHOX5hNcD6R6U+3Jg9oOoUtY5lMpt4WLEi/jepSzn0OYN4H0hMa/bhKo9zS9REcCztN6he+GRjwPwpKOc79vmCeB3pCwPtyOSMDf2OXCZvdBW3G17G/yqNnOdficwrgfSFTSfbl7md/8Q+o+vL7gA/Eg4+VIrOf/AB8wbwPpDyt9u6nKsO/SIgJOYy5cT5kfKmznD8zmDeB9IZkT7eAPcQdRSLI/5Yw3pt8Rhb4k1klnG77MhvA+kNp/y8KziWHqZs2AZyxOB4qEIIJ5g1Mo5xTQ7YTwPpHkh+3GJ1zr1IyZScTJlXDgL2PwrGmctf8AHzE1wPpCzD9uc6oUHUeVT+mwaSzBQB48D40X1n/xh/A+keFPt0ZwAvUiGFjmZTIbg/w8ThY4W8ON6Uzlf0yK4H0j3Ut9vRV0ydStmAyOjOMpwsVzEeP8QIqYRzj/AMYk8D6R4P8Al7ClDB1NJ6QMWYWIFr5sw41OznD3bYrgfSGmj+33NLf/ABNqUkKmNkugS1vSDe5IPiKlrN//ABoj9F6Qs/8AL0Wdhp+pk/8AmyxN/E2ZmNzxteo2c4p/xiuB9ICn26gqzr1Gxyi2dmAwwu2IAPHyqKZw/wCmT+h9IE/5eT6l0/Ucth/eYKed7Bhj+yjjnG/bFcF6Q9GPt2jZ8sfUEiqoUkmTjxzAixvUOOc0/gCeB9I8DfbrDKHC9QKSAFP6hAv/APrc+dNnOWv4Ca4H0h3P9vSISkm/6dm/NbOWPMk5rgVCjnFf4GG8F6Q3Fqvt8ZxKmj6hytcrESxUnxGViQSPOpcM41VtkbWC3pEn/wD54uSU3ubNxF5RlviDYZTbkPhUbOc+guQmuB9ISzfbpGo/4PeJCwAOX3lYA4XuWUf08ahQzl7sOYOWBXnEOcfbr6SYeoY/WQcpkWykYE8RYXv4+NZJZx/4yG8D6Q5H/wAt7J+mN9dlBAkJlzEjkbGwJ+Fqimc1/g5ia4H0gih+3ZS/o38EHEMXuQcSQBc2HA8/DxqXHOPQCeB9IiuPt/QxSJB1Gye8TLCGKjIRYk3xI5gXvWcY5u6qtvUYN4L0j2A/b7nzSQdSC5Ns7YgHgcqHEDha9/GolHN9+2TF4L0jP7Q3YAtrDAN8iY6WUOGziw8yb4/CsP7utewZfovSMXqpewMM8TTNv8seUrqNHaQ5+OW5BUrY44H5VK+rtPyK75D+CT/iI7H7dBKAdN1E5mBAZWchDx/vX8udTsZw1rtjawPpC1T7b4ku8O/WmIJZ/cDLl48CLA/trHZzl6tgmuB9I8j/AOXF1TJpuoRm4eqVj87MRbwtU7OcrdhzCuB3pCUH25Zmj+n6jkC2KuzSZRbgPSb/AIg1LjnO/bITwPpDmX7b4gVSLfypK/on3rDzu1r4+dYqOcvzOYmuBXnC5D9ugjRW/wAQH275QplxvxFzYfCiWc1/g5g3gfSPUb7dcoMK9Qv7tuc173OJN6Uznd9nzD9D6R7Iv27yFpEXf42RTeCPPje/C9+N/ECpUc4WvYIbwPpEYf8ALyrxs8HU7IADlc2TjaxAsbeYrLZzhrXbIrgV5wqUfbmED5OpRc+qMGQX8zfD9tYpZzX/AIzJvA+kej/lwnV1jXqLJjmKmQZSbC2JvywqKZytfs+YVwD848aL7dFX2CnUmaRQFcNISLH83Hjj4VlTOdf8siuB9IfLfbyiIMnUkqi4ZSZBe9r5jdeP+yf6qhRzl/0w3gfSIsP/AC9ooPtdUSBmJCsxNwcAuDDAf0NZSWcf+MhPBekesn2+54nT/EuRMwfRrdiL8GL5vlYE/KppnFKP2fGK4Kv8R4B9vQEa+x1PHlH5y5OHJcWIsPIVCjnG/bDeC9IUU+3dlvIvUqAPipLC1/8Ao8R+2oazj/xk/ofSPB/y7lgEh6iNiLCNiAPK4b/TTZzhbtsVwPpDqj7dw8bez1Crlsxiu5AC4ZTicD5G/nTZzj0BXA+keyD7dbq5j6gFmxsZTwGH5je3wrFRzn0CW8D6Q+sv28sfdB35GFisp90nAcAMajZzj0BXA+kRzqft8ZsvtdRSmLCTUAk5742IB/cBWexnC/pkbWC9Illvt6ks7x74rWIGnJkBNvA+J4jH+ysdnOV5nGTXAvzgv9uq3f6XeGN/Sh98m9uANxh53qNjOXuw5hXArziLKft2kRj9Nv8AFmS65TJ+a/I3bHljhWWznC3YCuBfnCIT9t59LDf3drMY5DLdLnh6SpsOdRJZz6HME8D6Qv2vt2MoJXf8b5XJcLhw44+rl+21TTOGv4CK4H0hnUJ9vpE3sx9RI4ispTMt2vfAsMCDxNrWrKCzeqr7MiTwW5tDOb7fnYMdL1Ii5FvH7gC5reoA3JJPibCpcM3S12yE8FvSMvo2+3v63Te2m/JIssZTMHxx4C5Pw86wSzf0DL9F6R//1/nKranQ7jqZ9BPLo9T7hZZ4XaKQFbkEMuU/trG5CNxbM0pLeaqucyjJwdYtp8Gg2r/NDrAxJHvWs0vVukHpj0u/aSHcWy+AmkUTjytIKq5ZJha7VtO29+3Jw5l4vKjcWY3qUm1NeklLnennHdPvvQW6l/5x0RqunpzYPrundcxjzX4nSa4Sr8hKKhYXG2vd3lNb1yP5obL5UyfbYafl23Hhg/yyr0ks9H9GbiGfYe4+i0ksmP8AL+o9JNtjAnhbURfU6f5llFZfG4m376w3w22pr7r2ZczI+Gsz93dXFJbPPpQ9B20632/XbTuLbBLu+0Ra7SvLu2zTQ7ppcizISxl0TyhQLXuwFqiWbYWcJRc9mTT0SrB6t6VOYLA34yTUaqq0x8Za+Cp0D7qU0/8AmshjYOr7BomDXuT+tqRicMbCqruZT6fo899CN3vB819ldZXMRFZGyg3dRa/HAXFuHh411ZSEZz7Z94+PoUG5IvjcYHnQDkLzPIzlFisPUbcTfn4UAqbT3nuvoV1OIFyTaxsBhjQDOQquVlYEiwblZbm+GN8aAUPbYgviAMAb4luONALYyyLkLCONmAfDjha3OgFmCICwJUKCwcNY2sLm/nb/AEUBEZAzZkQFbfmsRfH9/wAKA2XoX3IetOkXRzePfdtdE44rqYyTY1pZk6YS6/Ql6rNnB+/t9pdJ377m9XND3D6S3WPUTaPXaXY4J49ZASrrImsndZFNxZgQLEYiuZ7lxVzATUlVOTrw+LHWXHeJuGKi06Ujo5WVu3DXbjvWsl3Pdtfqdx1s4VJdVqpGkkKquUXZiTgotXXWLFuxBQtxUYrcSoiiuXZ3ZbU22996SJbI7KrFgpAUjwtYEf6q9TzHViYC4clSQSAMRyI/CgEQMiPLd3dWuABjjbEcjwoCQZ3DKqoZVN+H90eZ540B5f8ATk9JQE5rWv8AlubCgIM0wQZnDRh3LZ7DibY8bcBY0AKdOCWYmyDBjiBbgeV7jwoCVpyWUZrjElFbiAeGONAeyy2Yq9siv+YnGwFhbHy8aAYZFTUaaRFBRpYiGI5Z15HjeolqfEStZYn7q9XPqe4WzSSKwH8khAVjgqDVaiy8OXDGuO7jycsFNv8AqP1Yl/3jio4iKXmrpZyGeMP2+0koUgPuOoJF/IAD9ldklVoooamYPo0Fd2gC+hixBH+zkas5EbjF7GHXZ+p/VYHVxBvMFzWIjrMd03FffNDlU4zplIPEZh41M1VGUOoyXWX6fUm+Ropuurck35MoJtWKPNnfu+Wpm1HbjsVDIhb2dpcRlrflOj0dlwAsBx+NcX3Zk3jsanuT/NI6HOI0w2He/HqRXH9OERqLe6SGynAccOf4V2hzxJDe5GWfAXPPlx4fPw/GgITMheVJgWJ9UYPMDhb4GgGDLFGUCsxLGwW3G3C4NiMaAnws3uD0spVmltbAljj44njQCjI0SsUhJIOLeC24WoBZlWxzls1rCwxGIsD5mgIsCEqQrs7BjmB4fAnDmKA9ZChsXMhY3LcBf9lAIEQdFOcktdSOeW/Hw4mgMjqN43bVbLD09q931020aJxLotreVm06NZ7sqE2VvW3DxPjXhDC2YXXdjBKctcqaXxvwI9ZX7koKDk3FalXQvAWt73TSnst2q0q3SBI9okAtz/ljgsb8ya4fu7J/WMVHcpL1zpM1X6Cy93xfVKbrExBveRje7Hn/AK6785YlRxxuCrekqt2jFwCMBjzJuaAW8eV0lhcRyk8PzA3N/P8Ap4UAlirgiUWGIBxuOdsKARmGYMbkqLuovxOBIoDwwNlkOK2UKobEG1rXIvY4UBL9to4VRLK5UlgRclrXwt/XQEH3mKiF09tSeK8Dh43+FASo1cK6mxy4NjcY4D9nhQB7SIi5r/lNif6uFAW37i9Pbtv/AGb7CaDpvZ9bvWvGgWWTT6CF5zEjaOMZmCr6QSbXYiuIyrE2cPmWMlcmopvddP4mdHjbNy7hMPGEW3TcXAcSbtpuGhZf8WdR9P8ARlhjo9duCarWAc/+D0H1Mot4Nlrovq0J+5hO5xRpH709lFV8DKPvJRhxur5I1YhtH2v2YZW3LfuspsTk0eni2jTO1if97OdROR4fprUbWYXdSt2lwt3Jci2Y87FMJDW5TfBSC5XV8yMcvX+n24qnTXQ2xbAOCa7Uwtu+qHn7uuLxg/CIVH0qVz3965PgT9nHkhR8sifjlD3duMeGm2+WVegx+7dY9YdRKY986j125Qwj0aRpyumVThZIIwkajyVa2sPluGw+m3bjF79NP3np5zwu4u9d8uba3q6OTUa4dPCmm2qKQiPTy7lGs7EHJlYgG4FrjHGtu43strXRnhFKqN6692PYds7s6Pa9m2+HbtsGo27NoYImSMsxUuMrH1Zm5+dUmW37tzAOdyTcqS0t8hvYqEI4jZiqKqOr/cPFoI9o2ArHDBqBqZvp2jjVCyZFBAygGwwwqn7qym7lyrbVEb+cJKMaHvYvbNBrei95l3HbdDqv+MkT3JYY5SwWFTdi4NuNR3jvThiYKMmtG42t0ZXCMrUqpazmfaDbom7lCGaGKfTQHWkQSRh1wD5SFYACwxBIq4z241gaptN7Jo5fFPEUfCe984tHp+sdTptLBHoydJA7GFFRPUDclQFF8OP7anu5KUsKm3XS9YzNJXnRU0HY+u9Ht0PZnTI0EEQi0W3+zJ7SqRIMpHDG7Y3N+dc/llybzN6Xrlu7hZYuEVhFxI1v7fdt0Wt2PqKTX7fo9Wg1UcavNCkrEGMk3zg2AvW13nvThdtqMmtG46bp45TbjKEqpM512/2+Ju7UOnMUMujj3DVMNK0YaMrZyoCEBQADhhYVb5pcksvbq09lce4aWEiniUtyrMv37i0ml6mgh0unj0kkm3o5MKKin1MCWVVAPCvHuzKUsM23XxnrPTNUld0Kmg6nuGj26LsZEskMKoNogPvmJQ3uFlKvfjdjbEHnxqks3JvNtb8p7u4b9yMfgtW4cn7A6SHXdV7mNVpdNrNPFt7uvvxrKReRBYK4Ix8auu81xww8aNp7W46bjNHKYqV11VdBi+4O2aeDurNptHDBptLLqtJ/w0cYEfFQ3oUKCTbEC9/2VsZXdk8ApSbbozyxcEsS0tVUdR7/AGl27Rbb0+0Ogg00smomRX08aRHBAQPQouPImqfutcnOdysm9C1upu5vGKjGioZXsrpdGO22uk1EEOo92fWvqZJIkYsoS1iWvcAA2Fa3eCc/jopNrQqaeE9ctivh3Vb5xHtXo9NqO5W2RBY9Voo5pyIpE9xGAjfKcrXHnciukzuco4Kb0p0XSirwEU78VuGa78xaPSdVJDpNNHo3fb45GMKKim5a5KqoBOFa/dqUp4asm34z1nrmqSu6FTQdb3vSbbH2OgWSGBEXadJlm9pQwkzIQxIxuzcTfnVFhpz+qvS/Ke7uFhdjH4LwI5X2A0kOu6n3carSabWQRbeXQzxrKReRBYK4I871c957koWI7La8bc0bjNHKYqVx1SegwvW+2aaHuxLptFDBp9JLrdL/AMNHGBFgyhgI1Cg4jEC+P7NnLrsnl+1JtvZfGeWKgliaJaKo6d9wGm27RaLp9odDBppZZp0DaeNIz6QCAcii4FzheqjutcnOVysm9C1upu5vGMVGioZns5pNEO12tknghnMr69tTI8SEkZLYlr3AAwrVz2c/j4pN/wAO6euXxj8M6rfOSdjdJp9X13qIZdPptbpYtDqGX30EgGUqBlVwRjerzvHclHC1TadVq0FflcU71Gk9BH7sbbp9P3Jkg0EMOjgnXTZoIYwkeY/muiBQSb4gf6K9Mkuylgk5Nt6dZjj4JX2lwHV+++l27RdN7G8Wg0+nlbV+2HgiSJv91e11W9r+Jql7s3JzvzrJtU3W3um/m0Yxtxokh3sLpdIeid3mmgi1Dy6+cyvJEhJVY1GXM18BbhXn3lnJYqKTa0Ld4TLKop2ZVW6V86Nhgn7jbFpYUg1eifdEQJMt0yZ7g5TfkOHjXU5hJrBzelPZ6iowyTvRW5U6l9we16HS67puXQaPTaKR45RMdPEkWfEZc+RR4WGPjVN3WuznCe029K1upv5vCMZRokjc912/btP2P0uom0GmaaLbdO7alYFSQlpAC2bLmvY8b/OtDD3ZyzZradNp6K6NRsXIRWCTotSNN+3mCCbe+qJpY0lYaWBIhIgfIC5uATexNvDG1b3eqUlbtpPdZr5Ok5yrvGk9TaLatX3mOikjgOh1W/QxavTsn6X6jqHjZVtcMbjCrDC3Jxy1SVdpQdHu8Zq3oxeKpuORhuudu27a+uOsNDtGmTRaDSrKmj0kSNGsalUNgreBuL8628quzu4WEpusmtLPLGQjG7JRVFUmdW7NsGl7b9ud00Oigj3jcxqTue4xxOskwVjlDyHAlSCCOda2CvXZ4y/CTezGlFXV4D0vwgrFtpaXWp3xtJtsXYeFZIYRH/J42M7RKG9xnBDk8bk2xB51zquTeb635W/uULRxj8F4Dk3YXSw63rHWpqdLptZBHt80i+/GspHqQWCuCMb1c95Zyhhk02vGWp03zRyqKld0pPQQO5e2aaDujLBoYINLpZZNLeCKILHyz+hAoJ5kC/8AUPfKLspYBSk23RnnjYJYhpatB1Xv5pdu0Wy7E8Wgg00smqkjDwRJEcIwQLoow8iapu69yc7s6ybVN113TezaEYxjRJE7sfpNGO3e5STww6gzarVtqJHiQkqIwLEsDcAA4V4d4pzWMik2tC3eE9MsjF2HVb5yDszo9Nqe4hgMGn1ujj0+qZfeQOLKtgVR7g3vV93guSjg6ptOq1aCuy2Kd+mtaRXebbdNp+4Aj2+CDRRTaeASRQRhEzX9RKoFBJBqO792UsHWTbdXrGZQSv0SodY716TbtF0Xssibfp4JPqIo/cgiSJgTCearexI4E/tqm7uXJzxU05Nqj1tvdN/NIxVmNEv2Q39vum0x6Y36aWGLUyybgc7SxqSVWMei7Xw8R51Heiclfgk2tG/wk5RFO3LRulf9hhgm7jbXpNMsOp0T7ykYjlX0ZDNgcpuMByrqMVNrByk6p7HUVFlVvJel1nXvuD2vQ6Vum5tDo9NopWMwmaCFIiwNrZsijDDmf9FF3Wuzmrik29Wt1LDN4Ri40SRtJ2/b4Oxcc8+g0zzJtgkfUCFVkLGX82cqWv53+dq1Fdm82opOm1v6NR7OEVgq0Wo0X7foIJ+puoJ5ESXJoEWBJED5AzjgTwJtxtwqw70ykrEEn/F1GtlCTuPiNN7pwaU9xt1i0Xtxe5OgniRbKHsAwKrYHxw41Y5NKXwUG941ccl7eSW+dl746PbdF0lscke36fTy/UxxiSCJIm/3V7XVb2vyJqg7t3ZzxM05Nqm6290ss0hGNqNEhf2/6bSt0jvUs0MOokk3GT3WkjQkqsYAXM18MOFYd55SWJgk2vF3+EyyiKdqWjdK/dMQQTdxNn0unSHVaJ93RBHKLplMuBym4wHKupxsmsHJuqex1FRYSd5LhOr/AHB7XodLqOnJtBo9NopSJRMdPEkRYG2XPkUYYYXPj8qPutdnOM1Jt6tbqWGbwjFxokjbtTt+36fsZBPNodM00W2Ru2oWFVkLGWxYMVLXseN/natK3dnLNmlJ02noro1HvKEVgq0VaGkfb3p9PP1D1JPLGkpXRRrAsiB8gaTGxPAm3hwqw71SkrMKPd6jWydJzlXeNT6xh07d45tPpoYGim3jTrNpWUCMMzRqwIGHHHhW9gZy+mptuuw9O7umviEviml5yOjfcJtWg0ui6en0Wi0uj1H1EqyyaeFIWZcthmyKMAfE8+fKq7rXpzlNSbaotbqbmb24xUaJIzuzbfooux0uo1Oh00uoXbtTM2p9lfcJ91sc5UsSOANa1+7N5skpOm0t3RqPW3CPwVWlqOcdhIdPqOtNymkRZRFtrewkiBwuaRcQTwNhgbVa955Sjho0f8Rp5Sk7r4jWe9A08PX+6jRiNH/RM8CqFXOI1uCBhiLH51t5C5PBwrw9J45ikr8qHau4mzbanaHRzLtuih1qaPQuk8MEYdSVRmCyBcxwHG/Dwrn8qv3HmMltNqstb6iyxluKwqdFWiIvYXbdJP0vvz63R6bWF9XlV5YVchRDwzOrceNhWfea9OOIgotrRuPhMcqhF25VSek410LHpdV3O2BDGv06bjIx07rnQlQ38JtgLXtblwroM0co4GbT07JW4RJ4iO9U3n7jYtGm6bDkjji1J0UmdI1Csye4SpJUC9jcY1Wd1ZSdqddKr1G3nCSnGm8ah17smxbZoO2U+06TT6ebc9rh1G56jTxun1EpKESMxwJIJ4c/jW/lV+7cuX1NtqM6Kr1LeNbF24RjbcVrjp4T/9D599SdPb909rdQnUPT+4bSWlcRyavTyRKRfijkZW8cDWvh8XZxCranGXE0+bWet2xcteXFx40a1EqMfeiBKhiY1Y4G3G1bB5DgDq7e4qi7CwtgCpvj8KA9knOYxhVGa3DG3MUBM6bmn0G/bLLoNbPt2qk1+lRptLM8EhV50BBaMqcQTzxrxxUI3LUlNJqj1qu5wnpZlKM1sujqtRYj7soYou7qxRErFDsOhshvlN5tU1/gMMBXOdz4pYHR576EW2fOuJ+yullbZSFJ9xCeAU88RytjXUlKMRxo7GSIGwb0qxwJFALs4ds6KAbejwIN8fgBQCptQVzqAoLrb4c70BDVrgl7EMPUzNb4hR+ygJIKIFUNlBexbkBzP4cqA9kSRYlCi4zfqYeP+igPEijkVfSUJHpC4YeHnQCwskYIyIYm4Mcb/D40BtHRECt1l0aCFGffdv4D1G+qj8a0czX6S92JeqzZwfv7faXSjt33RwGLr/ZY3zM/8giIDNmvbU6gXB5CwvXPdyo0wUl6b9WJbd43XErs9bKzSEXw9GHqAN8fLhhXXlAM+4ZGWwzN+W4JuMbC340ApVBNvXmTEmPiV8PAUB7II4nT21usl/cJAuDawNh8KAku4TKzH3QoFn5W/wBNALJDLmDApxzAYW44YUAxMMwC5Rc2CyNjhbmLUAyEQOFYjLhfwJXh/roCUrCy3X0C91HD+nGgI5WJ0dGBW+JvhicQPxwoBcYypp/djyN7i35m2blUPUEWQ+66MwdwthLIFv09E4XC7X1WoOBFch3KVMJcX/kfqov+8Trfi/R62cduH7d6bNgE12oyg3sbg42GOFdgtZRRMF0miPvUJaRUIBbAEXIVhb1AeNZMmugmaBVk2fqO7rHk1KMoAtmIY2GP9VKGMdZjOl1U71ty5lsJEswDAg51xxAFHqM0x/rCTN1J1AGGUmdjmfgCFHGoWs82WI76RCLt/wBhc8eUy7IWANsR9Job3t41xndlfq8Y9+f5pHQZw/5GHXo9USshjH1DO6e2FH6JvxJHL5YiuyOfHIyln9tGucUvbA/0F6ATKVbMTZXWxRrY3t/YeNANBACjgKVGBQjHj440BMGJUYKbYJa4sDhbCgEvIgIjIDs3FOdvOgGtS7BAQRI5WyIRwxGNAeNFEABHnAN2fKLqRe+NvGgGTfKXVbryFza3HGgFCTObBsEFlxw/1XoCQQpjYhbKq3LXub/CiBbzvPpSOx3aiVi1mG1hM5zjHbJGNgeAxwHlXA9340zjEvt+ujqM0l+gs/Z9UqHlaNyERMx4Dlj5mu+OXE+xhmlBB5hTx+PxoBuzCVRClmuozWtdTwvQDklkYtmtnb8trXBvfzwNsKAZfIGLixZs1gxthz/1UAmKZonNsRYjKxuQThx8KAll86IQqYXKniccL0A2IpGjCOqgXv7gNsfDDzoBEfsqShR2bMVbMfPA3/ZQDzoXjTMfbONm4FRe17cMPCgLUd4Zp9P2F7BHTa3U6RNx29Y9whjmkjWYJoosokVWAYAgkA3AvXH5Nag8zxbaTaeiq1eM9W8X2YXJfB2KPRTqRU2LJpyzQqoQkWtiDcEXvYV2LdShJfuZ0Q5UwNwRieY/fUAbEchjKOqhb3MgNjccvxNAeQqjSfTpFJPqGbL7IBZjfAWC4nywo3RVeoLS6Gx7j09v+zp0nNvWz67ZYNy3dPon1mnaEyrG0ecxrIuOXOP4fCtN4uzehcVucZOK00daaHroe7sXLbi5xcavRVUN/wC7P/D95Nilku8MQ24kBbEZXPpHj4j42qkyTxstkl6Rv4/Ril4Db/uQky7R01FjmbXSnKPKMD5cbX+VaHdRfzLj4F0mznPkx4zL9hxG3RW5sJDD/wAW6zOCFKlYxY3x4AjjXl3lb+Kjoro6zLKvcy4zlPZoBO52ojzu6+3rMrn1F7X4kWAwN72/C9XXeDTgfumhlvzHKQe/bluu3jt620WnXLbCxB42AJv/AENqz7tqmEXGyM0033xHau4s8Z7KRygMiTaHb8ikG9jlthz/AKGufyuLWZtbzkWWLf6RcSMT9vAR+n99KsY2+qRJHwDD0Egg+Vyca9+9T/m2+I88nXiSOa9urJ3iyLM0yHV60rMbOXFnYYrlGPG9vljVxm2nLtVNEeo0cH814WSPuGYnq3QoP95/LkAFsMud8cLE3uf6YDy7rr9M+0Z5u/53gOs73Og7D+4odVbZYkVbY4MEOHPhh41SYeL+rU9Jm/cf6LwHMvt4yN1HuWBEi6AspON1LKCQeOOFXPen5ePaNLKPeviMV3BVV7xJbUyTK+u0QaUkSZT6ARZct8vhx8698rdct1U8WXBvnli1+q17qOh/cbIF2np0EEE6qYp8ci4Xty8j/VVT3UXj3OJG7nHkxM92VlRe2WpuDGYJtZ7rG6i5TPcE+Rx8K1u8EX8cuFI9ctf6d+E4X2ZdW7k6CzOFb6oi6nH0MbEC2Xz/AArpM+X6KXgKrLvfrwmU+4WQnrLSxjBzt0QAtgRmf4E438f6hr92FTCvtM9c2994Dr3UkyDsKrgOqvs2mRVINyMyi1ufDDx4iqPCx/uz7TN+8/0XgRzj7d8jb/ux4Spocwv/AHWYA2PG5Nv6CrbvS/5Ee0amTr+Y+Iw3XIVO8wy6h5VfcNJmlJEhUnICLLl4cLcfjWzlzrluqnivg3zxxWjFa91HQPuPkC7b06CCv/ETlLcb5Vwvb+v5VVd1F41ziRuZzqibB2blUdq9SSChgbXCRsVGYpmwJ8mF/CtXPY/r1w7PSe2XP9M/Ccl+34xydZ6niJF0UzpmW2GYBsOIONrVed5vlVxor8p994BHdtVTulCw1Dyhzos7Eh/bPpBAC2OA5HHzrPI3XAaqeUY5hoxGveOm/cO+TpbZFIIvrfSbcxGfEfHn/opu6y/nzfB1m9m/u48ZJ7ByAdB7mLFWi1s7Stiou0YYWPw4/jwrz7yr9XHhS6TLKn/Jlxle+3rRydxNozXAl3VvbYgAZvcJW4NrC+P7a6nMtGDn2Sowum/HjOsfccoGp6bcTu7+3ODpywsoLLY2tcXt42qk7pvxLmjdRYZz5UTdOoHC9iomuWVtp0t2K24uh4G/w/rrRwq/uz7TNi6/0S4kaD9t0gO59ToVYs+mhZWsbZFcg3PxYWqw71r+XbfCzWyby5cRqG7ET9+VUOwB6g06sbAkm6gWuDfHjz4+Fb1nRlX2Ga1zTi/tEfu2sg7jdYNmFng/Ta1v/UpgBzt4175D8lb8PSYZj7+RneuYnHZbtkUfOM8jOCoxur4ggC1uAtxHjWllr/uWI8B74pfpbR1nWzp/kJ7ihlQ7Gkai2JswQ2HPEYeNUtuP93+2b8n+i8Byz7esrdUay4KyLoHZL2N1LKCb8fCrnvR8su0aOUe9fEQu5qqnduMjUSShtRog7kiTIfSCAFy3t4cfOvbJ3XL9VNEjzx3zOvdR0j7jJMmw7ACCAda+Xxv7fjbljz/qqn7qr+bPi6zezjyImT7GSqO3GuuCjQ6nVmRjdRdow1wTwwOPhXj3iX62PCl0meWP+Q/Cci7FNHJ18+BDezqnjzLbgTfDC2BthV73j0YPwor8r03+Ue71hY+4umddQ8t4dLnuQ/tkG9gAAcAb2J+dR3edcFqppYzPRf17x1Hv4wTojalNwPrIsrW4sImHPhzPH8eVN3Z+am+B9JvZr7mPGN/bzIP8JbyrBlePXl5GxA9ceFj4+nGnehfqIcXWTlHu5cZX/pF0m7j6IsCRLvTAEgWzGYlQQbYXsb+GNdRjNGClwQ6insab64zsn3HKMvTb++7Pee+nzCwBy+q1r428flzqh7pvRc0b2kss51x075tOscDsOrG7K2zR5mK24uDwN+HD9orTtr+7/a6j3k/0XgOd/blIDvvUClWzS6FCjWJGVJBe5/62FWXetfyYP0uo1Mn95LiNK7nzI3dPdSrt6dXp1ZrXtYLjYWzW8PHCrLJ1TAw4mauNf6iXGdr+4KQJ0ds4N7fWpla2NxE1uI+J4/jy57uwv1E+LrLPNvdR4z37eXA6M3i4YNHuDtI2IF2jBFj8BjUd51+phxdZOUv+VLjK/dDtHL3E20ODaXd2CEgAZjKStwbYXsb/ADrqMw0YOXZ6iow2m+uM7B9xwXP004ndntODp84sASvqy2vjbjeqLum9FzRvFhnK0xNu3RwvYlGJLK20Q5mKkYF1PA3+H7RWlZX93fafQbE/kvAc8+3CQHeepFKktJooyrWP5UkANz8Wwqy71r+VB8PUauTeXLiNZ6nkil726tXuUbd9NGSQCMcgHHA48fDhyrdwVVli7D6zXv6cU+0jpv3GIP5Z08/vuZF1EwOnDCxBRbva1/neqjuo/HuaNxG7nOqOkzu2OF7EMxuwO0T5my8AXa4sb3tiPPyrXvL+7/aR6wf6LwHK/t3kH+Ld0BBLS7cwjax4I4LXPhiLVb96V+nj2jSyj3r4jW+8cqN3L3g+pvbXThj4WQc/L9lbmQKmCh4TwzF/z5HfO5Ecf+T8IWdokXS6EwIpVA49JVSpB4DiAcK5rKJP6k9G7Itcav0q07xjvt+Y/wCDt5IuWXXMMpBwtGDxxve/hXr3nX6mHF1mGU+6lxnCe3Uq/wCamzNlZ1O4yqtlN8z5lGA8zjXR5sv0M+yVeD+Yjxm9/cpIP5x05GGIcaKYi/AXk5nlw+ePhVX3TX8qfGug3M5fjx4hnuvEw6e7SFXzRrtqE5lCkXWIgkgAY8LCvXI3W/iO1+888wX8u1xH/9GgGi656v2aebTbP1JuOm0UsjK2h98yackE2HsS54iLf7NaOJyzC4nTctxb36Uf3lR85s2cZes+RNpb25yPQZn/ABtoNyf/AMTdC7Du7te+46CN9m1PHEl9GViY+ZiNa30udv3F+5DgbVyPJOr/ABHt8bGfvLcZcK8R8sdHMK9ntjuq20+7b70jqJcMuu08e6aUMf8A57S+zKB5mI0U8xteVG3dXot25cktqP4kRs4Sepyg+FKa5VR8wlO2O7bhlPSe+7B1kpWyabbtxij1pH/4Jrfp5b/9FTWX1e3D38J2u1GsfvR2o84+AlL3coz4np5JUZhtP05v3T/U/T2l6h2Hcdgk/m2huNbppdPcnURjAyKAwt4Gth4q1fszdqcZeK9TT3HvHirM7VyKnFx0rWqbp2z7tp//AJXySha+wbflRsMvr1JwJ/bVL3R+QXafUWGe/M+BdZWUyZ5EyjOreknC4IvbLyrpynHVj/VJ8SSLYKOAoB/3UIst7ucrNj524UBDUDMFQ3WNbXaxJGOONAeSqBdolF7kKAbgYWF/C2NALH+7KtISQfSpGIN+A4YGgPTM5SwyocMqriCV4X8qATJKziN1unEkA3uRhh5fGgH4CSP1Be7McoPA+BAoDaehJAOsujXkuAu+bbc5uCjVR3FzY3wrSzL5S72JeqzYwfv4dpdKO4fdTMuo672QxhfVsMQUlvUxGr1BFgONc73KltYKT9N+rEt+8SpiF2etlYXkfPfI6GOyGJgVvwvmHEGuvKAGN3NiAOJY4ADiBbn5UB7CxRgQQSxDXt4cQ2B8aA9k02KkesJjdrAEAYeNAKVwSIQtlcEvckfhfCgHo45FVh+ZAcxDWIHqv+340BHmztbI+QtcFxYjC5wPjegGUVi+d3zupuQfSGHi3AAjlQEl1RQxBCnEsmGF+VxzoDxgLkLmICjAj4nHlQDnuLFkBHusStmBuBcjA2o9QLN/dv8Arde9NlWX09PRnNfE31U9rg/OuR7m6cNce/cfQi+7waL0F6PWzh+qYx9AaMfxnX6n1LhgRwrr1rRSR3TXOk29zeNM73FnNrjnla1ZMjcHtrnOo2fqMScU1kXt4cw5rEiOsx/TcrDetApvlWZARwv61wqZaEZR0mX6yjZ+ot8IYBfqHKDAY5RULWYMsd3/AJ0HQfYUZcynYX9KEmwOk0Fsedcf3a+Zxa9P80i/zj3Nh+j1RKtOCWDA3uLgKQcuNreVdeUAmykJiRmWxJ4WFuAwxoDySNSuVTZWOYzKRmHC9gLYi9AR190YiX0A4RgCxBtexIve1AZCMMbBVDMmOU2LYAjgeF8KAZIaLPKTnfjcnlz/AHeFANMgnsVUX/Ob3v5gXoB4gwoSCbGxKkC9lJt48TxoCMAVuoYEjHIMMMQbE+VAKLehUX+O4LKMQPAcv2UA4Gd1EhQqsYZfce4Rjj/EcCbHGiekFxu9Ooik7IdqYQCHT+VgoGGI/lcgOF8ca4Lu/Kub4ldr10dPmq/QWfs+qU9DXaS4JygZCCcOeOFq705giSNLmcA29RbMCCOWBI40A6ZiJAAMgixJvckn+rjQHmfO658q5MARiD4XscBzoBl87PfMZA5tmtiDha2FAPFFyEJlFibnA2F7i9/CgFQMqkSDNmbKrITh5H+hoByTJIjBb5V5X9WPkaAjuDHGSFDsWwB8SQcb4/CgD31AVQvu5bAhrC3Dl8aAth3ivN2A+3mMe5JN9KgiUA5nvo8BbE4W5VyWTumaYve//kXuPX6Ox+24cJ0HbHr3cdN9eOmp9o2yQX/m29NHteks3E+7rWiBH/RvV5dzfC23s7alLejWb5I1K2GAvzVdmi334q5XQmL0n0ntL59/7ibfNMFCybf05DNuz+Q94iDTg+fuEV5PHYm57mw6b9xqC+740uZGfw1mHvLq4opyfLojznp3jt5t4YbX0dreoZEGGo3/AF5jjJ8fpNCI/wADKaj4bHXfeXlBb1uOn706+qifbYaHk23Lhm/yxp0jE/czqzTxFNjk0PSMA9K6fp/Rw7ebNawedVM7fEyGpWSYVvaup3Xvzk58z8XmDzK8lSDUF6KUefXzmpTa3W7rq9in1u46jW61t404fUaqVppCzFP4pGJ4+JrenbhbtSUUkknoSotXAainKc0223Va9J0nvVNHpO7O2azUylNPDBoJZiGN0RXNyAB6fGw+POqPu/Fyy9xWusiwzJ0xKb4Cf3w666a6n0Ox6Tprd490k0+olfUtEkihUygDF1F7k+defd7Lb+FlOV2OzVKmoyzPFW7yioOtCR2h646R6f6U3faeo9b7Muq1DSjTtE8yzRPHayqoIwtjc41Gd5ZicRiIXLK1LfpTSTgMXat25Rnu+E0rtLvuzbL16dx3LUw7bt8qamNNdqTlSMPcqpPAXwGNWGd4a5ewmxBOUtGhbprYC7C3e2pOi0kfvdu+2b11lJrNl3SDdtKNLBH7+mbPGrIMVDAWPyNRkFi5Zwqjci4ur1jMrkbl5uLqqHS+s+vOktZ2j0uzbZv+n1O9DR6KM7dd/eV1C+4GJUYrjfHGqnA5diIZg7k4NRq9OinAbmIxVuWGUFKr0aCF2I6q6Z2baOodL1HvGj2xtXNHIqauUKssWQqwVCMbc7ca9e8WDv3rluVqLlRbm4Y5Zft24yU2lXfNE7e71su19zl3XUaqDQbMdRq/Y184McccbBghx/KCuGPjarLNLF27gXBJuVFoW6zUwlyEL6k3RVZkO+u9bRvXU2k1Oy7tpt1hi0UcTvpnEkaOCTYsBYk35GvLu7h7lnDuNyLi9rdPTM7sLl2sXVUN63DrvpNuzCbLp9/0776Nsjh/lTF/fEufFDdRw8b+VVtvLsQsy9q4PY2q13KG1PFW/hNhS8amo0PsX1BtOx9S6zU79uWn2vT6jQvDFqtTKI4w+ZTlJOBJF7VY94sNdv2ErcXJqWpKpq5ZdhbuNydFQxvWG87Bqe6h3fadRptTsseu0sjauNSsJZcrSOOHBr4+V698DYvRwOxNNT2WqbvAjzxFyDxG1Hyao6N366n6c37aNhj2XqHR7rLDPLJLBpZBJ6WUDM1gbYjnVV3bwd6xO47kHFNLWbma37dyMdmSfEPdpetuktk7f7htm87/AKbbtyaXVEaPUFszq0YClAVsQ3Cw51hnWX4i9i4zhBuNFpXGZYDE2rdlxlKj0nJu02+6Da+vtBue86yDQaS2oV9fOSEjzqbeo8L8Mau85sTu4SUIJt6NCNDA3IwvKUnRGb76bxtO+dU6fU7Lu2n3aCPQxRPJpmEkaOpJtmAsSb3wNa/d7D3LGHcbkXF7Tek9MzuRuXaxdVQ3/e+u+k5OzMOyaTf9NJvq7bp4f5Wxf3xKGGZTcD8uON6rLGXYhZk7soNQ2m66KG3cxNt4VQUltU1Gi9iOoNn2PqPcdTv26afa9PqNC0cOq1Mojjz5lOUk4EkDCrHvFhrt+wlbi5NPUlU1ssuwt3G5OioYrqfe+np+63852jU6fUbIu46eUauMFYSVytJIvkGub+V62MHYvLAbE09vZapu8CPG/cg8RtR8mqOh9++qOnN+27YItk6g0e7SwyzSTafSyCQhWVQGawIHDhxqq7t4O9YlcdyDjVLWbua37dxR2ZJ03iR2r656R2Ptzrtq3jf9PoN1Z9WRoZy+dg6AJkGUizcBY8awzjLsRexkZwg3HRpJwWJtW7DjKVHp0HOeynUG27R1qdfv24Q7bpZdJPGurnl9uNXexUMW43xAub1aZ/hrl7C7NtOTqtC1mpl12Nu9WToqM87kbz09ru5H8z2XUabW7UkmlefVQqfZeRcplYWtex4kcazyqxehgti4mpUeh6+AxxlyEr+1HStB03vl1V01vnTOzQbR1Ho901Kav3ZdNppRIxX28pZ7DAA+Nqp+7uCv2L83cg4qmt8ZvZnft3LcVGSbruEXsv1r0n0/0hu+g33f9Nteul1cjx6bUFruhjADIMpFjwt41ln2X4jEYiErcHJJa1xkZdibdu1JSlRnFOjN2g0/XO0bpuE6wbfp9zE085YqqR58GLEGwF8b10GOsynhZwiqtxoVmHmo3Yyeqp0vvz1B0vv247JJ09uej3bUwQyjcZ9Ic6gXHtq0gwJ42HKqnu3hr9i3JXYuKqqJ8+g3c0u27kk4NPfobzvHV/S+r7NJtWn6h0K7p/LtNANrjk/WV0ZT7Xt4kYDn+NaGHwOIjmftHB7O03Xc46mxcxFt4TZUlWi0HPexfVHT/TO779L1Fu0O0Q6rSxjSSzlhG7B8RdVIuBzNWPeLB3sTbgrUXJp6aGtld+Fqbc3TQYKTdtLvfezQ63bdUmr27UdQadtFqYwcsihhcgNbA4/KthWpWstcZqjUHVHltqeKTWraQ/3dUf5k9Zq8hu2lVk9WbL+jHh5fAcKyyH5K34ekjMfmJGe66jf/ACT7X/qYCRrXNg2dHI9I42HO+HzrSy1/3LEftvHvivlbRsc3cHpJezadPQ7ykm//AMtWD+WFZTIspk/Kz5Qote/HhWvHK8Q8y9s4+JtVro3t49Xi7XwuxXxqajn3ZrqbaOl+p59fv+rOj0s2ikgXU2ZgrmzAMqgk3HlhVpnuCu4qxs21V1rQ1Mvvws3Kz0KhG6033Ydx7kHetnUS7SNTpZWdozGrMmUyPkOP5ufOvTAYa9bwfs7nlUa114tJhiLsJX9qOqqOl99uqum9/wBh2OHZOodHu08epeWbTaWQSHKUC5nsPTjfjjVN3cwV/D3Zu5BxVKaTfzTEW7kI7Ekzzs/1v0l0/wBC7nt2979p9t3J9RqGTRz58zK0YClBlIseFvGozzL8RfxUZ24OUUlp8Iy/E2rdmSlKjObdnt/27a+vI9y3vXQ7foni1Mf1k0ntxK0n5czNxHLGrbPMPO9hHC2tp1WhazTy+7GF5Sk6LSSO6277BufcBdx2PUabcdvVdM2r1ECkwvKpBkxFsxAtcimTWL1vCbFxNS00T1pbgx1yEr1YUa0HT+9HVfTO+dHbVptp6j0W5axdUkr6XTSiRyFjKsWAGABPO1U/d/BX7GJm5wcVTW+M3cyxFu5aioyTddwxfY/rPpXp7p7etJv++6fadXNqg8EOoz2dPbtmQBSPIjnXp3hwGIxF6ErcHJJbnGY5bibdqElKVGzivTu7wRdc6HdNXMqbdFuw1Ek2cqBD7t82Y3sAMca6DE2pSwsoLXs08NCttTSuqT1VOr9+uoult+n2Bun910e76uJZvrp9IQ4CYe2HkGB4mw5VTd28LiLEZq7FxWiifPoN7Nb1u44uDTe7Q3Cfq/pabsv/ACheotDp90G1x6f+WJIPfWQMP0xHYnG1aUcDiFmftNhuO1Wu5x1Pd4i28Js7SrTUc17F9SbF051Bu8/UG6Q7TBqNFk0887MImfOpKkgEX5gmrPvFhL2IsxVqO009w1csvQtXG5umg1Tr7fNv3TuLuW5aHUw7htB1kMkOoS5jdVyljbA8b1vZbYnawkYSTUqM18VcjO85LSqnaO9vVnTO+9JbRpto6j0W56tdUssml00okcgR5SWsMLE87VQ93sFfsYibuQcVSlXxljmeIt3LcVGSbruEHsj1n0p050vvGi37ftPtWsl1jPDBqM/rj9sAMgCkHwIrPvBgMRiL8JW4OSS3OMxy3E27VuSlKjZxHpTdtPD1zte6a2dYtBDuizzT58gWL3L5sxvYAeNdBi7UpYaUI69mnMVtmajdUnqqdU79dR9Kb9rNjbp/ddHu+rgjl/mE+jOcBbj21dxgeJsOVU/dvC37EJq7FxVVRPn0G9mt23cknBpvdobnuHWPSs3ZkbSnUWhh3T+Ww6cbWkn66urD9MR2J4D/AE1o2sBiFmftHB7O03Xc46nvPEW3hNnaVaajnHYvqbYOmd83ufqHdYtog1OjVNLLOWEbMJASvpBF7Y3NWXeLCXsTairUXJp6acRq5Zeham3N00GtdTdQbdr+6eo3jS6xNVsg3SCZNbGxRXjQpnYEjDnW5g8POGBVtqktl6OE8L12Mr7knoqdK789S9J7/p9h/kO7aLd9fHJK2ql0h9wpCQModxhib2FVXdvCYiw5+1i4x0Urv8RuZpetXNnYab4DY9q6v6VHZiTaJOotDo9zXa5NMNt9y06uzGyCOxa7f11q3sDiHmauKDcdpOu5yntDEW/hNjaSdNW6cq7J9RbH051ZrNZv25xbVo5NDJHFqZiwjLll9LZQcTxBNXHeDC3cRh1G1Hae0tRpZbehau1m6Khgu6e+aLfeu911mza2LX7bKIhBq4r5HKoA1rjxwrZyexOxhYwmqS06DxxtyNy65RdUdm7gdW9F7n2q27bNPvWi1e9pp9Eml29H97UROgVZcxAuthe5PGqLLMDibWPlNxahV1epPe4yxxeItTwyimnLRo3Q7G9W9M7N0vuui3ffNDs+q+reVYdRII3cGMDOAfzWsBhUd4sDfv34StwclSmjj1DLMRbt25KUkmcU6Q3Xb9s7i7Tuu4a0Q7XDuDPqNxObKEJYh2yi+U/Cugx9mdzCShFVk46uorcNOMbyk3orrNu789W7D1JumzN09u+n3XTafSSLrJoC2VGLYKSQL4Y1X93MHdw1uSuxcW3umzml+F2acHVJGa7sKU6c7OmRyF/lyI63GJywG+Xh8/lXnkb/AFGJ7XWzLMPd2uyf/9L5p6uOeDX6uLURHTTLJIPYlVkYWa35HAOJ8qiLUlVaVwEtNOjF5iGQqrAEn9Tlex/oKkgccfotJIxKhueIwGOJPHkPKgIbEvkzKCbXPpwUHGw/GlQb90p3C622fW7To9t6m3GLbH1mmj1G2yzHUaYo0salTp5/cjF+AOUeVVuOy3DXoSlO3Fyo9NKPU91UZuYbGXrckozdKrRrWveZ0z7qmWXuwNQrl11GxaFchvayyahbfstVN3MltZfX05dCN/vAqYqnorrK4KHZs4CqCD7Z/hOGJFxjXVlITc1mRgpAzYyDhfG3y8KAcI/RZ5HOUMMTwwHmcMOFARPcYGOygseC5cApsQBQHrlhJIoa9uC3FrWwIvbHn40B56lezK3GyjhYjjcjxoBL3unpYl8cwuWtjc8eB4UAhg6lRbMbgi1+HyoCVFHYIFZwbKTjzx5fuoDYOiGZetOkxFGXQb3t54XJJ1KWU/hWjmfyl7sS9Vmzg/f2+1HpRYnvBNMO+vbKbK0VjtjRqeII3GW1sBxriO7lfomJ+36iOkzen1Kz9n1mci74l37qdUyPmJk+j9YvYn6SEsBj510XdL/q7X2vWZU5787c8HQjlqOApw9PFQxIGNdGVAwsxVvUlrG+U8vG3OgJP1EapZvcQtghPC+B4UAuMRt7Tgt7uZgImuQRewPj43oCRK4X9HMC4yq+a+JPA0Aw8OCBJQwjdjLa1xxxseWBvQHjRPe4xkFi3EenhhQCnkjjeSy2CvYZefKzE3oDwP7sZZQJAcHIwyg8aAdiLe5DEwPtyyoruDfL6wMQeXjUPUyVrLM/dy2XuRskan3Ej6eiVT4kavU3JtztXJ9zPlJ9t9CLzvB7+PZXSyv2q1Sf4Kg074SLrpXXMeIMYN1rrN1FNDdMX0bKibpEWs5uQOJsSrAGvRkbjPen9RGdp6oUgENq4wDY4HMTfh5VgiIazF9PzJHvOjd2XIsyE3J5OONTPUZQ0Ga6ln97e94lCsFk1EhW/EYkA1CPNlmO/Jt21+3/AFAJeYbI8ftCwx+i0NyTxHnXId3PnMZ2/wA0i+zZ/p8P2epFWQHLg5fcJPqueAOJNdeUIj30zZL3seK8QfA8zwoD0r7saFFVbM2fKTYKLHHwONAJaF2VRGfBkBFsLjiSeAvQD3pjcukquHexbwNhiKAVNlkiV82WOTANY+ki/wArHnQEZpoYpHF5DGPTHc4tdcDfgONANyTDEZG/6/kaATDLe+ZeOIc4G/lbwoDwkEtcNc4txxB5UB37qaSZftw6E05JUDfJW9tr4OJNcLHH8K4zA1/yHEf+tfkOhxP/AFNrtP8AMbv3cknPZTtknssWX+VlZCPzX217C1hgfjWh3cr9YxX2vXRtZv8A9fY+z6pVGEBlLAsrMwLKpta/Cx8jyr6EcoNSrlKlQxBClicQD5GgEsCLFlLAkHKoNrX50A8bqLFWIwNgSbkjAjHEHjQHn6gAJuON3NuItwF/CgAuwhRrBg5IJOJt/S9APxENMqsbG4MZA9RF7Wx5igPZC63Q5mOYAIpN735UAzMLjKAFABup8cOHlQEa7AZXUI4wZsQxDeI8xzoC4fX3V3UfSnZHsdD0zvGo2vV6jbhHqdTpgqzlPpEkCpKVLpxuShFcLlmFs4rNMWrsVJRdUnq0ye5qfhOlxl+5YwVhwey2tziKn7nuu47xqJNXumv1O7avHPqdZM+pc3ucHkZ7/jXb2rcLS2YJRW8lToOcnOU3WTbfDpGYiGmRGNr2MbBfVYGxAueVsKzMRcpdcyksxzWCA43zcv6caAYmPpPCMAHMGwx8r8KAkacamD+Q6hoWjU7zAdPqHRwkhRkN81rNa4va/wC6vG804TjXcdeRmcE1JPhO19y9bsuk767Hqd/jEmyabT6VtxSWMOrLlkAJX+JQSCfnXNZRbuyyucbT8dt05uctcbKCxac/JVKm+Sdd9kchR9HonWMhUVtvzD1H+E5ThzNV6y3Nde0/vGy8Vg95ch6euuyThs+j0X6pHuL9ATctjfBfxNPpua7kn94fFYPeXIc57qb1253DppIuk9DpoN3k1kc7zw6b2H9nK+e7WxuSMKtcmw2OtXm77bjRrXXToNPHXcPOCVtaa7xwGLTKIi7Xyhfy8CLn+lq6WpViBGkaKdQCb2sCMfjYY0IFzQxBI5Ft/e9u/wDDxA+NqJknunaKS6Wb3GvZ+QuMBbn/AFUYFSaNIsrzAZrAsAcQLYYVCdRQ8mgCmOP2sjL/ALwW9RwvjUpgx8unchZBYR8jexvxvjyoQO2BQmNsyYM4XDhx/sqQIINlbEoxxBHAHgR8zQDoQPIygC+JYHACxsePCoqB3T6dQ7LKBmbH278OFrk2xpUD0sUcTIkeUuwGZ7+lQcBe16VJMY6aiPL7rC7qWTG9x8BSpA1JCDcXIAFwcL38wbYVIHVhYE5WsqWLZbAG/AD42oB0KXnLXva98OGNrnwoB+TSjNGnqkawMp4A38xUVJFrDAHChbOLXZjgvib/AAFKgZ1C+wzBGFgTa2JAHlROpA8sAnAZQQqizLhbHn4/KlaE0FCGEHIq+5/FlI4KOPwxpUHk+mVA/tOLscyC1wOOAomCbtvR/VGv066rRbDrdZpplLRaiKFmRwptdTbHEWw51r3MZZtvZlNJ8Z6RszkqqLZlo+iOrfZyydMbkpN0Ex07hswxtiP9FY/H4f8AqR5UT8Pc818hF1nRXVoZFHT24EE5bfSyXJABPAHkalY7Dv8A5I8qDsXF/C+QOhFfSde9HggK8e76ZTmBt/vcpvYcbXFYZkq4W52X0E4XRdjxo3Lu0wbuf1ra4C6RVyEWP+6jBbDlxxrUyBforfh6T2zH5iRnuvZ2fsl2sF/WzuocC6gKrqBc2IOA/bWnlqpmeI8HUe+KdcJaOpaHrfspBodBA+k0an6WETo+gzgMiDMHsCCwN7+eNVVzLs0lOTTet/xG5HE4NRSpubw9H132SKow0WiQIDk/7v4D8xFgvieHj+NYvLc185/eCxWD3lyGO3rqfs1q9j3X6HbNG2sk0U8OhcaL23ErRsUysRgQxvflXvhsDmcbsdqTpVN+NuV0mF3EYRwdFpo6aCpWm05lYl+Jb1jxt4Gu0bKJHoiUGR2B9kePA4cBUVA57WnkhdktGBYA3sS3P8AaipI1E8StldDgCuUG2Itc5jUkEqTRBg0j2ykkx3OU3IB/ZUVJoNvCghLJHg9/bdh4YYfOpqCJLp3bMIwBk/OWw4D+ulSBMKgKAjgyrcFRibY2BqQeZWKtlzXTAqcQTQC7KfbsMWtlA55ifxxoBwQBZVaTKF4AA3uefgLVFQS5YIY0zhQzEgRopBN/lc2pUkx80eoF5S6iG64g4Akf1UqQR2jLqCb3YkMRhwOFr2vUgEgb0hG9RJANhcWPPHlagHnUsI0uWKgDGxuL/toCU+nBizElndssYA4eRHGoqSeCCCNUEkZJOOW9+X7MaAVPEsaqwZCSvqAP8XCw8bUTAiFfqEyC4kN8cBe3LH99HoA6YIY+OLNhlte7E4f2UqBb6aMKHFoyFKtGBfHHE0qA23p3fd3mlfa9r1G6CBlWVtPEWClvyhrYC9sK8ruIt2vLko13zKFuU/JTZn4eh+r42dZOltxdU9RJ0z2CjDMpAsQfLjXl8fh/6keVGfw9zzXyDeo6J6sjhYjp/cMAWx0zk5SQLA286LHYd/8AJHlQ+Huea+Q1Tcdr1m1vJptx0kuk1IAMkEqMjgMLglWAOI4Vs27kZrai01wHlKLjoegsB3cmMuwdmCx9b7fEzsF9JukIygnHkcK5zIlS/ie31stMwdbdrsn/06LT9zes5ZJdJvOvg6q0CuyiDfdJBuNh4LLMhmX/AKr1UzyTCt1tp23v25OHMtHMb0cxvapNTW9JKXTp5xTbz0JuxZ926H1GwSjA6/p3XuiHxb6TXCdLDwWRfKo+Extr3d9TW9cjX8UNl8zHt8PPy7ezwwf5ZVXONDpnpLcY3PT/AHD0emkkFl0XUmkl25wTyGoi+ogJ+LLT47F2ve4dtb9uSn+F7Mukn4axPyLqXBNOPOqoY1fbDr/SRNrYunpt/wBvC5ju2yyRbrALDH1aN5WH/WAr1t5vhZvZc9iW9NOD/FQwngL8VXZ2lvx8Zc1TTdtOTetrhYGPUDX6ZTC6ZZFPvJYZWxBBONb13Tbk1q2X0GtDRNV310lhfuqKN3TgRGH6Ww6USxjCzDUaq+GGPlXLdyv+v+3LoRdd4vmvsrrK35bSK1rqthmHAYXxHnXWlESPaldmIYqin0sRy/bwFAIzMEcoyhWXEn+q3OgGMxzMD+oSlizXsptbxBw5UAlWuLmTM1soBHqNrnj4Y0A6iZyXtZlXC2A9XCw8vKgEsp9QJLHMAQ3zsB+NAOwt6HX1E2uFABw8/gBQEhMskgBUtkW1uFgRbgQKA2zoof8AjLpMF7Ab7tuVVwBI1MdaWZP9Jd7EvVZs4P39vtLpO3fcnrdVs/cvpDdNPMI9botng1ekmdFcRzJrZ5FwOYEAi9iK5XudYjdy65bnpjOTT4nGNUXfeC7K3i4TjocUmvA2V16m3/cOrd41W/b5Kmo3PVrEkssUMcIKxqI0ukYUCyqLV1uCwVrB2lZtKkVWiq3r0vWUWJxM8RcdybrJ/wCxhzCGbG+XAcRgR5edbR4DDaQKWkLEAgi48fH5UA08Ei2tIMpILqRY5RjY4c6AcaOSF7peNQynA+AvyF7WoD0h5JXe2LWvKx9VgOWPyxoB3UyCRQY7K7N+qbYEkDiDQDolAyZPWrCzkcbjje3C/GgMcLy4FCWAJ4Y3v8caAyEbShAGU2veRrC3wwHPjwoCVAo96CQG7LLH68DazC9Q9TJToyz33iew/crp54kCt/IIhKtrDN9XqBmPD4EiuV7oU+FnTz30Iu8+9/Hs9bK37gYx0hp0IPutrZzCA1rD2lzEg4kHlXVbpTR1MxHR/wD9NdOWJI9wZcpy2bK1ibk3FZsjcZ7sRU7R1N+Y318eWzAWOZrE+IHOsRHWYrYyi7tpWnu8Syp7oQ5T/vF5kmplqJibH1MoO77pfKS2qk9Q54sQwxtaoRgy033A+w/bP7fY4Usi7I5fD8zfRaC5xGJub3rk+7tHi8W/T/NIvc10WLHZ6kVNN0ssfqZTgnHDgRa3MV1hREGdWdizKSouwJAGNuZH4UAqCZl90hDYWsAMOFrW86AVM36kXtuLrhIAATfibH9mFAOTMHAESrkjJJQ3ym5xxwvwoCOGlEUcSs6hW/JfC3Dlcc+NAIeCRVjK2WRiSxJHqAwNvKgFjTcVMhJYHKyjDjxxF8POgHU0gjW3EggBedAetEn6YkueK5hY4+WPyoDZ9d1jveu6S27o7U6qF9h2hzLt2kTTxqwkb3Df3EUO2MrcTzrRtZZYt4qWKiv5k1Rur1aNzVuI2rmMuzsqy34kXVKi4d3wstB3kRk7L9q88psy7TIrXtZjtbgqApNhYeFcb3dTWb4pdr10dBmzrgLP2fVKitHeN84DnEEiwPGvoByo0HDZWu1gpu4FyByNyPEigId8zhvMFeQAJwH76AWkRdSuZipuoJwsR4csKARcC3BFtzHnbHyoBKuRn4ShUyhfAi2KgkeHOgHoncEZXBBQjK9zY3xA5UA4sbSXVXsRi4/HwoBLq5jyuGMha2SwFrYW+F8aAaK+gYgMqnHwseN8DegLPd5ZE/yX7CSqwMY0CrJIQCM40MF8xI4gcq47If8AtMb2vzMv80+Tw/F1Ir3sfTnUfUrPF0309uO/Mn5vodLJMi8vVIBkHzYV1OIxdnDqt2cY8bSKW1YuXX4kXLiRtv8Alzuu1On+Kuo9g6SGUh9Hrtemq1a3xIGk0P1DgjwNq0Xm8Z+4t3LvCo7MfvT2V0mz8A4+8nGHG6vkjU8TTdstvYpJuG/dYahcXj0sUW0aUnhi8v1E5HwjU1G1mN3UrdpcLdyXItmPOyaYSGtym+CkFz1fQev13Ft2T/DPRGxdPSwkrHqp9Od21fEYmXXtIgPO6xqOdHlLue/vXJ8Cfs48kKc7Hxyh7u3CPDTafLKvQYvXdS9S9Wbh0rJ1Fvmr3WXTbzDHo1ncBNOJHTN7KKFSP8o/Ko4eVe6wdjC2Z+ygo1TrRa9D17r8J5SxFy/OPtJN6eTi3jdu72znqPvFtWxjUHSNu0Wh0kWqZc4RZC12C3FwCDYeNVGSXlh8tlcpXZ2nQ3Mwh7TFKOqtEZ//AJbFAcDqrOMoCltOcDfHg2GFrVq/5Yv6fOe30Z+eSh9t2nSwj6pnvb1BtOuP7b2rFd7H/T5yfo3pcxpPcLtA3RPT82/x9QNuUP1MOmOkeHIQJc2UqwY3sRwtVlleffG3vZOFNDda7xq4zLvh4be1XScb07PqP03VomdFjW1/zLc8/ADxq+egrkQ5royI7MLAXDZrk8AeX76yIPRGGC3mDtLdBf8Ahv40B6VSErlIAPF3LBgPAfGmsExZEOmMQAcsB/xAJFrm4DX+GBrGmkDChXKu7ElSy+4Wwvha5qQMGchkBDyx2PuE45c+HnUgjGQoMisGzE+k+n08sRxNCCSWVYhHfObEo38OfiMLUJIoV/cHtqqMCcz4438KkgyEZzoSFzLGA2AuyseJ+FqxJFRwyQ5sxCiXgxsSRww5XNK1FBnUaczShHuqMpKNbguNrYniaVBJh06hCZSHNgiBRYAYEk4jicKVA8YRHawVyFuVaxBAHAgcjjUVBFR5gGeOEmM3sUF1UDDmb86kGR9qQhWdpAIAEmFrfnx+OArHaRNDFRfqtkMgUX4twJ4WPLAcMKzZAGOG7ZcPbxsR4i9xztQDkH04m5Kkf5Qt8beJPjUaaAZ1LyNGsqD22Iy+2WPM4EcyLGpQYSxpGgLTlHJuFLYkEYEcMKA7z0p33bpjprZen/5AuqfaYjC2oMxjDqXZgwFjY2bGuaxvdxYm/O7t02tNKFph80dq2obNaGwp9yLFm/8ADIAJsF+pN8t8McvG3l/ZWt/icf6nMev1l+aS4fuLk9Tv02kbJbKn1JNzcWF8tYvunH+pzErOX5vOcI6IdtX3P6d1TH221G9JMbWGW7mQgHyxFdDmS2cHcW9CnNQrcM63ovhNo7tIr9xutma6sNMgs3HKIoyLY8P6q18h+St+HpPTMfmJGw9wx7fZnter5ii3dsbqD7TMq8sQLgeVaWV6cyxH7bpsYvRhbRl9p+3f6/btq3B+qMra/TQaqSAaclVEsYfKPXja4F+YrXvd6FbnKPs9Ta17zPS3lDlFPa1oycf22wKgLdUyiQnimnBQY8sx415PvY66LfOen0bR5XMMbj9vjaLQavWwdUuZNDpptR9O+n9LmNGfKSGFrgWvb5VnZ707c1F29bS177MJ5Rsxb2tS3itOm1DDIChESsZQ4v8AlK/0FddJaSmTFaqN4Mysz+phZmvaxGIFr41CdQyOgVlLmb0pZhFxv8OPwqQLMSRqZLq7E39V8mON8ONr0qCXpJkRi2GoJIsoJzKQLkqf31i0ExjLmzRsxcABgFN8ovjbkKyAiaQqXWImTMQFjBzKRgfHHhQEZ5VzNKhyZwCFI/iPInC1CB2B1VC7G+ewZFPLmST5UBGkBJsqLmJ/SbEWAOA+NqkE2AsSI2AdnNpFPBltfDD/AF1DJFrDJ7gnUelfTd7WB8CBw4c6iooGpR2jW13Qt6ja6ljcjnbhRBnun0axtlL54UbNa3qYjgPMc6NihJ+nQJmXgT6RccTYG2N+FKgjsZfeYRQBmQj3FiGLEm17HnQEyKOaeMq3uI0pLIALWCccT/bWLaRNKkGZv+IZQ5W9sxa91uPV4Y4WrNEHjxQhlUsMzjF1sVIFj/XQCLQhlTAMT+o2JbA2/ZQEidw4kSMFFiy5JCxGawxB8DjUIMiRJngMs0piLA4lsL8bAeNvOpB1Ptv3S/y+0e9aX+VjdBuk0M0czSFCpiVlKtxuDf5VTZtk6x8oPa2dlNcpvYPHPDqSpWp0f/mSZmU/4ZVRbH/iSbtzscuA4C9VX+Jx/qcxt/WX5pKi+4t3dQ3TSxxnHOdSfnhlwqH3TVPecxP1l+bznA+5PVLdadRS78+lGjWXTRRLpwc4tCuUHNzvjXRZbglg7KtJ1o268ZWYrEe3m5tU/wBDsHd6O209o43Zm9rQJZ2IKlgkIOPM24/KqbINN7EP0utm7mPu7XEf/9T5t6p8+r1TAhAsjgEHDiRdjQHjMuH/AKxWFlHhfC1AMMAP0wuVGI+f7qAk6DU6rbNSms27Uz7dqIfVFqtNK8MgPIho2U/trC5bjcWzNKS3mq9JlCTg6xbT4NB0nZe5/W+47psm3b/qdL1fpZNw0kKp1BooNfLHnnRc0epkQTqy3uCJMKqcRlGGjCUradt0fkScdzzV4r5DetY+85RUqTVV5ST3d/Xzm9fdTpzpu8U8Bf3FOybc6yn87+42oJN8P31X9zobOA45yfNE2+8Eq4r7K6WV2clpGv8AplBZT8jYsfCupKQcZlsp/wB4rCwA5cqAYcWBRVyo1gfP93CgHY4o8l2Ww4ICeBvQCZFVWsBlBW5KDC5/fQCI1c+2pAZy1svgL4k/vvQD2S+Dmwa2ZiMPl54UAu0UMgMcv+9unqxGAxFxwNAOK0YlZCvqUkBb3BGGNAbJ0Vp4dR1v0eHQt7u+beHIc4D6mPiQcK0cz+UvdiXqs2cH7+32l0o6991arD3A2PT3zLFsMRSxucv1E+W3nhjXOdyI7OCmvTfqxLbvG64iPZ62VuVyTIShUGxJb+hrsSgHUkf2nyKAykER+X+mgErJnQF5CpbCTH024mw8aAcgW7lnUOjem4GOAFvx4UAmZi0xREYEAE4425X/AAoByQ5AhdPUSALnHgQaAbMWaKI4kjD3CQFJ4/s5UA5ApJaMgelbsxHh+PGgPZIVBjGSynBnB9XhYH/TQEV0kbMEcOuJHO3gb0B7FK6ZQqlPUoueAxA4VD1EotL92sDN1907PMGDv07F7gL3BH1U+Jrke5rfw1yv9TqRe94Ke2h2etnANZpUj6Jhly3eXXzWbiMIwMPgb1126ilhqZhejY1O6RLL6Rc5SVH5grWFekqkbjFbBDEu09UFrAjVxmMBbXOY2FYkQ1mM6djzb3ogynK0yD8v+0DS5qMoGe6m0aR73vEK3Ue/LaxOYA48fgaLWebLIfcAZtN0F2FiA/S/kD5FLXuTpdASR4Vx3dmvxOLr5/5pF/nHubHZ6olUssjuWRcuXmfH/RXYFAPql0uW9x7jC+BHmPO1ATPaCh2CAFVuVON/K1vPhQEER+4VbkbBQCAb+WOPnQDjlUlsRdWKD22NrWPD4GgCZZAAQrWUHEHD9vkaAeUrJAHERLFf0x/DY/EYeNARlBQlGfKynLZcDlJxt53oBUcrmbIpvEMSxxPz4XoBHuXdjlBPEHjmoCLK49uzIRluVzYLx+fyogXL7yaaKXsZ2r1jgyOy7WEAbEIdukxIB8a4Du7GmcYl7+366OozV/oLP2fVKlj2o43S3oHPNcgH+mNd+cuIMiiJnzCNXJXNxJBPG3jQCTDFGFCPd1OUre5+Aw4/GgG3VhGGy+i4zA8QCCb/AI8/CgGrNme5JBwQrbH/AFUBJWOMhSygZxccjmPC440BHZfbkzLcMDbNfDEfGgFrlUA+0QzCxoBUmJsZMzWxtxve4+NAIJLxIxASxCg/wkX8KAt51xvOv6Y7D9hdz0Og2vW63X6MCOTctDDrhpT9Lf3NOk6tGrtltcocBXDZdgo3szxalKSW03SMnGvjbrWnwVOlxeJdvB2HFJ6KaUnTRuVK2bx151t1PE2m3/qfcdfpR/utA0xh0y25Jp4ckSj4LXWWMuw1h1hbinv0q+V1fOUV3F3rqpKTa3tzkWg1FUWMh1X2252wGPjW7U1x5cq+oxWZ8KAVJYgL7l2t6gOOOItQE7QMH1XTZ9KtHvcAw4YsovbDxrxxK/lT7L6DO15a40dJ746fctZ3Q0Gn2dJm3U6PTJt3sAiVpAXYZGGNxja3CqDu9KEcA3OmzV1rqpoLHM1J4ikddEYaLprve0SxNHvxeyyJIZzmF8R6i1wTzxvbCth4vLFuw5Dy9ji96RMbpnvWHSNH3mYqwYKNQSt18TmAtjzqPi8s1+JyE+xxfpcprHVeh7j6fbF1PVybmm3vP7cMeqkYxrNYhbpmyg2BthW5g7uDlNqxs7VNzXQ8b8L6jW5WnCaBphPGhS7lpRYK3iMbgcasGawnUe+WUFSXS2XgBYgD1HztUoD2nVy0ZZDltZUP8XjlJw43qGD1ik6qVs/q9teRwueHL50A3CxiVWbKeJAsb3H7KkDpRpmVWlvcgpa4zE8AAfjzFRUDOTLIVePOxB4jjwtYcMOFSCPrI3fFlMb4XN7i9/2eeFEQNRP7cksLyDNcWbA2GGFSCQZEUoyxkC95HkxLY44DxqCSfpyhEikOoAASRF9RGW2IwuDbnWLRKHtUo1AjGUw5RZbelbriRYE3+NFoGshiRltFlzMB+oDywvcnxArIgymjRvbBZB7eQlWAvcAX4fh8KwkyUQ5dYEiIEoUMpCEAlgOWJBwscBU7JFRbQSB4IS5yMoVin5ybcwbild0mhkwk8kbBSXKB1ZzYEciTYeeFYVSJMM8UiSiyFjdGjBOPA2yjj4V6J6DFoHlSGNmkUFbgLhdjcXIY+NKAjgD9R0SwGVA3EC4B4Yk4eFSB/OuEUMgLJjmAYXYcLX8BjjUAjyxSSKzF1IjYWA4i+PieNSmKFjO33THaPc+ktq1PUeq0g6gn947gJNYY5FKzMF9FwFGUKOGNcpmeLzC3iJK0nsKlNFdz95b4SzhZW05vxt3Twm+RdI9jXzkTbdKzN/6zWkup4ZRdgRjyONVzx2a70vum0sPg99cosdFdi5UVmk2z6dX/AN6NeyKLXBAbOOGPOoePzXelXs/6ErDYLfXKVq6Qi0kfdPYk0EmbRxb6Y9FLe94BKwja/moBxrrMe5PBTctexp46aecpsNRX401bRsnd8B+4fVlxlDaMJe1swWJBe/OvDIPkoeHpPTMffyNh7hEHsr21DAEHK7Na4QCNxa/Lj860csX9yxH7bqPfF/K2zU9s6c7zDSwnTQ722hlRU0sZlOQJkBUBWbBMpHlW7cxWXbT2nCu7o/bSeELOKpoUqGVHTHeyKIAy73mYEZDqGZ7H0i/qvc15/F5Y/M5DL2OL9LlIu4bP3jg0OsTco94TbdJpWfWXmbK0NiXvlc5hlGN69LWIy5zWxsbTejRumM7WKUXtbVKcxyKAypK2oBYKpuBhlt4Y1cs0kPTifIUdWKsTgLXvgcPDAVAGYhKw9QykEF5OKXthe2FzjU1BMldCXiIClF9x425WHlxve+HAVCQIqoY2c4Kqgcbk2I8Rz+NSB93aUH9QKhGU8VygePxqANyxGIrcZlwyEjC2H43qa1AidC0YUxFUv+mQRwx5YYeBqEGY5L6d4WeQFXBtzxvxN6yIJmdMpIUyvYWlP5Be/AVBJL08ilo7qWVr5yARY2AwOBvheoaCJ8hVoHjyvYsWaUgK1vEkHx5VikSY830t0uXN7RnjcAY/I1lrIJmkV2Z2Ea2DfqAH8pw5/G1RIlDs86wSygMqKjWcFTe/A4Y2NjUJVQegij3G07ahJMxlkLFmwYAYem1r1O7QgykEcgX2VLvmUMEcLfE8rDxrBvdMkY/WQyh2ZgTmZwwJstyOFz4XHCs4shobBKDNIlgEJYNiwAGBW/LhU6yCKHjndHSPC7OVHMra/HD5UA4joiC8g9yXj6W9IOBJ4fsoDx45pP0yy4g+hueW1hx5UqKHVu0my9Abod9HXE+nWTTfTDaY9RqDDmDZzJYAjMbhcKpM7v4u1sfDp6a1oq71OI38BbsT2va8FDtUXR3YxHWM6nb5DGtskuuJBBxvYnHniMOPMVQPH5q9NH4IlksPg1urlHx0X2OlMiK22MSl5FGtOAa/qY58MPGsfj81W5L7pKw+D4OUrV3V2zpXbOpZNH0hJFJtC6SBz7MxnjWc5s6hySTwBtfC9dXk9y/csKV9UlV61TRuaCmxsLcbjVvVRHU+7+Owdqr4lNHG/uWwBZIRa/L4VVZB7/EdrrZuZj7u3xH/1aPavuCdy1EydS9IdO79eU5twj0x23WkliDebQNCCfNkaql5U7fuL1y3wV24/dnXmaN/45S95bjLwbL5Y06BloO2G6FU0+o6h6K1Za0cUyRbzpQT/tx/TTgf9Vj8aiuY2ty3dXhty/NHoIphLm7KD8E11PpAdutXrmL9M9TbF1UxFxpNNrF0urYk8Dpdd7D3/wCjen1eNv39q5b4XHaj96G1z0J+Ac/dzjPw0fJKhq++dL9SdOFF6g6f3LZ1/gn1mmkijN8Lh2XKfka3sPjLGIVbU4y4mnzazWu4e7Z8uLjxohbHKg6g2AZyR/MtCRIDcYaiPncW8q9MQv5U16L6GYWnScXwrpLA/djDFB3eeRpTMP5FoFEtjmOWXUpiPkK5vud/1+/48uhFvn/zX2V1lcldgbggK1ixvezHkRhyrqSlBozfKnobPeJRe+PL+hoBTJlYszEtiWAF7nzuedAJS4bMFzpawPiTfxOFr0A3OSpuqMyAWbNwNzhl8SaAjrNkvYJmU2KkWFja9z8OYoCUkxkYqNQCAB+ieJK+FxQDOoXUe8oJf2+K2GC4Y2twxxvQEtIiSjOwIVMqKLgkrwxNuN6A2bo55k636MMQW/8AOtvyswFgRqowLi9aOZ/KXuxL1WbOD9/b7S6Udb+58PJ3F2wqJFlTZoQ2Yi4/4ie5AH8P9Vc53Ii1gpN7s2/wxLfvI64lcEetlex7gQq0SSqBbNmsT4kH512Jz4lY3SeVY0YlFUqyHA87XFxgKAECMjM6n3FOMfjwNuXCgPYJmyErIVMaepwL4LwwoBoTy5yqXIOAltw/00AtpWYlJBYXOJwHHiePGgHCtrMTm/hAuTYc+eFANBvzlWynAEBuGNAJV29S+63D0njicfjQHpJkzMXzZuPn/Q0AtXVZImYFz7iAC1rhmFjUPU+IJVZa/wC74ovcPpqKM52i6ahElsQb6vUE8K5XuhT4WbXn9SLvPn/Pj2etnBdURP0Bo3sc/wBdqOeAAFdWtaKeO6a10moi3jTKbMC5sb3xKP8AsrNsPUP7ZB9Ns/UeYq3u6yLLY8DnNYoxjrMf01D/AN9aBjwaZCwDcBmXEVMtKM0Zvq+TN1Fvkaj0pqGu3HAqMKhazzZY77imhbt39vcim6z9Pst8LqRo9Dif9Ncl3eosXi16X5pF5mumxYfB1IqbxIsbW/LccAcK6wowVyBlMjWQGygY48PxoDxHYnGQktcG7W5Hw+FAKjykWAuLgXvf5HH50Ap/07EkMy4DG5w+N+FAJaebJntcY3S3EEccedAKgndlYByGyktHbkLXx+BoBKFJpGDkhVAGa35Rjhx53tQHq5z7oRX9pb3YeIuBfCgPIVKxROsKlnBGVm/IB4jjyvQDc6TOjXFhwkjBsBa+J5AUQLbd3ZZh2J7XLGpMWbbgc9rll26SxTHgK4Du9FxzjEp+k+WaOpzVp4Cz9nmiVWZAyWaylVwPAZgL2ONzXfnLEHVJKMoBLNGFUBQT+Xnbx86AkL7yRq8kuRx6jLJyIOAPPhQEdtRcKvuCX+F3PHhiRew+NANq5Yn20Vme4UgW+PHnQE/+DBWuwGL2uLY3487UA2BcZWujFRdQL2I5XJ50ApoyFX1/o5seNrn4XoD3FBmAGeRifDNhhz5UAwxQ5Y5CTnFzlJIvxYXoC0veBE03YL7ff1i7DSgeyBgttCrenEcS/GuRyVL6pjHXd/My9zF/orC/bUVbjVtS8UMKPqZ5cI9LGC8h54KAT+yuubSVXoRRJVdEb/p+2XW+ohXVavZJen9DKtxuO9yRbZDa3ENq2jJv/sg1V3M5wkZbMZ7ct6Cc3+FNcrN2OX32quOyt+TUVz0HD0v0ftqqd97gw6pVI9zQ9OaOXXtc8jqZjp4B8QWrD43F3fdYdxW/cko/hjtS6DL4exDy7teCCcud0XSKbfuhNrKvsfQ0m7TZrfW9S655lcjgfpdF9Og+DO1PhMbd95f2VvW4pfintPkSHt8PDyLW1wzdfwxoiBuXVGt6km6Zj3HS7bt2j0O6p9No9p0UGjhhEpj9y4iQF8FGLs376944OOHtzcHJya0uUnJuidNb0eCh5TxEr0oqSSSepJJftxm5d3N91Wwd3tv3vRxxyarY9JpJ4Y5AcrXzghuBAIa2H76qMiw0b+XSty1SbXQbmYXXbxSktaoKb7iOoW1Onk/keji0yiT3NMGc+7e1vUTcZT4UXdaxstbTb39Gj/cPOLla0Q+v3DdQSSuy7DpPaZUMahpDbLcvj/tX+Vqx/wAVsUptuvgJ+sXK6kaT1x3U3nrzbYtm1O2afRabTapdUHhZmdnQOiqQfDPy51YZdktvBTc4ybbVNJrYrHyxEdlpJVqcvAeOxPuEqQUCn817XOA/dVvrNIlM8UyLmgZdQ1kVmOJDG9xyqKUA0ylJI0l9Y8QbWwwW1iKkDiP6lZUDRG4AUHgo+GFzRhEYl5NQ8aplyrYRE4qRYkEHmBTcAuFWYyXe5AVlWQ3Ae/O3jQDmohLTuyyhWkXgbEADwN8fKiDMb7hkZo0FixPunjc442vjepII7RnP7eRSym/qvdst+f7OFSByCWN2MIzGRxctxAH78KgGYgcRZCUMkSsMxXCxHHyOHjwvUNVJTHVZgtpEzRXKiLAEDiAScPwFQwMSxOZEa/pCliguoHOxY87VKA9I5sVBy5gMgOIN/wCEjDlUEnmoSRAYCmdTayAHh8Tx/HCie6GP5NTCAZkzqOGX08LFcTfz4caxqnqB6NWElzj3ZS35o8x5nG9rePOp2dAqRJ5o2f8ATVUKgi5bH1cQRyOP4VKVCCLPIrPwtJgpB4A2/cayQHEmWOFs8dxmb8pNxlFgWJ4i5qKaQMNndVd4y0jE3IsD6RfE8cPKpIHlDhZmsf1IrO5JBvfAgHyqCTrnSnYrdupNj23qTT7zo9JDuUIm0kEqu7ZQ7Ic5UWFst/P5VQ4zvDaw16VpxbcXp5KljYyyd2CmmtJtY+3HXqrE9QaR3Y3uImAF/G98SeeNan+V2/MfKe30afnIP+XLfM0CR9R6MxkEFBHKCHPAXPEf0tU/5Xa8yXMPo0/ORyHoaNIev+ndPO9/pt4iieVPykxy24HkSML1d5jKuEuNbsHzor8MqXo13zce6b+93H64zIP+H0sSekG/+6jHE/uFauQqmCt+HpPbMdN+Rmuvijdm+2Wnj9SaiVrseN8kmYeGBPPH9taeW1+pYhvcp1HtiqfC2keJ9wHU0O2abRx7Tokm0sMMDa8ZzcR5VzFSbXYCxqX3YsO45OTabbpxj6tcUUqLRumRf7id8d4vZ6f0iIrN7q55DcFbDDlYm/7K8l3VspOs3zGbzi5vIxu999uoN023cNm/kukgG5aWTSzT5mzIsysjMF4c+H+ivbD92rNq5Ge03stPkMLma3JxcaLSqHClidAA2cKRYlTYi1iBY34+JromVhKjljaMrqIXYLisjk2BUYf21jTeA1IjxxBv4H9Sx3sRcccL1KAssouIVByDMwxYm/DgBegG9VJZ4lCe2Ga7Zj+dRYFgDyogzxUcTIkjFMcsi3BBW2IFqAenjLRae7hTEbLkxBvwOJotYMfK7QyFDaSYYK64Aqbm3E2txqSCNNGUPqAbODZmB534A4Y/GpB4sqQSBZAQykIqLiLnnjbjegMtCMl7D3Cbl48Qcp5XGIrFkkv3HJzRLkQIpZWAJLKLEi3L41FCRmeP3EPtgxKWAyYsx5k5hgBjRcJA4je2i3utmIkIPMcSOHw8qMkAJY4klAB9y9yAfVbnexA5UAqCHUpEriO0Vy2QLiMfVxJAwN6htBC21CgJ/vUMeCxhr4DwIAPPjRRFRGo1MUoW8WR3sT7jWOHPzHjRKgbqQpZQY1D4k5mBB/MDa+IrNEMTBJlLtkDXTMLE5jmNgFtgDUMCWkMvuMEJiS/tcCRjbn51IFQq+aIiM3ik9KMWFl5i9qhhG/dC9rdf3E/muq0u5QaCLbNRHHqXnDOxaVWdcqrxHptieflVXmWbwwGypRbck6U4DbwmClia0aVDpUf25bmbPP1Bo2cLlyJE/wAhc8hzqqfeu3uQfKbn0afnI8b7c94ETnT9RaNCzD0e3Icyc8RgD4cfjU/5XarphLlQ+jT85HGetemNR0Z1DqOn9Xqk1ssEUM/vxBhhMmdbg4k1fYDGLGWVdiqJtrkK7E2HYm4PTQ7F3TdDtHZ7SxWkjbQqyNa5ICQgHw4jjVJkS/n4hvzutm9mHu7SW8f/1vm7IgGoltxSVisZPDE8aAT6i4RfUxvcYWHkKASyiZcrEGxYAcjxvYAeFKg2bZOuesunV9vYup9y23T4H6FNQz6cj/agkzRkHzWtPEZfhsQ63LcW9+mnlWnnNi1i71rRCTS3q6OTUbPoe4Gn3Tdtq/xP0H07veok1unybto9K2z63N7yZX93QNFE5BNyGiN+dad3LJW4S9jenFUehvbjq3p1fIz3t4xSkvaW4y0rTTZf4aLmOqfdvpETu3EljaTYNE7s1rk+9qbvbxNqr+6MaYH7b6EbWeuuJ+yusq2iKLBcCjXWM8rePhXUFMPXYyWHqa5wwsL8vC9AJsXGXNlIJXDC/IgAY0ApMFDH/dkEZSbGxHIHz40AzdQq+glXFiWGAIwwucLGgHVMKuypb0kizCxuL/jQGNbSAyIYJGAWQ3fBypvmBuCDw/dQGT4EIbhTd/cIBPpUnA+dALvmXMLK5AKnDAjmW8z40BsXRLs3WnRVyhT+e7cZ2JxI+pjAA58eVaWZfK3exL1WbGD9/DtLpRY/vTtm27r337Z6Xc4F1e2apdv0uu0rEqskb7hNmRiCDZgbfCuO7s3ZWsnvzg6Si5tcaijoc4hGeYWoy0p7K/Ezh3eDaNt2DuRv+z7Dol2ra9I2lGk0cQZo0WXSxyMLktjmYnE4Gul7vYm5icBbuXJOUnWrevynvFPm1mFnFThBUSpo8COftJGpa7CwW+ZbXIJAAt5c6uSuMc0TSFpoCXikN8uYjKf9rHyvQHq4lYhgUAzEkEY248hYAUBLdLqrPwUYquF8cL8rGgIxBBEgIkdsGUcLeF+eIoB7O7MyMSjg+kjAcaASowLIApw4WuxN+JPwoD1hhexsSc5blfiDyxoBgvZzgVVeDrwFuFrfsoCVCoZ4c1iBIl7jmHGGOIJthUPUyVrLP/dxmHcPZ/cJy/4eiCF8oNl1eptYDliBXJ9zflJrem+hF53g9/Hs9bOHsTH280+dbZ9fqAQfUAQDYW+ddctZSRMD0lL7e9QhFVy90NhlwKsb4ceFZMl6iZt8qx7P1H7eST3NQiPlwsGYi/nWKMY6zF9Luq73tzAKSZUCqFsfzrz5VLegzRO6rGTqffs1rDUOVYkY2UXv8KhazzZY7v2jntv2AEmbOmyOEDBTh9FoMFtxNySL1x/dx1xmMfp/mkX2baMPYXo9SKpyNYkAlr2sq8yPDlzrryhPEOZR6fVwyYZiPC4oB/Kb5VY5S3qPK/kDiaAQtlxH6aixZV5m3H40AlmkdRdbKxK5sAQCP7KA9WNbhAxIAvGVwIHGxHwoBc6t4rZRxUWJuPzDgaAjZHmIeJSc45NiDfytzvhQEiAxxBoGkJlALM9/TiCcSfwNAOTHMilHyBiAyKLkA/DhzoDtu/8AS/TS/b90p1Km0Rw9T7lvJg1O7AsJpIg+tTIy5rYCNcLchXNYXHX5Zzdw7k3bjBNLRRaI+HdZc38NbWXW7qS2nJqv3jpXeW6dju1iRFDNG21J6ueXbHDC2Aql7vU+r4r7XrosM2+QsfZ9VlTA2aQ3IMS4+3xxPlhhau/OWPHYLfgTCA1rAh/UBw5cqAh6yCSVEysQc9zFa4JOAPEWoBzTxwwrLZ82ZrFmZTbLYcBgLm9AKzRAZ0AZiSpBUAXwxHCgFpYM6gFWKhSXNrXJJBJ8qA8KkubsVIsHOOIOI+PhQCiWKyNa6g2Y2F/HiONADDOuJuubNm5j8LHCgERxIc72DMDxwsb4XB8qAuX3R3DaNh7IdgZ9w6U0vU76jbQ2jh3CedNNDINHCxkePTSRGXMDbKWAw51xWXYa5czDFbFx2/G00Sq/Ge7JOnIdFi7sYYWztRUtGitdGjgpUrvJ3U60jhbSbLqtH0boT/8AA9OaGHa/TbANLEvvth/ekNdCsnwzdbidx7825cz8XmKp5heWiLUF6KUefXzmh6nU6vctQ2r3DWT63VNjJrNVK8ztmPN3LHl41ZQhGC2YpJby0LmNOUnJ1bq+EbJciRgLhTZsBccOdZEARmQ3N1JDZsLi39lATdGqhtskKiQru2nYBjZXsRZTbxryv+7lxPoM7flLjOwdxtXtWz97tm3PfY/e2gQ6SfXRMgkUII5ExUizANYkVzOUwuXcrnC06Sq0uVFrjJRhi1KerRU3eTup2gCFG0CMqkBVbb0YYn+Hj8cKr1k2Za9r8RsvH4XzeY9buj2gbN7m3xu0hHuD+XK2YnG5wN/MnnT6NmW5L8Q+Owvm8xz7uf1Z0Du3TsMHTO3Rafdm1sWpOoXSrC3thXzXcccxIwvVrk+Bxli85XpVjRqla6dBp47EWLkErao67xX9wWvIJgjX/Uj/AIWxt5cRXSlWLacM0a4K+DqjC97XxFrA3oBEk0bKFkC5fUBGwsTcW878OXCooCIXSN1ZHKyGyhcpIBXxAvjUkD0SKJCJwJS5yLYc/Ek+fGhJJNo0/TTLm/KtrmxwKkfOoBHDLqJlR4goyljIxBFgRYmp1EHgHs6kxBvQDdSvjyHl4U1kk+TTe4VlLFQyrmVlOAIPMVjWhNBj6TLljV419s+iS54i3hifKpqQO6r9GFY3v7khYZByHPHxonUMiRSuQCb2NgSWuCvn/orIgy/ryIXIuCv6YK+sCwsSfI15mQ3OEHpDK5iGa/5hdf71r4i9qIEWXWtLH7cqllYXU3sAFPHHjy+FSo7wqISW8QVg1pj+q7G4ZRazeRHGpaIqOosi2IZtQMDGlxmW3PHiPIUA0DG5aUopCnIGK4FgMA2N8QaAY1x0mZmRFvcmRlF8bcBY2tRVDMfE0hVwsjBYvzL8eQtYG/xrIgyuniRvbNmMkJK5msFx/A2FYtkjU7rdcLlMy5ATYHwxFjwqUQdN6abu42wabT9Ofzb+QSxytoYof90ysSHERONma4sOd7VUYr6f7Vu7s7apWuvwm7a+J2KQrsmeEvfMaaHTCLeooIDGsK5DcGKzC97tbAccDw8a8KZW5N+JV9Z6VxdKeNQNTrO+SlI1G+KXJByQMxvYE3upvf8ADE0jDKtficocsX6RonRMZh616ZMih5o93gvE5tmYyWOYEcQccRVjmOnC3Oy+g1sL72PGjb+58Xs9y+to2YkarT+4Sf4Q8MZHxAtWrkTrgrfBXpZ7ZiqYiRlevYy3ZvtnOq+2IXmiVVNw2ZXAYnxNr3rTy10zLELiPbFL9Lb8J0vRdz+0Wm0ehgbQohXSwrOPoEcKyRrmDciQb42+FVNzJ8xlKT2t1/xcJuQx2FSSpubw4ndLtAVjY7fEoVT7Y/l6nKBiQBbxJw+dQ8mzLzvxErHYXzeYgbz172n12x7suj2iE6qfRzwaI/QLGwkeNsljb02Y3vXvhsrzGF2LlPQmm/G3KnndxeFlBpR00dNBVAlpgoaUROoASRfAcRj8L12b1lGHvhIsrkYkqZP4WzD9l/PnQHrS2VlYhcAC5GUHhwPAcKgEORoBdx+kFbOoQHG+GHDDnUkHoLMUklIeMLcCxBsOA8uGAtQknqkSXeOP2wfHzxBwvw4VAIskxbKrwly7D1cLFj4cripIPJ4xpzG0bKQwswUA2t5UTqST/Z+ohSzN6CQrEXvZbg86xrQkZOkVQ1ijCWxYm9xwHO9vOpTIoPiM6fTvJKwZVX0Mv8Rvha55cKVqwY6OVwzWzWBLXB4Hjw4VkQZfT52jxYIhuM4IJBNgbX/pesHrMketl9pQxXNKAClwTjYE2HJqjdBG+tkhUxWvGhy2UlcTgOIwqdlMVI8E2QuyKw9sWhIP5CeIsOPwqWiKjqIfzJJaP+OC4ykkYgE4AjxNAePaSQRPFYouZ1KjMosBhy4WoBGo+laJT7cZlscmUYBb8bcb48aKoZiUYmXJC5T3Pyi1hYeNsRasiCdAiyh0kzuZPVhYfl54nn8ahkj+pZVVkIANlcBSbkfHlRA23oqXr9G3Nuh/r0R2ij3P6PFCTcxiTkDxt860MesI9n4jZ4K89DYw7vKvsq8NDeoJO+mk+pWOLeh70jzTylc2cnDOt7g3wIA+NaEllU6VcNGg2F8Wq02jw6nvhptKoC73+kgVf0mc5VIAFyOXDxONNjK5P+DlG1i0v4jmPUEe/SbpqZOqm1K7zNGn1cmsHtzZQoEZIIXDKBjVvhfZK2vY02dymo0ru3tePWvCdj7qAjZez+tyCO23LGIF/KMohbA28Kosjf8APxK9L95Y5h7u0/RP/9ejer6p6H3TUTJu/b9Nsm9xlO5dOa6XSjibt9LqhqYib8gVqpeDxlr3V/a4LkVL8UdmXSbyxFifl2qcMHTmdV0CW2DobdWB2PrxdvkYWGg6l0MmkIbwGq0p1MJ+JCj4VHxmMte8sbS37ck/wz2Xzsn4fDz8i7s8E1T8UaroIuo7b9bRQHV7ZtCdQ6FTnOv2OeHdIwORI07O63/2lFqmGd4RvZnJ25b1xOD/ABaORkSy6+lWK21vxal0aeY0nUQyaXUNBqom0+oQDPDKhidT4FGsf2VaxkpKsXVb60mk04uj0Mf2g5N72VirSrLr9JnF8AvvpYchjXnf0W5dl9DMremceNdJYX7qtZPq+7HuyFlI2HRrkY3KD3tQRy865nuZJyy+r8+XQi47wKmKp6K6yt/ugFUXFUGUNytby/ZXVlIKMmZjdAwGFuZP9ooBBZl/3YAu2Y3xxHPHxNAP3PpBy3cC2ABDHiLc6ASXwxEaIgIJ58b4kjnQCcxzGwETG2JPLhjbj5340AjIQTkupa5ksuJ8Cyn48aAdNgIgRnyKQTc2H40AlZ4wL5rXN1Bxvb4AUBs/RDMOr+k3hVY2G97bluL4/VJYnhblwrSzP5S72JeqzZwfv7faXSiw/f7cxs/dronfW0Y1su1bfo9culZzEsrQa6aQLmCm3DjauT7pWfb5Zet1ptykq71YpF5nt32WMtzpXZSfJJnAuuOq5ut+qt26ll0C7T/MjCF0MchmVGgiSG+dlW5bICfTaupyvAfA4aNja2tmumlNbb1ad8pcdivib0rtKVpo17lDUmFmUmxy4FTyPE8B48jVgagypCM8pxwGZLekcgbDzoBbAXaREDhrkgXYcjfyoBCrIpQm5ClcoJ8zwx86Abb87FjbEZm4C3HgPG1AS7pYkLluOYtYEY0AkKAL2v6reHHha2GGFAJY5hfKcgBAF72PjagEvcHKrriCCRhlHMcvGgBGs0YUDKHXDHhmF+NQ9QLN/dqhl7g9MyaiT3C/T0YUhcuB1c9gLcePMVyXcxv4W5X+o+hF93g99Hs9bOH6yS3QWmjF8qbjqAceRUEfvrrq6UUkNKZr/RhZ92hCG5UszEnkEbC/wrNshamObFnbZ+qLW9OrjLY8g5rGogtJi+m5P+/NCVLE++lsbWGYcKmb0GUOozfWSxzb7vkjXDNqpFU42wAHD4ioWs82WN7/ADTJ0B2GieQOqbE3tgrlyr9JoRbC9647u028Vi+3+aRfZx7mx2eqJVrMbswtmt6xjiP6eFdgUI5l4YiQkEXGFrWwvblyxoBV8xykeq+VmJJH9MKAFABa4BBv6SOX7+NANylSUAHq4+GYE2sCMKASmYxqosVLggn998DQABJc5kLkra5BYgAW4UA7dUHsgDM1ze9yLcTf5UA2gGTJgw5MeJvfjYY8aAkcAGzE2wvhiw8cONv20B0HcevZd07Z7N2/n2WOJdg1z6xd7GoYvI7mdrGIpYG89rhjw86qLGVezx88Xt1247OzTVq3a8G8b93HbeFjh9nyXWtePc8O+d27yNIOy/aqJbJDbazkIubnbH8cOF+Nct3df93xS7frous2+Qs/Z9UqEsqJgwEXAlgCQbcwa+gHLHhdXDqFzEcib/DkKAVLmLFkYiyjEXJAHiTw+NAIUCMeiyJe5UAgH/rc/OgFKwsAFVTY5ASPVh/TGgF5wbuyp4G2Ck/Phw4CgESNIpS2U8GawH5hxF/KgPAVW/pFybhzwB8aADKSmIF/ylRe/n8waA8Mme7ofWVIK/DgeBoCzvePXSzdjuwUbI8ph0WSKTNgVOjiBA8LZa5DI5N5pjI7z/My+zJfosO+DqKvjLGuVmutrrmNsPDG1deUJsO0dLdVb+Ix0/09r93QgM0mn0zGMWP8UpGQW8Sa1MTj8Phve3Ix42q8mvmPezhbt7yIt8S0cuo2P/ADbeWPU3VPT/TTLi2mk1f8w1YPj9NoBMQfJmFaazf2nuLNy5w02I/ens8yZsfAbHvLkIcFdp8ka9J68vbDawmUb/1pMgtIp9rZdIxwvb/3qcj/ANE0/uN3+naXhuS/LHpH6SHnzfggvzMxu6dQ7Ru0vTI0HTW3dKwaLeIvbTRPPLLIWaM5tRPqZHL5QuGCgXbxr3jhp2rU9u5K42nroktD8lRSpznlK9Gco7MFBJ7ledt6Tce7u1DqHvRs3TzTnRpu0Wh0z6oKGMfuFrsFuL4DAE1T5Jf9hlsrtK7O0+OhuY+37TFKGqtEbZ/y3baM4HVE7C2UZoAbNfG9nHLlWn/lc/6a5T3+jLziR/y4bSuEfUetU/xKYkPHxwvby/bWK713P6a5TL6NHzmaN3E7Qaborp6Tf9Nvuo3BDq4dMdJNEqi0uYBldTyI4WqyyrPZY297KUEtDda7xqYzL1YhtqVdJwfMHF3yAQ2WwOa454W/fXRlWEmsE80SMpMcQAWZcDYHhhUJUJrU8mkHrIGYKQRGcWH4WqSBwwxzGMpMIhcsseFxl/DxqKkng1CZ5TGpLQoD7lrMGxBsPClAPPG5/VYXjPqt52ufD8alARHpo3CEtYsCWiub+N7cRRsEuHSqYybkSZVu74Y8SBjY3ta9Ytk0FPIYoUszFm9OUC5N74EG1qUBF04nmMgN3jlOJYm5a1r8iMf6WqXoIQxrWlhy50wF8wbEXHEXx4YVK0gIS0gsBgBnJOOVbG1jQglwma7yyPmsMlgLnLhiCvjUEkKWeO7HTxlowpw4lr8CakEBdRKc75QY0UZwT/Fww8KkgygmaNH9GYpa+c2axxFifCooSOrrVgZ2BGcYxNxONuPlhUNVFTzTuHSUN6M1iFXAWxNsQaNAbKK7AFfcZiGOoGFhxxPDCpqQLOmELSStM0saHL6MpNxgLjniPCoqTQUkhaONjFZJfVlIzY3tbHwNKAjSIxRY3OIYsbcr48OFqyIO59Ld9NZ0x07s3TsWx6bUjaYTB9Q8jpnTOzA2HMZsfGucxndyGJvSuubW1ppQtLGaStW1BRToZ5fuP1+Y36cgU5j+n7z3C/G3EfCtb/FLf9R8h6/WZ+aiXB9xevGZpen9LEyW9tRO/qNxYcKh907f9R8iCzmfmo4v0fqkl7h9M6mV8k2o3yOVeBUGSa5+Vzb4VfZhGmEuR3oPmRX4Z1vRfpGwd2JVXuj1hHJdYRpVBYEZsIEJGHma1sh+St+HpPXMfmJGf7hTheyva+RPWC7Dl+VEfD4i1sK0ssX9yxB7Yt/pbRs20fbxoNdtm07hJ1POJNdpINVNEIFygSxhyFGfEAm1zxrUvd6JW5yj7PU2te8z3t5SpRT2taMsn237SEF+pNYJT/HHCluPINmxrxfeu5XRbXKZ/Ro+cRdz+3zRaPb9brdP1Pqvd2/Sz6j2nhUozRozgMQQRcC1/wBlelnvTOc4xdtUbS177MbmUKMW9rUirQfOBGAqpIPcuTjiOBHGuyaoyjQS6wJCumRRIrNdxYDKeZwqKaak1PWdMsaoTbLY58c2HL/XQgSgimhYZhA1srg8yTl4fOhItmjieHTH9Zy1jf8ALlthiL3N6gDp93UJnBPoLK97Xyg4fPypqA2IUcuSfaKMFUkmxtxA8amoJcOkjEhBViA3pU/lAsDi3xqKig8B7Ky3kvk/iA42GJA4Go1kkESamScOhYkA3DcAG8jhjx+dToRAvVRywxNlQgfmUDHA8DY3tjhROoZCgkZ7hVF2JQKMVLY8rfsqSCaizNKEzgRRnMAbH1A8MMagkb1E0ZayBjqMw91jyPgBxqUDGNPK8wREyMXvlP8AdqSCdp5mIVglg+YorH0grfhUUJHl1KDI7gBbnOpOa1j/AA8uVKAUmqM+p91vSLEe4BY+kWBN+NRSiFTyVVDG496xIVOJU8b4WqSA+iJ9vLLay3aEMuYcrcvDhUbRND2OXN7pijbJGQmdxiQcQSBgPClBUbcG0jWCpIgVUHpwHOwqQdJ7d9zp+3ej3fRw7ZFuH81mimzyMUKNGrLZrcQQaqM0yeOPlFuTjs15zdwmNeGTSVanQ/8AmQ3AsL9OaZBlvcTOQW/Dhyqr/wAUt/1HyG39Zn5qJMX3F695Fz9O6aKI2zSGd7jxwsKh91LdPePkQ+sy81HFOv8Aqs9Y75qt+1UK6UT6eGAQRtmAES5VxPjzuK6DLsEsHZVpOtG3ylbib7vzc2qHTe8M5Gwdn3Q+4JNvRmfAYZIQCLc8bGqbIV/PxHa62b2Y+7tcR//Q+a2q1EJ1WqWMgiOVw6DEXuRa4OFKUAzmAizSGyR4Egg/m8ceNASdNqpdJKk2g1Muj1EdjHq9OzROvMWZSG8KicVNUkk1vPSTFuLqtDN/h7pdbeyNLum7QdU6CMD/AIDqHRwbpHa3ANqUaVbj+64qslk2GrWEXbe/BuHMtHMbizC9Skntr0kpdOnnJ+zdS9v933fZf5n28/kWvO46QQ7j03uEsMPu++gVn0et+pTJfiFdcOFeOIwuLt2pbF7aWy9E4pvU/wCKOy+VM9LV+xKcdq3R1WmLpu7zqjbvudnl1XdSWbUtaVNl2+ORitl/3moAsDjywvjVd3Mk3lyr58uo2u8CSxWjzV1lfHmjDsqgALiycQbjhXVlIJDgRlmJCR4kgg2zWGIoBwSKVCxsbcQ9jYc/jQDgXMM5IZlGFhifhQDV190D0q4xtzOHh50AkXDAEtZrBhc+VsLY2oD0McxKuzEYX8+QPwoBTSyIpYZWzAJwFzgbkX+NARk1AuuOZsPSRf5X86A3DoaUN1l0jIqlz/PdAT7YJNvqU4VpZn8pe7EvVZs4P39vtR6Udh+6DV//ACg7OSLhdihXKTw/4icnG3nXM9xnXBT7b9WJcd5VTEx7PWyvJkuS6flYcLY/667M54YeZY2FgH4sT442vjQDsEq6pXWNguBJjOJA8b0AlnIJSWR/y2WxwuoGAHyoBxZfdQIRZhcvcDEeNAePkNrg3v6fAi1+Hz40AsMAo/UUte9uNvK3OgBizM3FrDNe2AHjc4AUB4HVmW49RX8wJAwPG1AKsbl+OHpFxfjfh/bQHkZhzopJfO62vw/MMeNHqBab7uEjHcTpyFAQsXTcWYA2tm1WoJv+Fcl3OSWFuU899CLzP3/Oj2etla9Y8o6QQIS8H102YG5yEQqfgL+ddZulNHUYzo5m/mcKpzfG3qAGVrk2PCs2RuHuwGVdq6mPG2tjDZVPDM1748BzqERHWYrYnkG8aUxKHk91Mqi7E+teQpPUZxNj30Z913nNI0sg1Mod74H1G/xqInmyzn3BGD/L37f9QRcy9PtmYeI0mhx41yPdtJYrFpef+aRe5tV2bHZ6kVUUKcyqS2bjfDjw88a64oj0kKhDY5RewPla/wAqA8vfBVuEW+UC+AHE35fCgFB/SuZ7Y/xYcPOgGnyE3LBlvgRy8vKgHOGPDJc4gHAc/wBlANPOrO7EsiqDkthe+HGgHUEjAytJhGpF2xsL4m3lQEQ6yNiwUZrG5e/Ljhx4UA+snEoQMwuRY2HA3+dANz6hY4smW7Wxvhh8udEC3Pd2cy9j+1ilWcKNsDsBcYbfIDe1gDbhXz7u465xivt+ujqs3X6Cz9n1Sor6hVzKCLBrk2OF+A+dfQTlTyHUMHAU5lYBSxtYY/soB4s9gpNrC3pwxH770A3mshKu1xgtsMuBuKA9sAjZj6cLZr8jwvQDsarIigABWGDDhxsDQHpYgjG4X/1YHlagGi8byBQxMkgJy8Dh8fhQCTLZ2JsGbEN+bgfLxoBYaOURZCAXOXxYk0BbTrTcenF7I9kz1Vte5bzo9NpY02rb9Dqk0WaT6S7e/M0UrFLf3BmvxNcJlqxFzNcZ7GUY0eltOW7uKqXKdLi3ZjgrHtE3o3HTc3Xp5jiUfcWLQuV6R6J6b6UaMjJrm0p3bXeTfUbi0wHxRFrpnlbue+u3J8FdiPJCnSU/xux7uEY+DafLKvQa/vXWfVvUYUb91PuO7xLw0k0z+z8oVIjA8goraw+Aw+H93bjF76Wnl18543cVdu+XJvw6OTUateJnVFwkk/KowOFbZ4Hhl9bE2Ba1m/Nw+HjQGQ0kummk2J86qg3rT+65INrMpYEC54cq8sQn7OXE+gyt+UuNHRO+8Os1Pc6FNuEv1q6HSHSrBm93Oc5BXLjeqLu44rA1lSlXWuosc0q8Ro10RpcW2dz2iEXsdQsxCyRsPqCSOKkHjY/u8qsHdwS3Ycxq7F/elzkxtq7no8cYTfZWzBliUzuCU8AtwQL1HtcDrrDmJ2L/AKXOYffP8ZtpF1HUUe6JpnlyQfWibJ7guB6XwBspt+ytjDvDbVLWzXgpq8B53Pa0rOtOE1N4DmVGt+plwUWxJxx8a2kzxGkiCS2yqov48r8b8LGgPZ3f3wyLfxk8SeB/rqQOBDITcrdbsyjlfja9sL1AH7LFKQjxlpTi1+AsCb873qCTI6WKJdKGZg0jmyoCAUCi9wTjcfurFt1JS0DUoXSXAGdpW9DD1H81r2N8KlOo1EiKOR1OdgzWwW35PE2HC3wqHoCIc0OR42RTiLhWHpHhfne9ZIgckkd442OF2wktwxFueFRSgIOplaRDcF5A95LCwBPIW86lKgYaJp5ppEyK5jS+Z8cAfA8qlhDQktIrMz5ZiBdSDmuTjbwwxoQDqVJCBWVyWEhvgeHLDyHnQkRNAulMYUHNLja1seP7KJ1DQRNPMZUIVgFxd7k4cDbjwvajAj2HKBmS8ikC2Av4i3GpIJ2mzmN/QhwFoyMfjeoZIRySoJAPSFIAseBB4ijA/AhQeuQe3ICxc4DMDgTY+ONYsEZwJBGiShFV8mdj6Ra+JHxrIGUnghXTokbZrLcnMPW3PDla/jWEW6ktHdu3u29nNX0ltMnUku3/AOIJvebcvf1DpKCJmyXXMLDIFGHLjXL5nezKOIl7GuxopRcH7y2wkMK7S26bW7ym9xbX2FPuZZNnclrMss7lgT/D6jcfDjVc72belyG0oYLg5R1dj7Cyxq7fyY6dXP6n1DovpuCFIYYDE4VDv5vX+OvET7PBcHKVn6XGhTubsH0rgaCLf1GiduDacTEReJN1y8q63HbTwU9rytjTx00lLh6e3jTVtdZsPdlA/cnrGRvyw6YA2/8AtMfE/O9eGQ/JW/D0nrmPzEjOdfCN+yva6NGVgWZXe2BZUfMOXA8a0stT+pYj9t498V8raOdaHbu5CRR/TQ78+kdRHAEE5jtlFlUHDgQbeFqtZ3MHXxnCvgNKMb1NClTwmRG09zoYbsN/QWIsWnzFT6RcXLXOFr1h7XAt64cxlsX153ON6uHuOmmng3DT73HoNHDm1QlGoVPbIubg2DCwx8uNZW54NyTi4Vb0UprIkr1NO1TwmhlGKrKxWxNr2N8vL5VYbprDDQZChyDFQSxNze2IPnUgc1BPtRqgDsowseHPiPxtUIkBmkVQxVSwAVfHja+HEUIHyiRhJCyZkzDITiMcOJPzqCSfoo0aSaSZ0si5slwQxsBz5cqiTdNBKQ5JFHEfqD6lUWKMb2xNltwvhUVroFBOnMkwVmbKjWIjZbX+IFr1LCE6rT2RmytmBsVUcSeWPEDhRMM8SRzG6ZQyoMABccb35f2UaFSM0rZPbLZ/RaFQOXHHzFTQggxSS+7BGEursMqsSAL/ALzUsgk6ovHK2c5GgNnyEDKQL8D40RLEOAQsqAyEqAyNfMM3ja2NAIfThYW1bgZgeKjCw4WPhSukUG0lmDxRqoYX9IYkADmMfEVJAo6dy0iSKoW5IK+kC3PHleoqB3SBw4UqqWvcMMTccPKjCJAaVJ/Sipf1FQcLDlTcJFRCQv74fMVKrjyXha+HAY1APJsi+9HE4JK5hlNuVgMfhjRAm6aCFNKSZRJI9gZFIAVfC2N/OsW3UlLQdK7VaTt3qZeoB102jWWI6YbSmrlZBZs5ky2IDXOXjVNnc8ZHY+Gru1ouKnWb2AjYe17Xgodmj2nsJHIiCbabquCS6h2UjjezEg8xf+uqB383a1S5EWSt4Jb3KSF2XsRKZET+TN6AZQJmsA18Sb2vbxNYu/my87kJ9nguArZ3U0vSel6jn03RzQnZho4TfTOZIl1JDCQK7kn+7fHjXWZPLESsJ4iu3V69DpuFNjVbVxq35NOc6L3bVJ9g7RRRMrI23IQyjEgJCLgG3CqvIqq/iK+d1s28w93a7J//0aM63uLvGul1UXVGy7D1bmka024bdFDq2AY//F6MwSk4cSSaqHk9uHuJztdmVY/dntR5jfWYTl7yMZ8a0/ejRkI6rtfuqsJ9n37oqRmux0Woi3fSEngTDqRp5wPhI1qbGYWvJnbur0k7cuWNY/hQ2sLPXGUHwNSXI6PnHl6J0e5FT0x1vsG9SNf2NBq5n2fWG/IR65UjJ+Epp9Unb9/YuQ4YpXI8sPG/CPgoz93djLgfiP8AFo5zE750P1vsMKzb10ruWj0jL6Nf7Ly6U/CeIPEQP+lW1h8xw2IdLdyLe9Wj+66PmPC7hL1ry4tLf3OVaDC7JOBvOyY5zFuGkLKG4KJ48RxxrZvr+XLsvoZ42/LXGuksJ919k7rmSyQmXY9GSw/iIm1QJN+dcx3M+Q+3LoRc94F+q+yusrSEZPcBteYCykDGwtxvXVlIMgnK4yBUzXZThnPmD50A97osnpAvfIPDyH4YUA7mkBUSYgqMVYEA42oAGF1zflBJfnw8Tj8qAVlYhiR6hbMeIt43tyHjQEaYyMFWLEAglh+61AKZSrxAetsfXxuLYk/A0B7Fp5JGYOoUBsCTiVtj86A3LoEex1v0WqsCse+baBfDE6qMHCtLM/lLvYl6rNnB+/t9pdKOyfc+66ruBs+pkVPeGyKntqcABq9SBfzI/fXN9yJbWCm//I+hFv3kVMRHsrpZWyaSL8qIXYrZ3DflJtx412Jz4hWcNkb1MTlaJreocjy4jHGgERadoZyyKLG94j6SVPIUBkI4z7/vtYjKAIj/AAkcSOeNAR2XM5YsEdvSMeI4ceeFAIZS5yBiD/C3HC/K2OFAeBSULI+AICZDYHjgfw40BJwyhwWUXAdybkG2FyeN6AYDuctwDH6h7lrjEnzwoBL+hiF9A4NY8Lfs4UBJSxaBnyqoljzDx9akfCoep8RK1lk/u51STdxtllUkpJsEQsMOGr1AtXJdzJbWDm/TfQi87wKmIivRXSyvOoWU9HoQCsP183uXJ9bGFQBbgQPOut3SlhqMd0cjDc4GXk4vY5bjK1wcOFZsjcPdgEjbV1KLWvroy1nP95rg4Yg86hER1mL2JJP5xpfaYRy+6mRhdbHOvMfCktRnEzHUDmPed2zI0bHVTXS/A5jcCoiebLPd+Jo5e2/YCAMPdh2Z7E+LaLQ4cK5Du5JPG4xb0+uRfZsqYfD8MepFWpWYMLWH+yOJ5GuvKE8tljBRQXYWHO554DzoBxGd2IP5yVCwrxOAsOdAeOAzoiMyrfKWBIufEKf20AzkvclgpS2dVvgCML8qAXYFbtJkBwZScbYeHwoCTGt4XiKra1kJ5eduFwTegGZI5BpxDcMQuV5ieI58eNARoojp4ywUBpDjNwwPIfOgAMws7IZVIKxgEDMP73hxoCTIsE0RVQCjLYm/A44D99EC3vd+ct2L7Y6ZcntwvtSxODxB2pzj8DhXAd3ZVzfFcG366OozZUwFn7PqsqC2n9y81wXNs4PgDy8b135y5FKyLG+dAFzcAf4QRj+FAKlWUNG8fI3ZPDwueV+dAPr6yLEXt6xxt/ThQHuOPFQB6UJ4gHG4oDy+UFxiT+VVNgCDy5D4UAiR3UL7lspUWxub8DhQDbuTILALIMRJcAjyBPKgPIjZi+QRWJJNvHHC/iKAXGphyqzCO/kBfHlx8aAtP3h/R7GdgohEEto87BTYf+4xXJHjiK4/I/8As8Zx/mZfZkv0eH4uorDpNJrt11SQbZotTumpY5YYNLG80rHkcsas37K665ONtbU2orfbp0lHGLk6RVXwG9ntl1lBGs3UOk0fR+kZAff6i1sOgIv4QyMZ248ozVXLOsM3s29q696EXL8Xk/iNxZdepWdIL0mo82vmGm2ft9tzqd26z1e+6lDcabpzQFUv4fWa8wrbzWM1HxOOu+7sxtrfuSq/uQr6xPscNDyrjlwRX5pU6DxOq+k9ukDdO9utCjxkn+Y9RamXdZGJ4N7CjT6dfhkanwGJu+9xEqb1tK2uXxp86HxVmHu7S45NyfJojzEDeeqN96kfpg73qIBpNv3iIaHSaLR6bRwadZmjz+3Dp41XEKL5gThXvbwNrDW5+zTrJOrbcm6J0q26njPEzvSjtvQnoSSSXgSN+7q77J013n23qFIY9S2zQ6OVtKWK+4uRgRmscbMbHlhVPkuGWIy2Vpum05Kpu4+67WKU9dKGdP3Hq2pgKdOMmkAc6hDOGduGTKwUAWPHDGtdd06Rdbmnc0cp6/WXXydA6v3GRtNJl6bf2WVDGPfux4l72Ucb4Go/xPR7zTxchP1nT5POaB3F7sN19s8OyQ7K23pDrU1bagyhy5RXQKABhfMCcTVllWR/A3Hc2q1VNRqYzH/ERUaU01ORzKqiNXzgRKAzKMxF7Y2N7c7Gr1FeQFXTOQXbJYkqz4CwJtcWtfwFSQKliKoGEis73KlSMoXwI8aIGQQgQkIqsQoso4/Mc734VDJI4T3MHynC918TgR8gKAnaS4jCllVVuqtmGGPhx4DzqJEoRqJf1GeFCYrhXZgMxueVrX+VFqDFyRxhLs5DKbMuNgL4AgcKJkC2mtZLo5vZcfyjnhbGooSQ5pQzsoxzAYYY8MxvWSRAiHSDUI4ivmQfqxriOWIPjRugpU9ZDppGETMgcZXJtmtccTwxtTWAjWK0yn1SSDIrC1gb4WvRgaiQGZiBiwy4k2BGOBqWBa6f3rgymVy12N/PHKaioHY9MY5wyo3tAMWci1uWJ4fOjYHTACzOouzZfSGBvmOOPgBzvUVFBsacqDkAhEi8GPDnx5DwqaigwIm94ygekG98LE+dr2FhU1BLnDHLkbICLyyWwOFhxuflWKJI8UTBgz2Uhib+F/3n41NSDJO8Z0kscmUuq4gFbk4WIFY7pluG7dPdlOq+odq0PUGgOii0mvjEukWeXK7rnZb2ANrFedVOKz7D4a67cq1WuiNuzl127BSVKM2Zft86rVWLajb87HBEkJHDE3KixJ8q1v8AKMNvSPX6Td4BH+QPXAkhRdRt/tODmCzkkOeCkZAOHMGp/wAnwtP4uQfSb3Ac16MjeHuF0ok1kMO9wQu6m4zrNY2wNxcVaZi9rCXGt2D6DUwypej2kbZ3XDSdx+s8rRi0NnjBIJCwx4njcjnWtkPyVvifSeuY+/kZzroCTst2sjVwA/ukO+DBgrAjADgSR54Vp5bozLEeA98Vpwtrwmxw/cVLDtej0kXTwGt02nggecz3iJjCqxCZQQGA4XwrWl3VjK45OehtvVp0nqs4aiko6UZKT7jYDJCYem5AgZhMW1AvbL6bWXxNz5fGvJd09Drc5jN5zvR5zFb/AN/f5ptG57PD048Uu56KbSfUNMLR+8hQtlscBe9r/ur2w3dj2V2M3Ouy06U3jzu5ttwcdnWqFdkiMemEbKxzkEDnYeCnA4DhXUvWVCIb+w7EOXKkLcsCpDY35cB+6pA4YkysySo0ajKixsAc3jjyoB/Rmy2bIzXOblfyFRII8YF2IdVCk2ynAheNz8bUA/pV9uR1W2U2dwWAPHH8LcqhhEnUP+RYh7sy3LMbFLY4A4f08aiJLGogssSu5ZGdQVGIJPC4A4/GprpAtJVjjADKyEXCXIJN8OIOPlRgZmmsIybA/wAWXgL2IFvC9SkRUjxQrLKI7lJn/LlNyfEHyvUt0At9KdLkazCWNgfVjwN8LfuNRWooeJkM0ckze4cHN7Ek8703NAGZEUSIbH0nOByKnH1AWAqQOtFmkKtLeygJEDdQDfA34VCYB9CVCBFZ3BAe4vz5W/caVFCY8KSOt8CpsfUDa2PDGxvhaoRIwIDdZfaKSKQWJNwTYHAczU1IoMSwOxVbh2W+d1sbDieNySPCpqCYQ5gsLGUHKpHLx8RwxrHdJIntO7EkhwRbPwvzvhja9TUgy2ldUOWQrZ/yNdRhhcf6awkZIznSfbPe+vfr9Rsv08UG3zJFqJdS+QKzqzKAACTgtvwrSx+a2cFsq5WstVOA98PhJ4iuzuG9xfb71eQrzz7chCflWUsSf4QfSBb51XPvRhtxS5DZ+k3uA8k7A9aojtp59uHqAymYglP4mACH8Cb1K7z4X0uQfSb3Aco606a3HpTddTse5e3JqtNFFM8kb3BWVc6m9uJvVxgsXDFW1chqb6DRv2ZWZOMtZ2LuwQ2w9oFSRR/3VEyO3pcgpCLYWt8LcapMi9/iO31ssMw93a7J/9L5tzf7+cls4EzFWsPUbnlztegEMXD5iBzJcm7c8PGgIsiflFsCwBY42uOBv5Y0Bm9o6m6n6cnE3TnUG4bGAAU+j1MsCsB/eRWym/O4rXxGEs4j3sIy40n/AKnrav3LXkSceJm97Z3N3Led02qDqrpvp7quWbW6ZF3HVbemk1wLTIquNXoTp3JBN/Xm86r7uVQtwk7M529D0KVY6vNltLkobcMdKcl7SMZ6VrVHyxodJ+7GaPUd2lRFuYdg0MbynHMVm1JLEAcMaru57TwNV576EbWfprE/ZXWVoW2N3zrmDA24+WPHjXUlKKYsJAxA44ucW+H9OFARpFIylf7wOc8ib8b2+NATI2XIhUHC4DEWB/2qATb8zcgLgkYXH4c6AG9RtkFlsSDfGgEtf0kN6mIIjIJtmPHHnQHiLGQcQQCS9+B8/M0A8jk5PTfgQgNgMx4UBs/QuHW/RiNe533bxhjYfVR4k48xWlmXyt3sS9Vmxg/fw7S6Ud6+4jaY967x9IbMBLCm7afQ6OSaMAsBqdwliLrcWuM2F65TulddnLb04qrjKTS32opl5nsPaYy3FvWkuWTOF9yujtN0H1ru3Semnm1sG2Jp2XUahVWUtPCspzBLDAn8K6PJMwnj8JG/OKi5N6Fq0NrdKnMcLHC35W4ttKml8KqaYAkYdcFAB9WJtfCrU0RAupQ5zcD9LA4eeFjQHrSMGa7cVALLhe9sKAQ5uRc2jxDtx4HHzvy4UB6rFCTYAkZrEYgc6AdkbAE2JNwM3Mf6KAShD4kHAGwF74j9lAKkZY3ZA1wFIYjDL+NAMt/CCACp9APz8eH9tASwVkdSFz+pTc/7JGNjbhUPSgWe+72GOLuF02Qn6f8AhyFxYYerWan0/MVync5JYWaXnvoReZ+634v0etnBNVHm6B0zi9pNx1BbDDBQP6q6ymlFNB6GYHowNHu0OTiSykN4FWrOSIroY5sWddn6oCgWfVxq3wLmsaCD0mM6biP880RW9/fTlckZhwqbi0EwZmurVQdQ75CVLH6uQjDE3Ga17VCMGWW+4GJE7e9gGyAs3TzSOeBH/B7eOXgTyrkO7kV8Vi36f5pF7mzfsLC9HqRVKVlORSQAh4HGxvyrriiPM5W7EG5FgoOBAt4+FAO5UaMNfOGW17HlbA0AznBYggAY5mOOB8KAceQr6cDYXKsOQ/tJoCOwsMD6sSptgQeOPiBjQDhkIuLlWsVYA87c+IoD0uWjAZrIwxQXwNzj/pNAeqbE52LMy2CkcedxQCGRD6soJc+JPHx+VAdN3vt3pts7VdI9xI9XqpdT1PrpNLqdFkj9iPINTihAzE2gF7+dUmEzW5ezG9hXFKNtJqWmr8nXubpZX8DC3hLd9SdZulNzd/cd27wiNewvaxwjKTJtuZbAk32xwT+Fc53d/wC2xXHP10W2bfI2fs+qVGFwGJGYMQAwNuV7eOIrvjlxJIkb1ZS1gwc8fPHlwoBmwuQpspazG3A/3vjQDlr2tZ7WdZGuOVAKBzWGW2BIXG5IwoD1fSCpucMb8R4Hh4UBG1HqkUKCLMA0ZABNuB5DGgFAZUIFmzWJVuB8saAdxsgJsQbrwIHlzA+FANrwJLZipuUsbry/qxoC4vcfqPQ7R2R7Cax+mNq6gmXbVg00e7rLNDp3TRxEyrDHJGshYC1pMwFuFcRlth38yxcVclBJ6dmib0vdo2vAdHjLqt4Sw3FSqtFa6NG9XpK4a/up1/uGnbQwb+2w7ZbDadjii2nTZfApokiLf9Ymulhk+Fi9pw25b825v8VSolj77VFLZW9HxVzGhzGSVklnZpdU7ASvIczvc4EuxufA3NWS0Ki1Gm9OkdF1UgAEtiVPA2PDGgHccqKTlxBXwBH7BQCkOSXZGZjYbzAGVeKXKgEW5+Fed73cuJ9BlDylxo7Z3IOxR98Nm/xGsbbMItJ/MvdUtH7YjcAMPDMRfyrmMp9q8rl7Ly6ypyotsbsLFrb8nRU3p917CZSrx7S/tEKt9PJcZjyOX5n4VXKzm+/LlRsu5guDkPf5r2HsxdNqT3DZh7MoxOOGUW/Cp9hm+45cqHtMFwHPe5snbJun4f8AB0Gkj3ubXRyGXTpIjeywfOTnwtmtyq1yeOPV5/EN7Gy9dNeihp454ZwXstdeY4BHqdSkkZOnLBlKhiLggHEgYC3xrpKJlXUmSkZ0ViZIiVzxlQeeYC5B5moRIwIY0zqiKVkDFRa5YY4D+2pIIMkkzhVW9n4tYALbAVIJyRuYlJymU3DXwC2GBF/MVAHoIldhmJklT1ZyMyE8/G16iTCQjVGNM4hxBKjMeYuPUML4Gi06yWMaoapYHk1M3uCVgWK3uwBwJPlRUroIZGbMzEowBWzPgWb4i/w4VkAVzJLKWJY4BWwGHHEHC3lQEuHUGJQIpQrunrw9NjcWP4c6hqoTETZZJSXJdL2I5kcb+YBBoCANNIgNlfLiEC8LWB486mpBJ0uqRXKyLkOUXF8xt4i9wL8+dQ0SPjMGSSxKOOCqbKRjw53FSDI6rUSOYDCPcUFEkVSCWblfzNeaVNZLGoJWLujxNGouVexsLHxvWTQQ6ckudHsyMAuY+nBQTbCxtxNqjUCKzLky+5wOQlV4DwvbnWRAzGJH1KsQctgCGtYYeHD4eFAOODDJKEcBFJBI4twPA24Gi0gejih9syPYK3rvY5i5uuNRUk6DsHW3c3bdkh2jp8amXZ9PHKNG6aT3GVGJLBJMuY+om3gcB4VVYrL8Dcuudym06V09Rt2sTfjDZjWnEZkdx+7300MCw6oJEY1jlfRHOxiIazMVxvYXvyrw+k5dtN6N3+LfPT4zE0pp5D3U9zu7ceRR70bMSCx0RY3sGIPptfwsOfkKiOT5c97lDx2J4eQ5p0XmHcDpEzM2aXeIBI3E53luSAOZJqzzHRhblPNfQauG99HjRuXdoD/MbrbILv7F2bHnFHw/C1auQ/JW+J9LPbMfmJGb65KN2V7WuLkuZfbBvgSrD8BwFaeW/wDZYjwHtivlbXhOoaHcexEeh0EMybVnfSwmdZYHb1qgLF7KbMDcnzqpuWc2c5NbWt7q5jdjPBbKTpqH4917DEKwi2pAq3S8Egw4kGy+fPGsXZzfflyolXMFvIxu9anshNsu6z6CDb5Nb9FPHt8kccyv7xRjGFJsL5jzr2w1vNVdipuVKqulaq6eY87ssG4PZpWjpxlT2m1MePtNKEZGuOAuMBhjXaOlSjJ7SyNEklzFI35owothcXAxA41ilpJqR/ahVkljREsqqcwwBtxIFvjUkEaZ5IzIsaH0GwjAGJbnialAc0ySe2+chyovEv8AeJ5H8KhgfSIFzHKSysbKkdjlXkCP9FG9AJMwjj9u1jKOJAsAQPSLEHjWK0kkOIatolkE2WGNCESxJTN+YcrVLoCDGQ0cQQ2Y3C57n5WNZGIZ2zQRuWcIDcWykEeHj8aAlRSiIs2fK4YCOw9V7E3wvfhR6SReoleYAtJmY3YkHC4JIt4XF6hKgMe+m/UZ4UdY7AkDjcW/CpqQKim9iRUkSwD4FiTe/IrztQE129y8sdyqMCQB6mFsbkC2FQiTIe+w0ftxH9ZCWxwYKAcwseArGmmpO4RknlDxZtM9nVcxAubHgTjYXqaIgls4DABsyqSSOAFha+PMDhUJEkciOFnjRhbFggGY3+Jve3Op1ghSZ3EaoWYA5ieGa9r/ALTWRBKlQo0TIUV3W5PDLYjytjWKB7CiTMXbEj0OzDHKbm4/Cj0Eo23pPqfrHpyTcE6NE0kWuMf10S6f31zJf2zipytYkYHGtHHYPDYhR9vTRq004z3w9+7bb9num4Qdxu8GmOpX2NW7PK8szy6IsFvYem64LwtY2rRllOXSpq3vK/bSbCxmJVdfIA7k929NpVDLODGigO+jJbKhAvYKPGxPn8KPKMuk66OULG4lLd5DkXVu6b3vO46rdeoGZ90nSMTl09q6xrlUZMLCwq4wli3ZtqFryV4TSvXJTk5T1nbO6uQ7D2ebFy+1xGPMDzWBscOfKqHIvf4nt/vLHMPd2uyf/9OjGq6w6d3LV6iPf+3m1NO8jCXc9hln2jUEZsSYw02mJ/8AoYF6qXl+It+5xElwTSuLl0S/EbyxVqfvLS44twfXHmEvtPbrcgX23q7cOm5Rf/huoND78KscMv1u3lz82hFPiMfa8u1G4t+Etl/dn/8AIn2WFn5M5QfpKq5Y/uIy9sep9bC8+yHb+sNOgLRy9Pa6HWyBTxvBdZx846hZ3h46Lu1afpxcV97TH8QeW3Xpt0mvRafN5XMaXuG07rtkw024aLUbRMoIXS6yOSGQ2wtlkCn9lWdq7C7HatyUlvpp9BpThKDpJNPh0ErYoSN92EOcP5rogwABNvfjv5DCscS/5U+zLoZlZ95HjXSd++6u7925CbqF2DblXl/FOSP21znc3/r12n0Its/+a+yullbTnWQBWxIOZiDmOGOJNdSUo85ZQSVBVSS5vwOI/NhxoBiMCVSXYeklowpxHj+NALhZRIYcUAjzRriSwAvh5n9lATcWT3BmuF9Qa1vPj5UAkrnNyoYC7KLWthwt50AlgCAxIGU4Ly5+dAIJBQkqWPMHyAAw86AEJD/ly5QOPgRiOOFAbN0jMum6s6VmQq8sW97ZkWQ4YaqM2sOPhWnmKrhrq9CXqs2MI6XodpdKLH96OpNs0vevtvuu6+5pNHt8G2azXlI2Yqmn3KSVikeJY5RgOdcp3UjO5ll6CXjOUkuPZS8BeZ3KMMZbk9SSfg2mca739XbJ1r3L3zqDp33tVtWs0+hVNZqIXgkMsOnSOTMHN8WXyrocjwdzCYONq4qSTe7XW6lVmeIhfvucNTpwbhyBpWjIFmRbC5XiLcwD+FWxoBEXYvGWKA2ygA+HmedASZIgg9Vgl8uPOwvxoCOt84JBZQQthYXA8fwoDIJGSXbMPSbmIX4nwOGA86AdmjAK2BCE2sRfEjD9/KgG1jysRYBeDPfAeNzQDDKomVjcA3Kk3sLY2BoD2dFNsmDuvpfA+fLwoBtBIHRixILqGBsTfMMR48aAs7917oeu+l45B7zx9OoZ3tib6qbAgYcr3rj+5fytz/2PoRf94vfQ7PWzjOXN28gFzkj1+owJy3wNsT8K7Bayii9ZgukozLvUOQquS7kBg1wFYWwOHGsmS9RL2+IPs/UfthY/b1KO9sbhWJt5XoYx1mM6XQPve3KMob3UKsHU4515A40eozTJHWJVuouomKlnOoa1wcBlHnzqFrPNlifuBcydDdi3ia0cmxN7aC2VD9Lor2JxJrje7HzWMXp9cjoM59zY7PVEq1lcH1sSiXBBxx4YDlXYnPkiZUEeW1rAHJe/yFqAWi5UIxLf3Txt8DyFAeCOwBAAYkAAAH1AjDHhQEh4QQqglCb3kINhbmRxoDHyghABdizf7xcDiLHDhagGYxmIDEB8FXlz8vjQD7xmMB7lCuBA4Gx8OVAQlmdBc5ix+QaxIub8LUBJRmADe17rBRYY3Y44efjQFg+pe4XSW4dgOg+jdNqNSOpOnde2q3DQtp3jhGb625SVrqT+smAOPyqiwmAvW8yvX2lsTSS09nc8DLTEYq3PB27SfjRenRx7vhN77x7sup7O9p9IsSrp1XbCZpLq7N/LJB+bEEc+FUHd6rzXFOmisl+NFnm1FgbP2fVKnHLkshuCACDa9l5V3hzA0puVJjNyMCfLlfGgF+lmC3NgcCePG/I+NALy5r3QOUAIPja2B+NAKAZmyX43JYAXtytc+NAIldVVyzMqxR5iWvYk4EftwoCGipLZ5AVJW+JwYAmxI5fCgCN3LsllkkvcWPG2Nrc6AdlLhCVIAxzcwb2vcfgKA8VcBcmxB9IuBfyub40BaHu6M/Yb7fr3DrpVW9r4DS2/qFcfkr/u2M/b+Ivsw+RsftuFWHikxIkVAbi9+JB4D412FKlCbhtPb7rHfV97RdM7hLpgPXuMiGDSZeILTz5IwP8ArVoYjNMLYezO5FPeWmX3Y1fMbVrBX7qrGDpv6lyuiMnH0Xtuhkdep+vdh22bAtt22vJvOrw/h9vSD2QeWMta/wBTu3fcWJy4ZUtx/F434T1+DhD3l2K4I+O+bRzj0mu7bbSM2i2Teur5kuHl3XVR7ZpGNv8A9n0fuS28jKKeyzC75VyFpb0YucvvTovwjbwsNUZTfC9lckavnMPvPUMW9J08un2DaOm9Jod2T2NNtGnaNj7hjuZZppJZJWGQWzE25DGti1hHZhOs5zbWlyddx6kqJeA8bl/2jVIxik9xdL0tm793tnn6j7w6LYdPqY9PNukOh0sErglI84YlmAxIAuaqMjvrD5a7rVVFyZuZhbdzFKC3aIyQ+27dFzL/AIm0ki5RlLRSDG9jyNh4V4/5Xb/pvlR6fRp+ciT/AMuOvW2TqmE4eoNp2/ffgPhWK72Q/pvlJ+jS840/rvtHufRWyyb5LvsG5aRdTDpjphG0ci+7mykE4WuOHGrDLc9hjbvs1BxdG+Q1sVl0sPDabqqnLmQTQhyhj+nX23AJBBPkLXwq61OhoGMk1BDwRtewYYgkXTgOfnjWdCCYWR8iwjO4JSV3Y2YkYAfAViBOsQxeyqjOGuC1rEgY4ipTqGRRqGvIXa4FgMvp/KAcPCpA5HM8gVlzMqi0BbAC54W4G3KlATEhkb3C65EdSxk4kkEG3kRasW0TQYu4jyhWeL4gKcfz+VSQY8KFkLxqySE3MgI/Kt+FuPhjUkDjvjcKJWUDPHx4Y3NuFCRQlgaMGQepVuykG17nE87AUAoRe7qEKyPATcoQLek8ADew+eNAJjaZWSNAGXL6rggKThmtmxowSE0yv+oxVWtZ5ADY8bEngMKhsC1WYMArCQBbTDhfkAAbWoB3RzIJkmSFvazH3kve1jYm3EYmokqolGQ1CHTe26RM0uLWFyLHHC5wNsaxi9ol6DGQyR5XeUtkY3CqSQVvaxx/Gs2jEk5EzMy2eNGPtm3M/wAJN8cPGsUyaGNd5E94hcqsWXIRc2YcqzMSOdS6G92SQ2CcyT8/3mlAOwNK8dnUj3jcgnC/y8BQFiOkO+W3dM9MbHsEuwy6nUbVEYZJo5lRT+ozBxdSb+rGuWx/d2eJxE7qnRS06uAt8PmitW4w2a0NjX7j9qZmP+HNUFLWsZkzZb4E+nHDlWr/AIpOnvFyHt9ZXmkuH7iNubNI3TmoiaIgqG1CknEYfl/rrF91J/1FyErOV5pXTpeYT9w+ntSbRfUb/DLlAxGecMBzwF7fCuox0dnCTjvQa5EVNh1vRfpdZt/dRXPcfrdxKpUQZTH/AHQIoreHPnWrkPyVvifSz1zH5ifGZLrhwOy/ay0lk9zUFr8TkD4YAYDlWrly/uWI8HUe2Kf6W14TJ7Z9vG7a3Q7dr26k0qHXwQ6h4PakIQSoHC3HEi4Brxu96LcJyjsPQ2ta3D0hlE5RT2lpMlH9uGvCAnqjTpJfACBnUeYJK/uryfeyFfdvlMvo0vOQxuH2/wC76LQ6rWQ9TaZ/o9PNqH0rQsA/tIzZQ3IkDnh/Xna70W5zUdh6Wlr3zGeUSjFvaWhHBNKPfg9nJb3P1Ua9syqMSCPCunnoZUrSiFqJTCsqi5Vr2JuDmPHG/hwqaAfSWJoR+ZpmUOgLGyWtmvyxppqByZGTSyS2Gb81hy8CCePnRPSCEJnRowbKq3YraxFyPxqSBSTFyY1zlAw95QTywuG/phQkmRrNIySZB6SAWHBFJ8MbjlUOgE5Whd0izNY2YiwwGGSx43qK1QMdMql8xhJdB6BcWDHxOBrIC2c5VDtmkBwzcSBhYAePxoAjkjOZJk9o3C2HhbG3nQHkipKihLxpfLmUGwYHnzwHyoQLkEsLsEczOxUXIxYEDC4ahI8ITM36gXN+ZbAkrcYiwONRUCzHIhtFKpbN+nyA8fI2tTWD0uDKUWJl1CWOBGOY8hzoDMyqkkJ1PtMqsqBQLmxW17g2wrzTadDJ75ivdaXUFpVaLKArqpIIJHx8OFelKEVHcsMuX2iSrL+qpHqwOLccPE2rHSgRZy6zXVQgVblivpNj4VkiCEdQwJeQMBmLE42xvf8AfUkHsM07SPIwZgoAD3GK+YHjQHYu2fc3R9vdJvmj1e1Pr23SaCaF45AtvbRlKsSDhjcVR5xlEsfKElLZ2U1ylhgsasOpJqtTpf8AzH7WWQDpzUrZQcZ0OPMA5fC1VH+KT/qLkN36yvNJMX3EbZLIif4c1Ko1j7jTrYeOGWofdSaXvFyE/WI+aV+7ldUx9ZdSanfotN9HHNpYYVhchj+iuXMWHj+6umyvBPB2FabrRt8pVYu/7e450odK7nh32Ds2IprZdqjZQ2BY2gGOAxtyqqyTRiMT2/3m3j/d2uyf/9T5uagr9bqiozIsj5yTYjEjlbjQDMlwjRovtIfURa1z43/dQEGNvaKsjmOZGHrRsjDmCGHCm5QHQdu7ndf7Vpl0p6m1G6bbb07Xuyx7ppbLy9rWJKoBHhVddynCze1sKMt+NYPljQ3IY+/FU2qrefjLnqZnaes+kd53bahvvbfbNPq312mI3bpzUz7U4k95MrvpmOo0zAGxICL8q17+CxFu3L2V+VKPRNKe5v8Aiy52elvE2pTW3bVarTFuO7vaUdA+6f1d1myEMX2HQE8bH9TUi9/DCq3uY65fo8+XQjb7wL9V9ldZXMEe8SozBBdyTYiw5HzrqykB/wAjpGvto3qOFrnDn5WoCCpAUoGsxPqANsCfhQHksT2WXPa1wrg4gYeHD8aAyGmMrQtc3sSQSeIFsbeXjQEgWtiQC4xPHnYfvoACgBmcgEkEX5/G/jQHhBDK/tAsVt4gGx/dQECbV3Z0F1C3DlsD+3HjQG2dvI0k626PeQiRjv23BVJucNVGcRjWlmXyt3sS9Vmxg/fw7S6Udc+56aVev9o9/StptXHskVhexCHU6ggjhlrm+46pgZb+2/B4sS47yOuJXZ62cEjkMoJnW0f8Kc7Hmfia7E58G00TgvlF1NmN7WHG5xNAISGPKsiBMtwTbDxNrYXoBU08LegKo/2GBAuALn40AxGY81o8RmzXBBwF+F8aAZ9xlCyFcoDDOOZI4cOOFATDOGiDDP6v/Vi/pFh8bUAZ1CxjIxAJYJhcnif3UAjIZQTcFTfKjEc+N/C1AeNGFDXVWbPdXNzZT50AJjLEhOJmQK18bFgBaoepkrWWh+7KCE9xtgi07EpD09Ac0iger6rUYhRcYWrk+5qSwc6ee+hF53gbd+NfN62cNmdU7eaQBrt9fqeFyLEV1q1lLFazXukmEu86drgAOcLWxCt+ys2NwkbZONRs/UdwqGPWRWtz9R41iYx1mO6ZmH860Ck4LMgchePqWploRmtJl+rYve6k6hKsCBqyQDxHosDflaoR5ssP39WD/LnsBPGzF5NjYTIwAFxo9CcCMSPjXH93UljMZTz/AM0i+zZt4fD183qRVsAMVzKrqXxQ4+niLWrryhFCG4vcKLmxJuVHwPwoD0tlBVwWYG5cEEDkBfnegFNJaW+VwWxYjz+FANaie7iNWJbMCshJscThcUAlGPrGSwjKm2FsOJoDxHgQ5/TcYtc3I5jhQExjHqMmRBmDepj6bnnjccaAaXSxM/tgKzC2YC3A4fO1APKkKcAARghHgOJ/CgIGp1EjLkmUsuJexurDk1sL0QLdd2c03Yvtm02lMOnzbV9JK2OZf5ZKtwwHlwrgO70aZxit7xvXR1ObOuAsfZ9Up/7jQu6hwbEhRe4I+dd+csT4p/fjJEZYflII4HDEHhQD6hbqpAVQBY8/C3lQHi3TEkC18o43vjfGgABg1kwVRfjiPPyvQGI1AklldHbC5vHe4I448b0Ash42AaTFTa4bgLfCgPYL+4zxtbiVIx5WoCY1ir5IgHY52U+m+PIfPCgEpYrGyYgAhiTa2PlbCgLddf6/pnb+yXYuXf8AYJupMu3q236FNc+ghDnSqWecxxvIykHAIV8zXC5bC9czTFq1NQ06Xs7TptPVV0XG6nS4yVuGDsOcdrRo003N3dOCJ3V3XQ5oukdh6f6JjX8su1bekurv4nWa06ie+PFWFdK8pt3PfTnc7Umo/djsoqFj5w93GMOJaeWVWabvXUHUW+z+91D1BuG9z3/PrdXJPa/grkgfACt6xhrVhUtQjHiSXQa129cuus5OXG6mI0+EheMhQPy28q9zyJjYqxWICR/U38IPjh+4UA9G6omyOjhWj3jTs0jC+XK6kkWt+2vO8qwlxPoMoeUuNHRe9cuuj7q/WbK8i7imm0Mmgm0oLSF/bORkyjE28KosgjF4DZn5NZVrx6alhmTfxNY66KhgR1B3gWBM+r35iTmWYRSHgbG5Cnjwx4itpYXL66ocqPH22J35EsdS93wx9zWb2ixMGdWjdbFcMrWUHj51HwmXPchyon2+J35GD6k6i653bS/SdR6jX/y+OYFdPqEaOISpcDAgC4F7Vs4XC4W3LasqNaa1roeV67emqTbpwmnRNOpPtyB1JtIg5seBA8j51us8EAZnb9dFA9OXG/PHjbxoBTvAiOyIXZXLKRxJ5E8uFNIPDI2ojys+QZR6yQSbDC/lSlBUalZWjzsCFABdV9QNjbE+NSgPBSiq0foWdiIVIGLH1AEnwqKgdXUSApDLIXVXsUygY3GIP9QqKE1HpfpUCywsy2PqsByxAym/4moVd0aCHOySEfpiMMbrCDiDY+kYcOFZIhkaRCcItOEwFwotdjwNhgTUgbRMzuFJjZSVKA3BvewoQTG07RIBcLkcEqQSSOPhh4UJEafJG0hctm9ohCpvkxBU4ceFqh6QhIZ5HVJPajV2/hvgDxGJvUgRBOY5T7rISbgyY3zBjxLfsoCRpnR8zmYR2Zr3N8wv/S1QwSs8xyljmAzCMliPTe+JPMcqjQSK/SeL3JFDhVX3gmBYk+oH4UAyXEMhRA9pRdgSBcEWAvamsDbFswkeQEhBG0YxFsOHjhUkDKorTGN7ySyhTGxFwLH9t6kCp4J4RJ6lyxuRItsc3IWBwqE6hosT0B267a790ltO675uAG868SvrE+sSPIRMyquQ/lGVRe/GuVzPNMbYxEoW4+IqU0V3C4wmEw9y0nN6Xwm9xdqe0bh2XVJPnN1dtetwDyXLl/bVdLOcx3qfZNlYDC7/ADi17R9pJ1UDUD20exkj3EDKRcEZyTiMeJ/qqHneYrc/CT8Bhd/nKw9OjTaHuTsK6edPotF1FHHp9W1jmgjnKq1729Sjn8a6/GbU8HOq0uGrhoUlikb8d5S6zZO6AYdyOumGXKVOdbGxPsxkE2sbV4ZH8lb4utnpmHzE+MyvXDLP2b7TjOkjRHURM4/hKqbqfDC3E351qZcmsxxPDQ98U64W14TWtv33u1HpY1g1O+S6JIo49PGschCx5QECgLe1h+GPnW5PDYBy8ZQr4NZrxu4hLQ5UJ0fUfeELGn1m++tTZmia7A+nMCUHMHhWDwmXb0OX/UyV7E78hGu6s7nvopdFq9ZuqaOSBl1TlJAHiIKuWYi5FgQbms7eCwKknGMK10atZjK/iKUbdDmqe6rL7UoSQABRfAAHEG1+PCrR8JqodZ5mYB0HtnE3J4EYfDj41AFj6cWuuYmKx8geIFvGmkCE1DuGQXRbkDOR6Ra3C2FKCokCw9oMWKt6XGLWPK1SBMAX2zNGCixL+q5GOBxPzvUNgkCeeH/1uVJACAoBBW+AvwxHOoomTUk20kkStisyqDhhbDjfnhyFRpGgiyyo8eChQgKtI2GfDiQBx5f6alIVIpQAAJAMwNhK35rDHFvC3jWRBHyHMsbKYnIupB5C9sDwwoQTk07WZ81vcDEOQflgL3v50JGUULLE0mKq6EoDbMVte44i4qGELmlb3Hye2Y7kKz3zHHC+ONuGFEgxl2MMq+pJUARhcE2Bve3EDE41IJAlSWcj3QoCrlkBGH7uI41AJZeSzBJPchFiSCR6gTiPI86gkcQiQlHC5w3ptiVUDA3+PlRgjO0cSrNCkiHFFGBseZvQg8kZpeMntgP7ire9zhe55eVTQEd2TPHLLdo85BjAwuR5HA87VJA8+knRVMZVWeLMmAHpBsSPGsdpE0OqdpekujOqv59J1dqxE23tp02+A6hYMwkzs7WOLflHDhVJneNxOG2PYKta10V3qG/gLFq7te0dKUodoh7T9og6p9as/tizRvr0sScQTlsb/A/uqhlnWYv+Gn2WWSwGF3+cfHabtLIXiWZCzLd0G4AmzXGY4mww4i37qx+t5jTV+En4DC7/ADlbO6uwbB031HPtXTc31O2roYZiXlGoySurZk9xePAHyvXV5Pib2IsKd5UlV7lNHEU2NtQt3NmDqqG+d0XM+zdnpY5FkYbNGDKtsSohDDDnfzuKr8jTV7Er0/3mzj3W3a7J/9WkGq1/bTdJtSdR07vPSeqMrM8u1a1Nw02a5uw02sVJAL8hKaqXazC15FyF1b004P70Kr8JvqeFn5UZQ7L2lyS085CPSGy7jb/DPX+ybmzE5dBu3u7LqyeS/wDFAwE/CbGoeZXbXvrE1wwpcj+Gkvwj4O3P3d2L4JeI+fRzmH3Xt71fssR1u4dOa2HQriNxgj+q0xDcCJ4DJGR8698Pm2EvvZhcjtbz8WX3ZUfMeV3A37SrKDpvrSuVVRqN0v7eRbrxIIuMOdWFDVJuz5W3Paoytr6/S3CKbi8yXIArzve7lxPoM7flLjXSWU+7CKGDuukOlbMg6f0LFWubMZtURx/bXM9zYqOAovPfQi4z9t4nT5q6ytWBzFb8iVJsSQOWFdUUhGOoHqBS4VjmJ5j+rGgPPZjI9xbIoN7nj54eVAe2ICply4XLcxxtcc6A9jDxlyEUuBcOwzAADwFAJkle4dbK2na4UqQVJNh8qAijUasymXK1mAzED04fDCgJa6sot5AWZL5RwBoBaBdb6o4wkyOpeRgQG8v20Bunb6P2eu+iVyKU/nu2ByBbE6qPAMOfnxFaWZKuFu9iXQzYwnv4dpdKOwfdlplg7m7RI8fuwTbBp2yXN2yT6hLs3En03PjXPdy1TBz7f5Ylt3idcRHs9bK3+/HEbelQ0eaMhbKLj8p8DjjXXFCexSI0BJ/KHuFPkcaAQZo8pjzFQpsbXuLYG/40AydSjJjCTGBdWAAued+J5UAkSXKMpuQLEW4HnagHTGhGZn/LwNsL/wBVAPQxERM7AZj+ZbXJ4+fzoDzUn20DxuCJPR4HD8wPhQEOR8FJFiLi4Nhf5C3CgJcJMjWuXCgXDY4C4tagEqVM0bxJ6RLGQTyAcEcbfColqfESizv3Xzse4ewzOq5ZOn4hYC+A1eoxFuHGuR7lNvBz4Lj9VF73hVMRHs9bOB6qcHoiOEt+pHuMzAXsAGjDCuu3UUsNTMP0Y6jdIjKc2Jyi4/MUaxrORG4xewSxNtPVAaxJ1cYjIa9jmNjWJENZiunZLb3oizXUTofzD+8BU3NRlAz3UmpD71vkq+oTaqUxuRfAXF7YeHOi0s82WL79PIe3fYWHIp9rZHsBYn/3PRCuN7tNvGYxvz/zSL/N1TD4fs9USscWQxsEWzoQWby8j8b12JQEOSQtkzEnC1r/ADsKAX7hDqB6VPobmSLAEcudAZARqGWMMrMPSzWuoPhfzoCCYRnaNiFXilhe5tjQHjnKpF8wPEEXsR8aAT7yBrFWlIXAgY5reeHhQDi6lGfMQY3SxZVBA8eXLCgH45Y2cNgSDiRwuvG1x50A39Skck+b1eOFyxFiAB8KAZ1RjaJf0w0zKGWUYFb4WbxPKiBdDvBpzpft77SR5QZmG1+m5y3bbpnvl4Zjm4iuE7vxSzbE/b9c6bNXXA2fs+qU3OjLFHCoEurSraxwvhYfhXdnMjA1kVjEkRjj4KOBHjx/dQDUup1LZvbzHMcLA3w53oBuOXUOi6VwMoxCsOYBOPy8aAnCVpA5yiRDcuxQ4jAHKT4XNAMBCozW4H0p8/EY0AoxCQgG0eYBgDww44+VAeZkgOVU9ZN2ww8xQD8Unu5iLqFYkEnDDhQCgSLZB+XHMcfVfjQFnu9EGmTsl9vWoiLO8u23lNiR/wC5Q8fC1chkcUszxjWtv8zL3Mm3hMPxdSKqArd2Kg43vwvjjfmRXXlEZDb9q129zrpNq2/UbhqZcE0+jhediQfCMG1ed69bsx2rklFb7aXSZ27crjpFNvgVTdV7adRaFBLvr7X0fE/q9zfddDpZLf7OlUyahj5e3VZ9bw89FlSuv0Itr7zpHnNz6ddjpuOMO00nyaXzD6bd2425x9d1XufVEqG8um2LRfSacEchqtfZiPMQ09vj7vkWoW1vzltP7sNH4h7PCw8qcpv0VRcsv/iYze9f03rx09FsHTbdPaPT7vH9ZqNTrpdfqNSJGjxkZljjGUKbBEHE35VsW7V+3Cbu3NttOlIqKWh6tb08LZ4znblKKhDZSe+23+3Ab53Q6gXpjvZtO9y6X6vT7Lp9HMNOCFJQxupVfMFiReqXJ8N8TlkrdaOTlp8KN7HXfZYtTpWlDPn7ktFZgvTMpuRlI1C4jmSMnhWqu6b/AKnN/qezzleZzjg+47SDBOmZnK2uRqFAt/6NP8Tf9Rcg+srzec0nuT3Wh626dh2WDam0RTVRat5mlD2yB1CgWFr5sasspyN4K67jnXQ1q4jUxmYfEQUdmmmpxaOKYKPZdniVR7gvbHHiD++r/RulcRHhcSe4spiXEEAjD4X5VIBTaQoS0iscFFm5HHDG1xhQgVJJ7efTKit6RcLgQCL2BNCSOkrxNJCQzxZgVzm48/jQEuYM5ikCepSpNrNa9sf6cKAmiJP94WSd7kZfygkfG/C3OoqCZKVTTKje3lCqSVGIx9IufzA2GPyrBaWZEOVQGjy/qBszySPaxsLkLfEeVZIg8myJcxOHiGEaEn03xJsR8qIMh6JQ0moeNjEUytjwDfMYVLZCMkzsIG9xS4KFi5IJPLx4XqN0kxUKNdVNg2AKqbjDhfwvccKyIFu4V2aSw9JAVObE5bj4eNAQycZWt6r3FjYDLaxNuHhUkGQ0sMEgUhSqn1FsTnJ4HL8TWLbJH5IHCgTMwSQZYpgQW+A+FE1uAxkejljMqtO7YnMoYDjhe/Pzqaig9AhdWGbN7Qu07C/DEgW42xo3QCJmZ1UjMBiUYHmfHhQCwSVVpCFyAeRzG2BJ/dQgcb3mTIWIVfXfxvQk6J072Z6v6g2zQ7/ty6SPSbjG0uiaWXKWXMVGYAekEjny/CqjE57hsPcdubdY69BuWsvu3IqUUqMzo7CdeWJP0N2cswGoub/3rkC9+HG9eH+S4PffIen0q/vLlHX7HdwgEghTTSRkkZRqlCi45X8b2ou8mD11fIPpd/eXKaD0lphD150tptQoURb1BDqlYBsVltl8DjhVlmEq4W44+Y3zGrh1/Oin5yNr7qPLJ3L60Qi/tw2DG2IEEeUYeFq1chp8Fb4n0s9sx+YlxmW66snZXtdHFZlneYzEAKDJle7fIkitPLn/AHPEN7lD2xS/SWvCblpfuM0Gm02ig/w1K30+mihkK6gL6o0VSEBU4G2FaM+6spSb9prbeo2Y5wkktjUt8ej+4/SFVJ6amLtjkXUKMR/1OdQ+6j/qcwWcrzRjde/en3TZd00C9PvDNuWlm0q5pw9vdjZCxGUXtfxr0sd2Hauxn7Sqi09W8zG5m23Bx2daoVkgily/oyMZScQDY5QDzNdbJ6dJTITqIJHYXb25FtnJN+ePzFAMsWQhvdaQkHMbrcnkLeNCB9nGmyOqD9VjlVgb4AcaaySH7kkMqOocCQMJULYfjjQEv/facL7YubhQCMeBwFQCTDEJIk9yQAqgIQixA8/jblQGSg/TRiEiUFrLH+bgLk34DAA251g9JkiCwT2DIhZ2UZVvbKovxN+fzrLTUgUyxqihWCsLjURA2DFTwFhaxoDHKBLrIlxV2JBIuARbG+FsKy1Igy0bSrmuTNYhQSRa3IAXFj5Vi6EmKcXmlZRlVmPtEfm8D6f7ayIHJAQI1OVUBWzXN8p8SfGgIjuskquAcuLIt7MbnhUkDulSOQkEEyD0e7mtkAFsvncHhUMkybadlBKerTKbkHALe2NjwrFPlBi30b/UCRNQ+WQXS5AOONieWNZVB7Gh90x3aQyG4RiGyeZI58eNKgcluFkiF3yHLIVJHDja+NqAaizlTGx9Jb8zYnL4jwPnQEhGkIPtt6JBkzDEAYniKA2npTtv1B10NfPsywNFtkscWqlnkyWeQFlsMScBfDyrQx2aWcE0rjdZaqcBsYfCXL9dncN4PYXr0szMdA1kKo31Buy3wXhgTe5ubedaH+S4P0uQ2PpV/eXKL/yN7gQRN7I0rOy+pF1IF7ECx+VF3kwb1t8g+l395cpzPqrprduldfqNo3eNE3KKJJiFcSKVlGZWzD41b4TF28VbVy26xbpyGlesytS2ZazrndVvb6f7PRaexhfakdCAFAbLAS3jjVHkem/iW9e3+8sMw93ap5v7j//W+b2qVpNTO8jZSsrNcC4sSbC/LjQEJ4xmLZRIOJH8IGJuQLfKgJm179v/AE86arYN2120TXGOineAHiMQjWPzFeF/DWsQqXYRmuFJ9J6Wr07TrCTjxOhu8fdPe9x9mPqbY9g60jWwk1G7bdGuqI4G2r0f08/zzGtD6Pat+5lO12ZPZ+7LajzG08fOfvFGfGtPKqMzO16vtbvG9bMp2Dfej9zl1uk9p9t1kW66FpPfQKrQ6xYplUm1/wBVsPGsL8MdatypOFxbL8pOEtW/Gsfwoytyw05qsZQdVqe0uej5ze/uwkL93ZPcUBl2TQIIwcM3uagkDgefG1aHc/5D7cuhG1n3zP2V1lb2V5LGRsuQ5gwGFvI8r11BSjDJ6gwX3BxIHAc7kC3yxoCOxcKGVc3A5bC3MHxoBxZR6AQGIAvYn8w4AHyoCTCyepiRio4YEgC5GNAeyRyu5likCnKM8fA5Tyv4EUBIiUxxkekxPf0g8b4W+B86AR7UWVIyRxu2NiAeVziMaAitPkCKlowlwQq3YC543OJ+VAZ/oyTUt1d0iQwRzve3JDGhIJY6lCpsPwrSzL5W72JeqzZwfv4dpdJ3jv8A7Xqt77p9D7Nq5zpZN50Oi0SamTM/tfUbhPAGykg2UkkiuU7m3HYy25OWnZlJ8kU6F33girmMhFaKpLlkzj/cLosdAdXa/pV9zj3l9BFppf5hGhjWQ6iJZQMhZiLXtxrqcrx6x+HjfS2VKujXqdClxuFeFvO03WlNPGqmlz2zksDmF+OAB5DA1vmqQXVC3usVU2KZb5gfDHmMKAkJHM59vMEOS4uc2NuAA4H40AldMYmUvJaRhgjcbA/HAYUBkJUJjhZLZyA3lbDE0AoKyqQ4AIkYAjgRfCwOPOgI8qLKmQMXiZmN/Frjja3CgFywgp7XteggtGQb2Ycb4+dAMYrCSi2jNsV/p50A3J7akHNY5hhbC4I8yfjR6gWd+6WeOXrnpmVkWx6cQgC4Nvqp8T51xvcmVcJc/wDY+hHQd41S/Hs9bK/a7236RikJPuDXTrBZb3HsqWBPEAYWrsd0ooajE9H47rpw11BcZcozXazYG4Fh51mxuMVsQUbR1MfUttdHlsoNzdrA+APOoREdZidjEbbtpVnukRkT3CgzH/eLyIFJajKJs3UDp/NN6R1BZdRMABwUBiLCkdw83ulg+/0yP0Z2MjOVBHsBsV89LobHHyri+68q4vGdvrkdBnKpYw/Z6olaU9Lxe36jc35XI8bE12Zz4LGolLtHmeIXZRxLXwv4UA5NDZklK5ZlBOZTf1fjQDwy5mGa75yWXgASL4EcMKARJHIWJKhU9w3HBrKBYk8LUAnWotwmcIoW5PkbgeAoCMulliDsH9CrhmxB8ALG/HxFAR5VLgLKwHuKQr3DHE+IoB1MoBTKCqghQCbnnwwtQEtgrRrcHLchCbXBwFr+VAb71D25O0dtOlO4n86i1KdU6ltOmyiMhtOQNR6mkz2N/Y5Acaq8PmkbuNuYXZo7aTrXXWm54Tdu4J28NC/XRN0py/uO094frh2b7XCZ5EgYbSInZmIBfa2ZRfhgDfCuT7uprOMVX0vXL3NmngLFPR9UqcJ5gSHIXgAUANwOZOHxr6AcqS19uUtKQoZcvqXAEAY+k3vagJKKqvI8ds0gspv6fhfww5UBFkgmZ3COqs9zKwPFeOIva1AOKURFQtcKtw/AEXsRQEMuFFrAlcQBcAHH8b0Ay0jMy5FzLgCRiVI5UA4FLXXIWItcgeoX5ix+FAPiIMAuYEj1ZQL3t8LX+NALdmw92xF7ITgcfHHnb5UBcTuCOl5OxPYjUdWzbsuj0uiy6bT7OmnabUSHSLmSSXUELGoVb3Cub8q4jLnf+p4tWVGtdLlWi070dfKjo8WrXwdh3NqlNFKb3Dq5yv8AN1j0ptUaDpbtrtedMpXX9R6ibedRwvm9r9DSg3/+bNdF8DiLnvb8uKCUFy+NLnKn4m1DyLS45Ny5tC5jC7p3P683eP6Jt/1G37c1lbatqWPbdMo42EWkWIEEeNelrKMJbltezTlvy8eXLKpjPH35qm20t5eKuRUNLyl3cuhllazPL/6w+eYE+POrGu4ag+kQKqvuC4s1gL3tyoDIIJXj2lfd9gDedKRMt86qGGIthcWuK87z8SW7ofQZQ8pcaOp91dDt+v727Tt29y+ztGuG3xbjKXEWWEqcxMnLha/Kubya5OGWSlb0yW1Tj4i0x0VLFpS1OlTof+WXZcXZdxhRWsqldxS173uCbg38ThVYs3zPzfwm38FhN/nJB7ZdmQA31emjFwqsNxABLcLeqxJrFZvmfmv7pPwWE3+c593S6I7d9PdNtuPTmoRN4bWQxrpl1gmLROGz3iJJGUAG9v31aZNmGNv39m8vFo9NKaeM1MdhrFu3WD013zgWmYsyRBgWQH13wKnjh4eVdOypQrUSmJyjAKsn5cn5WOBwHDyokGYlXtIXClo1xKJcEDn5VkQeTzGOQP8A7wSKqkix9NjyoDz3PekzDMSCCY24W4ACoBkmuR9TJGUjQHKFAtYDjjhz+NRwEj8UkWrj9xUVJGaxZzlAseAON8Kh1QMrKEMWZiAQfSSMx4kHlaxHhhWK1mTMPOkRCyM4Vb5lNrPj/e5i1qzTMTwyRTaayuqxobx4YA+IPEUSowJhM6e8+UEJdczYWHDhbiLUYRGBzRRerOCACbgADxw4mpIJcUKmdPaCrlChWW9y+P5jz86jcJEmBxPG7zKMXIDDMCDfhccOXxpUA2kcgIS6h1uJLesiw9PO1jSooLiR4fp5ElQxkn2xaxwHO+Nqa9AJkaE+/KERgUNkIub2xAvzINQyTHySF/d9YNrABuF8CDj4eNZEEcoypGWYrmzEHgMb4Y/GhAxFOsZaCRSwKELKtrg2xx8aUAqF3jZbIZC/CVuVyOXKhJkRLHCmSVHBeS7NY2wvfjj5VAN62bu91nsO06DY9s1kaaDa1MenvAkjBCxbKxYHhmwqrxGSYW/cdycXWXCbdvH3rcVGL0Iyy98O4mdi2qhuWJP/AAyZbE4jhXj/AI9g/NfKZ/Ur+/zElO+XXaIzzbjCcxHtSDSoFBJvxy+R50fd3B+a+Vk/U7+/zGl9IPJqeuelJTO0byb7p5Zp0/MS8oYkYWOYnn41vZglHC3El/A+g1sNpux7SNo7nrIvc7rbGwaBrYWAJgj4kXJ+Na2RP9Fb4utntmHzEv23DJ9eLJF2W7VN7pmKGe7MBxyt6QeIAtYeIrUy5p5liPAe2K0YW14Touy9t+zuo2jaNTqNwiOrk0cE+tb+YAN7rRhpAw4rZifTxFVd/NcyjcklHRVpeLuV0f7m3bweFcU29NN8y8fbHsyYxbWaeQWuZf5ioNhjiVIFgK8Xm+Z18l/dPRYLCb/OQ937a9oYtn1+th1sUUsGjnk0epXcAc0ioWUquaz42Fhf99eljNsyldjFxdG1XxdyphcweFUG09x7pUeByAA2Pukem9irDl8a7hlAifO7wqrnKcv+8kXA8r5vG9YIyZhpnDyDJxPHAgnwxFZmITSkxpIoN4mP6bHEMBzoBkziUKnrQm9hYAXPEm1QDIxK80SxiIKiYsV4nEVDJH4NRBMzxNHm9n8pYZeJxJINh+FRRoGWgRRCEkKsoX1FTmUjHgAOPxxrF6zIx8qRyK13WwGViRbzuvI1nUxGNPLDleGN7jLaW4vcWwDAn91GgMxLJ7qpGRIgFwTe3G3G3DDlUsHjSNI+oJYZs+Ma5QL24X8KAFjRkjwQyMSZDiWAsb2PLnQD+r08jA3lsgVACb/K/HEj/XUJhnr6dzdwc4Jyl8oCg4WZR/TGiYoNrpmjWYxzD0Yy+4PVc2txt8qVFCeoaeSMnKSn5yQTccMb4VD0DWR55GExQkJZmLKOGBx8rNUoMgZGKSteyiw9HAeHlhUgYab2Jc5HvK7ergcMLH4UIPS4915UVpFzC0bfw434eVAZGOTIDPLG5vHgFBFr3/phUEm0dM9xOoOjU3DT9PahIot0aOXUK8YkIeNSoZA1/wC9atLGZbYxji7qrs8O+e9jF3LFVB6zZx3x7iMVY6yJlCgArpU43JuQF8f2CtP/AB7Br+F8rPf6nfe7zEqPvh18GDS6+H2kH6qLpUuLC5ucp8Caj/HcHTyXysn6nf3+Y511N1FuPVeu1W77lOuo12p06xe4FyALEMqiw4WHhVphcLbw0FbtqkU+k0712V2W1LWdb7rJIux9nCJWmA2mINKwGdsICTf+njVHkb/n4nc8f95YZh7u12f3H//Xo1qNB213OTVLtvUe99LzmRz9JvWjj1+mUk8F1OiZJAB4mHhVS72PteVbhdXoS2Jfdno/Eb3s8LPVOUO0tpcsdPMLPbje9WXbpvW7R1lAY/Qdk10Us3wbRy+1qAf+pUfWrMNF6M7T9OLp96O1HnJ+nXJe7cZ9lqv3XR8xz/ctk3fa5X0W77fq9o1Km7Q62KSAnCwIEgW9r8asrGIt31tWpKS4Gn0GpdtTtOk4uL4VQiRr7LAKDkisHLceAwHljevU8zN7I6x73sL2uItx0RXJ4DURk28a8sR7qfZfQz0teXHjXSdw+6tVPdyeSAMsT7LoWhw/hEmoBuTcmua7mtPL9Hny6EW/eD5r7K6yucXu2MN7ra5Y8ASMLCuqKQlCSL3QikkMhUG2F8cMvPyoCIdPKc0d7G9yScCAOPy/ZQEeWHIyxKWAQXbNYcrn435UB6g9JbCxW724cxfD5mgFlDnXjYk2AN8B8hegJrM6I0rvcrYBb4i4OAPwoCHhIySzfpqQB6RhcAY8OZNAIN43Q+2zBSGNxYnxxx4cqA3HoRoZutukEL2D9Q7aMnAhTqozck+J8K08xVcLd7EvVZsYT30O0ulFmfuD1m26Hvf251WrmSDRaaHbNVLqplvGkUe6yySSEi91ABY/CuT7sxcsrvxgqtuVOFuCoXucNRxtty0JUrwUkzgfeLedr6h7k79vW1a6HdtBqYNEsOqgZsh9nTRxsBmAxBUj41dd2cNdw2X27d6LjNbVU+Nsrs5vQvYuU7bTi6aVxHOCFaLJcMfSXzchxxPOr4qxMcIKFGcWUgKTja3l5Xw86Al6YaYLLGpLMrEk43Pj53woB1tLE7IwXLl4hMBY87cuHzoDxBZHzMxSNxYsACcTxHx40Alp7KwdA4WVghJygi1weYxJ8KAhxzvgljZ2DMy+fx8aAyCuhPuKM2YkMDhwOOagPNQMygKLgm1hcWNr4jjxoDGRqx1KK0ZtI6KCMBiwFred7VD1Mlay0X3Zrpk696fiQhWj6fiSSCMgoGOqnNr4Y+INcj3Lp8HOnnvoRe94a+3j2etnAtXBE3RcWoIGc6+aNQeQWMDA/HjXXbqKWG6YnouNZN0iVrIblgcRiFYgVnIjcYrp/TxjaeqGJVcurjIFyb+oi3HzrEiOsxXT0aSb1pEdVKNMgIINvzjkameoygZzqSOOLe92hzMoi1Msav8AxcTb9h5UR5ssd9wCwf5e9iNRAiyB9jaMuCM5YaPQ3VwOBFr2rju7dFjMYvT/ADSL/N6+wsdnqiVd0yuMhZDcEW48T4muwKAyjsoW1gb4MwwP9hoCLLMIwBFdjG9io4EkcD/XQDEM4DEsgbMwZbtj5/jjzoCajGRyGOVveYJ8FwuSfGgGvpxqFf3C9y1iCBYD9lza2FASBHChBKgC12IxJ8ycAcTQGNWOB3Mkbfxm68cfL+nCgEJHaUOSGKm3G9gMMD4UB7JkJawzKVupvYC1xgB50B2zf+pen9R2I6D6cTdtLqd42XcXm1e1rnaeKNhrjmOYAW/VUH4iuXwGEvwzjEXpRatyikpbja2f3MusVftSy+1bUk5Rbqt1azsne8Qf5FdopMxWQHaiymwuG2pxfKeRAqs7v0+rYl9r10bma1+Bs/Z9UpY8qMhRAZLPmEovYqMAR5kC1d2cyGRShzlkZgCiBeJ8gKAfhdxIumYKoAChuF7HAm/GgPNQHyLmZnC8x4cwP6qAaysCBxc3tj8PAAcf9VARmUnBSPSoa17Eg250BLXTtdZ42Iwu5bA3UnEH9l6AfjHsxyvIGCsCEUYHj48qAUWuqPFYuq2ZSLY4cD+6gInrZs7MSr+p+BsAT8MKAtT3VaJOw/YPTsrCb6cvMcVGX6Nct+X8XhjXH5I080xu/X8xf5l8lh+LqKwyEkEKF9xgLj/o3wNdgUBEGnzOkyMY3vYgnmp/h5m1rUoDeNl6A6y3SGTW6XpzWx7eykjcNYBotMAeZ1GpMaAHxvVdfzfCWXsyuJy3o+PL7sas27eAv3FVQdN9+KuV0Mo3R+wbcYT1B3B2nTzKp9/QbIkm86hThYF4va04Ph+qca8fqN+77nDza35tW1yOsvwnp8Jbh7y7FcEazfVHnMNu8vTCv07F0eN5mc7zF9brt5bToJiXj9v24NOG9tVOa93Ym/K1bEFiHbm7+xqdFGujQ61ctfIjxn7LairW1r0uVNPgWrlZtfe7a9Z1B3Y02y7dD7+v1mi0sWk09wMxIduJOHA/hVT3fuxs4B3JukU22+Q3Myg54nZWtpGCi7F9wfa9g7Vp8jKG9WpjAB4gEE8QeI8a2n3iwa/ifIzxWWX97nJLdjOvFkQw6KFnB/3vvogFuZLEEeHCo/yLB00yfIT9Mv7xrHU3b7q7pXbF3XqDRpBp5tQNNdZUfK7XKg5Sb3C3uK28JmuHxU9i3KrpXUeF7B3LMdqSotRo0TXZSkl7rc3IHDGx+FWBrC53j9xWsHEYytc5uPh5g0RJGbUZrmOIBbZMWw8rVJAzMAjLIb+4y3vjc3x40A7AbDOt1Vz6iRh8qAfDs0bhi5AGUqv5bnj8agkkQpJ7aQqQqx3PlZuFyfwqGDIRSe0SGJLEAFrHxuoI4VDVSaiAwmwLMhU5xKwv/tWtwFNRAxJHDFHcyZ5CpKKBYEeNx5+NStIPFORfcFysgPugKSCLC9vAnlR6QY2eJX9ILIQtkTKbXItjiRzqSCZFP9M4BzXK5GsPTwwHhjRqpI6jlpHMikK9lyZgSL8/CgGvcd2VSwjdXN/EDh/Df40IJEStEsvuS5WucCOItmvjyPOoJHlyBM7ygZbWQkXwPDDnc/hUVJEZY4UN4kkaQmSM8T6gBiedsbVOsgjzzmYxx+2HyL/CccthfD5VKVBUgGC0gVcVIx52JN6kgccye2Eys3ti92wwB5A1AGJC/upfOwAFy18CBUgsv287mdu9l6T2jY9724ybrpvdOtkOiSXOXmd1Oc/mIBFr/LhXJ5nlOMv4iVy3KkXSmlrcoXGExli3aUZLTxG7w94+1Q9y22mBmYiTLt6WY8CSVGPDjVe8hx/nV+0zZ+o4bzeYlxd3+1jx+62hPthyTGdBGzG18SvmBzNYvIcwr5X4mSsxw29zFZumNUNR3M2GXb4hFBqeoo5YID6QkTTllUgXxCm2HOutx0dnBTUnpUKPjp+8psO634ted1mw9153Xuf1lkxKaZVNiLi0EeW3hcGvDIV+it+HpPTMfmJftuGa69kcdk+1YnyqXd2JB5BHK/8A6uJwrSy1VzPEU4Oo98U/0lo1vQ9ku4EkUWrh2mNY9UqsgbUIrZWUMGIvgLHDzrcnn+Di2nLVwM8Y5bfaqkTz2J65SIAbfAXH5YkmQ2BNgL3A8zjhWC7xYR/xPkJeWX94i67tD3A27S63W63QRfR7bpm1EjLqI3vHGpZyPV/CBwPyr0tZ7hLklGMtLdNT1mM8vvRTbWhHJ0YGxV7PmGFwLcMfxNXBpEmcqYhGTdyeGYEenhcCoRJFbUKcI4gCPWbGw+Hjw4UIGpAHT3JBYBvTxIHPCpB5Ccz51DZ0Fr2v+PjQExHfMAGaxAN0GJAH7MagkVArj3fbuPqPiWNuOHmKMGRizRFS5zm91twv/F+XyPOsXpJFvMHYizMrCwPIDjew48edEqCo00MKZ2knDKpCghcSRgL2xpUihHjxzyJcNGfRYE88L/vrIEfUqkma+aP3G/UZVIvw4WN+PjRARCTp0Dm5IZpEyjE/G3lQgmvO0siuB6Rc5iwGbmcB/XUUJqImkszItkR1BjLWxJ+HhUgcjR1kWR5fTkuGN+I5XbwvUMD8dmZgZgADxJAvbC/l51DZJ4FhuZyFkiK+1cnHkbjwwoQMy6m0TR+2qh2wQYWOHhWSQqY+WGxDBSjlhnjJvw4+VSQLUPGpQBm9y1l4Lc+dQCPIZPZUevibpjltww/0VIOydpOtukekDvw6o0Z1Em4HTDb5Bp11GURiTOLm5W5YcKos7wGIxWx7F0pWummuhYYDE27O1tqtaHaV7w9qI5lA2sxlEBjlTb47hTjYFRhiOFULyLMGvL/Eyx+o4bzeYlRd4O1srOBomUKl2c6FBcHEhRxPDwrF5Dj/ADvxErMcNvcxXDup1Fsm/wDUs+6dOaY6bQHRRQZBEsBeWMMHfKtwL3AvztXV5RhbuHsKF11lVvXXRxlPjbsLtxygqKhv3d2SVen+ziSBfe/lkbFQcC3twA25kWIqryFL2+Jp5/WzbzH3dqvm/uP/0PnFq0A1epJzZS7ZmUHz4igMWVzuojFtTmuXbEqRwthcfI0BvGz9edbbPEdHF1JrNXoFyr/K9eV12ltf/wBhqhIgHwFV17KMJee1K2lLfXiy+9GjNu3j79tUU3TefjLkdUZ5usOnNepHUfbbaNU4/wB5r9kmm2bU48TljMunJ+MVef0+9a9zfkuCdLi5XSX4jP4q3P3lqPHHxH1x5hW2aXtjuO57XPtHVe89M6xdZppIdBv+3rrISyyqQi6zb2JFyLAtAPOsL17G24S27cbio9MJbL1ebP8A+RlC3hpyWzNxdVokqrXvx/cdC+6qVn7qws0ftu+w6K8ZN2De/qcRVZ3NdcB9t9CNvvB8z9ldZXRlUPdgSpX1soPC18RXVlIQWu5yJczu3qzY/DlegHIoCjN7l5GAAAPmQLjha1AS5YA0hkYD0KQ2bgOXDAHwoCEcAwRyyqCXFuHgLi3OgHI85GbAE+k3uCLW4W+NAHtqVWRgGVXsoPwxtxoBxplXFkZQy3UH+9bAfsoBgQNLeQCxUXKLha5ve1AbH0VAR1j0mctr75t9nsOI1Mf9daOafKXv/XL1WbOD9/b7Uek7p9zzkdbdOqhSR9PsEIsRcBjqdQ1jf41zfcf5GXbfqxLfvJ8yuz1srYEy/nxckG9uPE2rsjnwcWkZhZQ3qBAJAvxFAKDwKASMnD12Nj4E0AiJ5FeQqgB4YgHAC9xzoB50kLoVkygkscmJvgKAcKMEYEhmx42wOIBONAQZ0nVVZQshNibgWx44+POgBZJvVZQSRghOJDeZwsPKgJUCvGozepmuTb81zzoBmaTL7kgBKo97cuNuHAgUB66l300+UqPcjLCxy3DDDz4VD1PiJRYT7pYdR/mBspkcs7bJE9ybXP1Wo4njXG9xk1gp1/qPoidB3k+Yj2V0s5RLGW7eaJmbNJ9fqSQPhxrs0tKKGO7xGA6ST29406Pc+vA355WwrORFNA9tUD6fZ+ozKMX1kRjx/wBs4ViRHWY/pqEtvWgYkhWmQ8jlsy41MtKM46K8RP60jc9S76Fa8a6olbH/AGR51G6ebO897oZh2+7Gxu5IbaGaNRyvo9Fe3LG4riu7CfxuOe5t/mkdFnPy2G7PUiuUjZXi04QjxbFSCMTfC+Fdoc6SImvGwsb5jcngL24n9tARmE0TuBYJIPzf3bjz5HhQEctO5QKi+o3J8AcBYHHlQE+KN1cBiDcXAIAIY/2AWoAljkKMVkIF7gLYgkC9AKYyRgqMrA3LHA8SMceFqAjROgUiQZPUQgtcta4uKAUSnCMZBzQA3P4+NAegKEjDAXvmPzwyn5UAnLIqMtgY2scRiCMBa96lAtv3rtN2b7WSKwkX29qUqB/Eu2yKRj8K+fd3f+5xXFL10dTm3/X2fs+qVETSs11CleJItwr6AcsKR1hurC9wMjjiWwGPjh50A6+SXIjRm5IYM+HE/vvQHlmVnFwSCQ172PngaAZ9YcovFAQpAve3HnQDqQpMHVWzswOJwIt4Wta1APyRD240K3WxAbwwvfCgIHsyxhZL5o72swueGHEUBIiyESBA5XhGMTgSL3P4UA5JaNE4WItjwB8/hagLedw9Lsmu7L9jE6h6jHTWg0u2xyK66OfXzapzo4gUhijyKCoxJd1HCuGyy9ehmWL9lb225b6ilpetvqTOlxtu3LCWNueyqb1W9G5/qcHi3PtdtzZNv6b3zrGdBc6rfNZHtumPO40ugzykHznrpXax13yrkLa9GO2/vTovwlPt4aGqMpvheyuSOnnHJe4+96UBem9s2boyN7qH2bQRLOuBxOqn96c28Q9YvJrM3W853X6cnT7qpHmJ+oXI6LajDspV+86vnOd7puO97xL9dvW7azeZMwvLr531DeVjKWA/CrCxh7dhbNuKiuBJdBqXLs7rrNuT4XUjQ5CG9sPlA/TAufC+PlXsYEtopLbAIgL/AM404IYXAu64EWN/OvO97uXE+gyh5S40dV7z7prth7s6PedrlVNx2vTaOfTFgHBcBwAV/iBBItXO5BZjfy925+TJtMs8ym7eJUo60kRX749w/qNNqJdDBDGok/4YaZljlvYY5rn0nhY16R7u4PZcU29Wmulf7mLzO/VPqJA739wDNK50GmjQhP0jp2UKUvcEm5FycR8qj/HMHSlXyj6pfrucho/W3cnqnrLbhte9RQQ6HS6n6gRxRlHMiB0AYk42DHlW9gMosYSbnbrVqms18Rjbl5bMtRxz38pdQbhjbMePy/CrU1CSrsUBcZS38YGNuRNAT4p49OmV1Eg4vex+FqgCpJkY3jVQlvyk5gL+VSByFlVYVeMtET68uHlhj51BJJDqyzo0Rta6sABgB5cKAjDUKU9uNzHnFuWJBscP9NCB6N2DrG0ntxxn9RiMRy4G3zoSTZ8uQiQ5miYLFhluDywwvjUIMiS5Vz5szsxKy8bX+fC3jUgXpszMyFjEY0BvxufAeQvRgJ2jcEJGFLH8y82HEjwokGR/akJ9WYO5BjUiw+RGHDzpUEnSNNHM+f1WuRYA2DDDiQMLWxqJaghqSDI3vNMHaWxYAk2ueOHhjRMMbkdBEAzEsC1iv8R8PEfCpIGRKrug9tSQACORBGOJ86AmRIrZHztGqC7gc1/eSPxoySTLLp2aONkVWW5ONgBYWufGo0gaDnGMwoVP52Ni3Hy/CjQF4GN86MklsySg3Sw5EW+dANaoRZdLIISpdgM6m98Be5ogzu3R3YyDqfpraupG6gOiO5wGZNOsOcRhZHRg7ZhwC3wrmsf3ieGvytKFdl0169Ba4fLPa21PapU28fbtoBGW/wARyyGSxEphAWxFgMGxvhiCPhWn/lcq+75z3+jqnlDJ+3DT+7Ew6ocoARIjacKA54Nf3OA8DT/LH/T5/wDQfRvS5ivvRsUq9xumYUYSrpt+ghMpXBgk1icuPhfyrpcwlXCXHvwfQVWGX86K9JdJundtC/cfrPIy+nT3ykgEn2I73+FauQfJW/D0s9sy+Yl+24ZvrWMnsj2rSVlDuZbi2Xir38Mbca08uf8Ac8RTg6j2xXylrwkGHvT3EXatPo44Yva0kUMK7kmmbOVjIVSzG6kkCxNsa9nkGD9o5PdbdK75h9Sv7KW9u0Mm/fPr+Z4Gj27TRKrMSBpmOcFSo4m2BucOfwryXdzBqtW+UyeaX3vchi977zdc7joNbtE8Glg0246V9NqZBEwf25VaNmVrgXIw8K9bHd/C25qaq2nVad4wuZlenFxdKMr9NIIpjl/hBup4D+lqvivFRSOwLWuoxB5gnw8aAmwOsV3vnJvlB/Cx+FAPvqIZVHtIEJOIvxt5VCB5G5tKyqMzWvlFlF8PGgJySRiSPJC3tsPymxIYj9tQSRxPHDI6reMq2Lk8AfjepIBWlQAB8zy4gsLDH9hoDJjIYlUye5DIhJbLY3GBxFzhWJkRMMquS1wuaJVucAePnc1kQNRH1ooGRJXwIOCi2Jt48qEEyVo1BDKJHX80tuXgR/S1QkSyB7b4ZswiUlSbAg/Ej+sVJAtF1EckV8VIAC8bkerxvjQkk6qL6iQztLlEZAWMkBrWvwW9r4+dYrQSyMHUI4ZvSVHD+HHzPjzrIxIplWxTKDdjlY4nDgTfzoCWiCQFR+iSRYrwBPnwF6AmPLAkRjYZs2AYj1Fri/wAqNJI1nEbAxRJIDwDEMPO39dNYFx5cwDxMU4XjNiCbY2sbi9AIdYzpZ7x+4YybyLiwGHLypug6V207Xw9xIN11Mm6nbF2qWCOREj9x292NmDC5FgCtsfOqbN83+AcVs7W0nzG9gsF8RXTSh1eH7ddHa79SyTPHdSqQAANhxOY8PAj5iqd965f0+c3lk684al+3HSyR5ouqHQsQUA04IKcSL+4MT4jCp/ytp6bfP8A6EfRlTyuYr93H6Y/wf1Hq+nYNZ9eum00UwmC5be7HmtxOIrpMsxjxdlXWqVbXIyrxVj2NxwrWh1vush/w52ejZkSQ7VEHwCgDJBewwtj5VT5E/5+J7fWzdzD3drs/uP/0aQa3pDY9bqNQ/TPcPZ9a7SsRtu7pNs+oxJ9N51aBjywlqpeZXrXvrE0t+FLi5qS/CbywkJ+7uxfBLxHz+LzmF3PoPrTZoTqN26b1y6V7sN00sY1WksOBGo0xkjP/pV7WM2wl57Mbi2t5+LL7sqMwuYG/bVXB031pXKqo1MIiGRla4U3c38Mb35VYGoMGQyFWUkxlcxJPI48/OgMjshvvWwRlcG3PRqCxtdjPHwBryvuluXZfQzO35a410lkPu2ObvCSQGK7DoAoHFLy6prEnGzE3rne6HyP230Its9+Z+yusrNI5VmyMcbFsMALG966cphtHzMyS3EpY4KOFreFAOe0EZ3BJtizHC/O9/iKAYeQy29u7Iy3uTa45jlzFANAsuBDBgCAgJW2HO/7aAfMnoDrlaMNiAfPgeXHlQDskatGuOQqylbjx/1DhQAHEIVZGC3NnPnbxoDwpHfMjNfNlycgaA23oYJ/jPou9jffNtObwvqo8bGtLM/lL3Yl6rNnB+/h2l0o7h91KCLr/ZQCxi/w/Fla2IB1epsBywrnu5apgpdt+rEte8TriF2V0srC9yyKTmcp6FJxIwthzrrihGQrZlVjly8bG/MYEHnQDkQLsVVgLH9MsL+o34XoBE0uaSFlBuoIwAscwtYigJDM2QvEMgSwMePLCw+FALRhKhZVBa9sgJJDcKAamyWs7gJh7lzYW4YGgGQ6rKFUBr4IoNxgOION7eNAPq+U5sVK5r4f18aAQHIUi6uCBlAsMGuCf67UA5EjIkAjYyZHVsx5Wa+IFQ9QLJ/dtB7HcHp4gkmTp2LI5IFj9VPf448+Ncj3MVMLcX/kfQi+7wut6D9HrZxggx9vNOJLEnXajLxC4A4AjHGuwWso47pgek2jj3qENEHLXUWJNiVYg+o4cOVSydwmaArHs/UWdBJn1KKtjexLGxx4fKoMY6zF9LlF3vbmKrYyJYBmN/WuABJFS9RmiR1irr1Hv3uHMjTsMt8pPpFr1CPJlke/OneHt/2EUHNfYmaQHAi2k0Iwt5Hnxrju7S/VYt78+uR0GcP+TYXo9USrxASZ2zZzJYMDYBbf6rV2BQHiyGzBnxdQTlGNj40AmSSyOxX0XsWPLzwoBC+2cjZgJbmwJs1uJwvQE1RfLYZl8TyPEeGFANGRnlEcRACn1SAm39PCgGNSQUyBSt7K7qLnje3woB8sZluCqqtsCAfUTgKAi2zoSWIe/q5cvHlQHtmys7ABLWvm4eIvwvQEkk5cSWLJ+mOKkY/h/bRAuJ3qjRexnadmJd2Xarqw4AbW5Fv28fGuDyBUzfE/a9dHT5o/0Fn7Pqsp26qWtmIVrG4JuL+dd4cweB4oRYP6i2UE8zhw+FAJMWeRMzARlhYAc+YoD2UkMgVPW5uG4eNx4m96AYkkBLC+Yj85RrWva1/KgGwJLlwDa1s3C4vYj4440BLRxLaME57Astz/ABeHyoAyxwxhizW45f66AbSSS5sf085ykAXtfH8DQD3pMaCxkviVIAvc8CP7aAtL3ob/AOQL7dnJV7aMIHvYH/go1Ax8AvCuTyX/ALLFrh/My8zHThLHF1FUCWJcgFX53OOGDWNdYUY8j+5aO/6gUMQSSLHCgJ237XrdxlGn2rQavdNSScuk0cLzueV8sasRXlev27Mdq5JRXC0ukzt2p3HSCbfAqm4/5cdT6MqeotRtfRmmkbNGd81kWnny8/8AhozLPzvYx1W/WrE9FlTuv0Itr7zpHnNz6ddiq3HGHaaT+7plzGK33b9h2pulxsvUw6olG8RvuU0Gjn0cEYDxZFiebLJJmubkoLYWvfDYhdvXbc/aW/ZqjpWSk3oetLQuVnjOFuEo7EtrTp0NLwV0vkOhdzt50vT3fbZt63PTNPoNt02kllhSxLJllXMAcDYm9vKqPJ7Er+VytwdHJtdBv464reMUpKqVDc27/wDQ6K+XZdaFuuW0UNmHj+YcBc1of4zit2a5WbH1a15r5hQ799EkG+yaxibBgsUJuDjcksP21P8AjOK89crH1W15rOd92O4/TvVnSse17Vtkmk1P1cWreeRI19Cq6kXTG7ZudWmT5Rewl5znKqo1u8Bp43G270FGKo61K2Jp/TfKFVRfP5/KulKscMYeOxe2Fh40ApgURWGfKuCuRxtzxFAOxQh1Y+lWbBUPFh43oCRFG1i5ORVF78cAOX7qgD8akrAYS0ivhciwXDmaEkGdZJZCcpsoDEgWuRx/0VJA+2SMO0ikhmDRs/A/HywwqASTrZJz7aqVRblJLnG1+N7VCVCanjSZrpjbMDGjEZzc4g342NSQMJg8kqQ+pjgXNgBwN7cRfnQEyJRlHvISGayEHn/dsBUMkjDVCUsDFkWO9ypIsASL35WBtapoKiRIVLRq4OY3kbAkXFgATegGVZ0kUBC4H5A5Aw5kfDzqSBpY4TOwGYFfVlOAvf5/soDImPJ6kCrcDAeq2OJ4Y8KhEjsenJKNJJkVRYRqcSScOPCoqEhJYo5hZcysSQpsBy8QBhUgXNC3rMIR1N7SA2Pp8B44VCYFe2YSjPIQXsPQPTiL4i3nQHmofBlETLEjejKACbg2OGHGkUGdF6a6R7qbjsemm2Ftamxa9JZNJEuq9uKQMSrZUzWGYixwHicMaqcVjsBbutXaba16NKNyzh8RKHiV2XwmeXorvUNPHph/MI9PCUEMK6xbJ7dmU2V8ACBavB5jllW/Fq+Df8B6fDYulNPKe6jo7vbdI4xuzXJBEWqUWOB4hxx8b+PnULH5Xr8Xk/0Dw2L4eU5x0TE+l7hdJJIpVot60yTISQc3u5SDa97Hj41ZZj42EuU8x9BrYXRejxo2ruyJG7odbggqx0keRb8R7EWU/PjWrkFPgbfh6We2ZfMS/bcM718zydke1OVSEMjq73J9QSQAXOONia08toszxHg6j2xenCWvCdJ0XfjofS6TQQfyXWK2n00UczRxxEKyRqpAJIvwtfnVZc7t4qUpPbWlvf3zbhmtlJLZeoej7+9FMFY7LrAbYARREgjl+b+n7KxfdnE7k1yslZra80h7x3m6P3PYt30un2OdZ9do59LAZI4RZ5Y2UElSSACb4V7Yfu9ibd2MnNUTT1vcZ53cztSg0o6WqFNUgzM1lz3NmfD4GuzZRjyoPUmf0jmb0AJGVRgpdxfMTbAX4C9qAXCola7EKAP944tjfBbUBISF82UCwBvgb3J+IqASABaco7SPGbFAuDWtjQkZ1QlYrGVJPMgcAbc+NEQeRpkVC6uVRWV/AHyoB9NdkjEMKAqVs7IT6Rc2t+/jUbJNRwyFWysxAN1kZjgMTbKTf4VII5Ad4yYSSiX5DE4rYjzxoQSYszFnkQZLEuqHhbnjjhRkiJdQqSfTpDdCAQ2N2zeWHHxqKAaaXI2dGzOwIRGOax/i4+FvCpAxKXBLAs4c3cm2Unl+NCBE4jeSMyAxvJYFRa1uHEYfjUgnJCoRSFUZGtxuW42+HCoJFrDJKLGQRgkEvw4cRY4cuNGwOSn2WVkzGNgBc8wT8BxqALMQZFaJYywF3jJtlueZHLClQIWB1jZ5GtkLYLxw8/DGlQOySHJZFLe4h92UjG45G2N/GiWkG0dG7F11vDblqOizrIo4DHDuEkM/sAZ7siuAwzcCeGFaGPxOFtbKxFNOqqrx0NjD2rs6u3XhobzD0T3r0rahYPr4xM7SzOmsW8pOGb89ySPEXrQlmOWSpXZ0aNWrmNhYXFrVXlPT0b3qg0yrH/MzkQKiR6pScqkALcsThyHhen1DLJPTs8g+GxaW7ynJOrdq6g2vctRpupRqE3oxo2obVOZJcpT0MXDG4yjDGrjCXbVy2pWabPBq4TSvQnGTU614Ts3d1mk2Hss+UpE23IQ1yTcx6e4ubE2GNUOQql/E9vrZY5j7u12f3H//0vmrqGL66TOMrZ5AyC35bk48icaAy+0bzu2xaj39k3fW7NIxN30U8kGYjHEoRf5ivG/hrV9UuwUlwpPpPS1enadYScXwOhtx7k71q0VOo9r2XrCIEK7bnoUGpI8tVpvp5r8rljVcsls29NiU7XYk9n7stqPMbf1G5L3ijPtJV+8qPnPDre1m7EfzDYd/6O1RHr1W06yLdNKp4H/htYsUoHkJjWXs8fa8mcLq9JbEvvRqvwkbeFnrjKD4HtLklp5zK7L0Ts0++bJqum+4uxbysW4aSUbZuIm2bWsiTxuyiPVr7LthgEmN+VeV/MLkbUleszjWL0xpcjq34+MvumdrCwlNO3ci9K0PxXr4dHObr92moz933CyHOvT+3lyoIJObUG2IN+PCtLug64BdqXUbGffM+BdZWoOWlizDIy3GUW/LjifH8K6cpiWuUOP4VYkfE/E0AoyPlF2uFbFRe5vx8KAZsWku6m9vSot6fL50AiXLIGGexuS4vfAjEi3DAUABlsVCrdsM1je39tANlgoKm5DXDOcbDlY2FABcuseZiXAIBONhxoB/TyoqjK9ib+rkb+AAw4UBtPQczL1h0eyFiy79txANrlhqozxN60sz+Uu9iXqs2cH7+Haj0o719xsM3UPdHpLZtOyjW7ttmm0OmMjhYlkn1s6pnIDG1zibGuV7n4mNrLbt2eqMpN8SimXWf2XPGQhHXJJLwtorp1VsG49Jb9uXTe8SwPuO2tH776ZmeH1xrIuViqn8rDlxrq8BjreNsRvW67Mq0roeh0KTFYaeGuO3OlVvcphQQ7FrXAN/bHAm3E3H7b1uGueRuAwAW2PrAPMWPyoCQ3sviPTYZggFspwF+eGNAMrKWmjGYth6VF+N/A0BMCxqpbEjArYA3xv5cDQEOR0kCFgSC5ABxxAsLmgEKUjLLly8wVuMfI8vOgJLm4IyEMPys+BJsTxw5caAJDcu5xsLkgcP7KA9LuVUQtkQMgZTx4gC2AqHqCLN/dqVbr7p1XXH/DkZCggj1aqfEfhXJdzflbj37j6EX3eD30V6PWzhmslVegdIkd8o3DUZhbxUG9danpRSQWhmvdGsX3aAr62BN/8Ao5GHOvRkbjHNkLts/U/pzAauPNfkA5rGohrMb03KRvmiykkidMotwGYcqmb0GUNPIZ3q8wv1FvjEEltRJcj4AXx+FQtZ5ssZ39eVuhOwTRsFLbC7Bibk30mhNzb9lcf3a0YrFr0/zSL7ONNmw/R6olW2ZXYAAlrHNhe9jywFdeUIq+EYbKVHLzJGHmKAQ7rZSyMvghHpJGHAcaAjARhQ5WzMwINsc1+d6AnRujs0ZzDISAwFwMOQv5/OgG58scbEXU4HC2B4DH5UAhWWQASMTlUEWvYWF7m/woBcroE/TF2GOcC173A/DzoCOMrZsqWANw68QQfnQCTIoy4/kJJIBOY+PnQG4aro/eNF0TtnXupl0z7JvGrfQ6CKOVvqhIDKCXUoFAvE38fh41XWs0s3MZLCKu3BVejRTRu+FG3PBXIYeN902ZOi393c8DLK95Na03ZLtYgYmJDtdn9J9X8skUC1ch3dnXOMUt7a9dF9msaYCy+z6pUJJhea7lQSFIbhfnwr6AcsRXZGdyCbcWU8cfEigFNKfcJuXsAI1PhgOHyoBSkKS35hwyNfAeWAtQCSquykEIFvcDhlwvQDxKuhwLLi2DA3v58vnQC0ZwEUk3JA9zy5j5UA4zkqzMwvewPEXOGIIoCNNYRMPUpJGe2B5XPxoBoyubG5jUDBlsAwFvI0Bc/r7Zm6j7Cdhok3raNj0uj0CS6rXbtql0cSKdLkIjBDSSMf7sasbcq4jL8UrOZ4p7MpNuiUVtPXu7i42zo8VYdzB2dMY03W6bnP4CvjbJ2y2gW3frTc+rNSBdtD05t/0sBtyOs3IqeXEQV0ft8dc8i1GC35yq/uwr6xUq1hoeVNy4IqnPL9x5/jDprbSi9Ndu9vhZSBHuG/6ibeJ78yY/0NOCPD2yKh4C/d99flTeglbXLpl+In4q3D3dqPHKs3yaI8xD3HuJ1puMEmmm6j1Gh0Nsv8v2zLoNMBwsYdMsSkfG9Z2cnwll7Stpy35ePLllVmNzH35qjm0t5eKuRUNFmChJGNxI5vK/8AEb2uSTjf51ZGmSYJAG2OR1Psw7vpiHQC5AKYgG/hzryvKtuS4H0GUPKXGjrfdjbNN1B3t2zZdbqW02k1y6DR6meNluiuGZmBa4BsbY1zmS3ZWMslciqtbTSLTHxVzFqLdE6I309gOhVLAb5rFzAIqtJCfUPUeIubgXw4W8Krl3lxXmLnNr6VZ858xI/yD6DS2TdNbHb8x+ojsb+OFY/5Li/NXIyfpVnznynPO6Parpno/pl992rc9XLqH1cEH0k8qOjpKGuVsA1wBfja1WmT5zfxd/2c4pKjdVXcNTHYG3Zt7UXpqVzDApIkQDLlwubC/wDprpypGp1BMQsORsL2vwsfnQEu000ai5AAIyjnYYWqAJSD2vWSFLWAUAnFcLk0BMYjI6tdJLH042tf50JEwSSzFAoUBmIyqCMQBiONALjfBYJQsTspyuDgSLW/oKAhuTbKzAgnKMcxBH5rDjahBNeJEicMFjcRFhf82HL8KipJBjkMcjKwLktipBGUYkC/EG9SQZOGBZFzGXKhUYN+UgchxHGobJHNNKqr7TgApcxspIy2448sahkojbi5kKIqMREMqiMXBUG93F8f7aRRDYzHpxLGUjvBw9LYAMQLsAPI1IPRCI8uZnDFiLLYmw5gcb+NSQeRrGbSWDWXKC1r3uTexoSTpmkb2HUA3jsWxLDhbDiL1CBjEmdJmZct2sCMbgcMD51NAPSxyH2FJLBgSxBuBzGA4UBP0cjQD20YSWALOy2AA42+FYyVSUeamdEkiKBJAyHLgcATY4HmLeNEgRnMyqHJDkObcQOB4+flWRB1jp7vh1F07se17DpNJoZINrjMUUsyMXZMxaxAYcL1R4ru9YxF2V2TlWW8b9nM7lqCgqURmR9w/Veds+3bcpLG0eR7ZeNvz3wHP/XXh/i+G35c37j0+r3d5EiL7hOpwC0uk2xXuPZyo1ib4Yl6h91sNvy5f9CVm93eRyvo7UmbuN0xq5rsZd9gkdktcvLLfmLYlqtswjTCXEtyD5kaWGdb0X6RtPdUNN3L65kF2EcAjyg3AyQxAkeGOHxvWvkSpgrfE+lnrmLriJ8ZmuvplPZbtQkZIH6zhTYE+0rKRYcrnCtPLY/3LE+DnPfFv9La8Jvmz9iuidVtG0bhPvusE2q0kGq1Le7CFu8au4FxYBSfj41XX+8WKhclFQVE2loe+bNvLLMopuWtV3DLR9gehFQX3XWtJ/7VZ40PwtY2tXg+8uLr5C5Geiyqz5zIm79i+jNNtW4a/T71rYpdBpJ545DNGYy0cZcBxY4YAYG9eljvHip3IxcFpaWp75jcyuzGDak9CKfRugZcg9Tm8i/2/trt2UCEuP0WzAAliDlJJIPA3/fQDkBk9n2kORbAgjDj4k+NQD0aYhi7+jISxNrmxwsBSoJkTABc9wjWyMLi5vajJGVlkBkRMl1xzEYtcjiR8fChBJLtA7+6gyEqA/AgGw/dUaySPMcjyD3FaO2a+bDLy48/hUkD2niT21d1UKz4s+HG97A+HCjZKITsYpSblguYKLE5iCRfEYihBkIEE7KVYxANY4kgG1gTx/CoegkdQpp5WT0vE9r2xvwth+NNY1Dmsl/QaNMxDnNmU3kDLhYG9+HKsUt0lsxmniBsDG0bsCHa2UFRa4PiSazZAv6Ux5jI5NlzZsLXPKxubD9lCDzKjuVOYlSpb3LLaw4Y0JJwZjpmWNFISQFIzgLcbAc7f0xrHdBjpndZVOBZcQGDeq4w+BrIgecyyQySkksxFlU2OHEkfOhI9pQdM4IbMzGwjKmww5k+NQ9IRM1cw9kscjOroJI7EYjh5WwtWMUSyGzySrIwsEKE5FBFuOHhasloIN46K7obz0Hp900u36fSzLuckUr++CcjRqUBU3xuDaq3MMotY5xc21s11cJtYbGzw6ajTSbufuH6supbb9uVAuLBHALA4n8/DlVeu6+G35ft4DZ+r3d5D0f3CdUFwZdFtkcQ/OQjlhbjf11H+LYamuXL/oT9Xu8ByLrjqjW9Y7vLvWuSITz6eOIpCLIqRLlWwxt4mrvA4OGEtq3DUm3p4TQxF+V6blLWdc7sMNRsvZpIy2UbVFKFNrkMsCjMB42P7apcijS9iX6f7zezF1t2uz+4/9Oimp7X73PNqpuntz2XrOFnYlNn3GJ9QMcA2l1Bhnv5BKqHnVm37+M7Xbi9n70dqPOb6y65P3bjPstV5HR8xqG7bTu+xakabe9u1ez6hbg6bWwSQEjyLgXte2FWNjEWr6rakprgafQaly1O06Ti4vhVCGCPZcpYupvc2wsLCxx/CvY8yJlxRVYMqYm1/wA3E3NATdpzHdtnZjYpr9KxFgFP66fut5153/dy7L6GZ2/LjxrpO/8A3UrIe6ULyKqTSbFo2cLe9lm1K5sPheuW7lN/TtPnvoiXPeJfqvsrrK3rGAwDElpBilzYcgC1daUZLY2KfqDA2K+XMX8RQDikGJ8oDOtjY2wA4WONv66AhlS2VVObJ65Clyb2uSfhQCnCu7kE5GGZWwJF8OJFADYSWDEX/MSuJC87jwoBD45bP+UDPgSOdhb9t6A9EOcBlYKoOY3ON/h5XoCWFy+2psxyjBfK58vw50BsHRWndutOk2eRY2O+bcqoMcW1KXIA4VpZmm8Jdp5kvVZs4P39vtR6UWG7zadoe+HbaWWdGyrt7Szs1lQLuUoYuTYYeJriO7cf7JiUtL8f1EdHm7/uNlvR5PrM4/3vyf5ndRyRSpNDMmiaN4WWVLLpIhgyEi4INxyrou6kXHLLSaaa2tap/Eypz1p4ybTrq6EctzMgyk3dgM2XDib10RUkTOVcjPiouGOHC9ASPqZQpUMrq1sysBje34+NAPxThlSNyqkMbuwswzngOfDzoB2aZTI0aLeGPKM63y5SPnxoBU4jBPuR+2YiwTgVcG5tj8udAHsqwsvpCgFCL4k8PjcUBHl1LK8jJmtI91IxPG1x4UA8is0V2IjysLKrXBww/EGgHIVP1Omym496POpsUYFxe9+dudrioep8RK1lm/u+jkj7mbKGQxl9giCJxup1epxFuROFcp3OTWEn230Iu8/f8+PZXSyu+rllj6PghbGF9dOUvgQRECQQcTeur3SmhqZjekJGj3OAL6S75Rc/3la4wFZsbh5sEzrtXUt7ANrYkYXJvdmw4eIrFER1mM2SUw7vpZAt2EqEC9r+tR/XUz1GUTN9Se7/ADjd3lN3bUyiRgDlvc/KwqEebLPd/IpU7Xfb9dTEW2Z8suGcp9FobFfC+GNcj3dX6zGdv80i9zX5ex2epFV1TMUs5TENbmfI/GuuKIjyTSRSYjBiRcHMDa+J+dAPRgSoFbNmjZmIN8SwBGPnbhQHjpCSFk9OcXZgACcQDa/jjyoByRjZHEBR2cgRjiVAFxb40Alpo3gilYp7j3V42uLjG1+IoCI+qk91pI8oLtgxFgtxiF/DwoBmSZmuTIP7x5c/jQHsDkDNckNhbEAYcxQC2zCxBuCLrYfIk/uoDvnU6x/8vPQumE8Mk67rK8kCyIZhGX1pBMakspAI4+IrjsDCX+QYiVHTYWmmj+DdOhxLX0q0qqu1q3f4jfu72jdeyvbFX1KiNjtahRchC21uSPjVd3bX94xTro8b10bWbv8AQWK+j6pVGNHjjPuAECxzixvyNzz+FfQjlBEsLOUOdBZQRj/d5k4UAwy2YKpyve54nG/C/KgFlgFzLJYAKcRewtjfxtwvQHuQFV/NheyWAx44igPCC0aKpLSJ63tcgA8Dhw/tNASIMZQRkZT6mHGxGH5Txw86AS7LjlfKLgBjicoPhjegETAEZic1vSCpxF7YWHl+ygI/t5bWJZMGBNwLXJOGJwoC0XeBJB2W7CwkLHENAGhdLY30UTEjEeNq47Im3muN4/zMv8z0YLD8XUisJDOGwtwZMMbnxta9diUBIg/3oIyOCMzr4FT4G98POgPJGS5VJApZrIeJIvfBcb/ClAbhoe3nWm7wxaqDp3VQ6Fwfb3PXZdBprf8A27VNEhw8DVbezjB2ZbLuJy82Pjy5I1ZuW8BfuLaUGlvvxVyuhE3jptem/wCQRP1Fs+9z6ndFOp020ak6wabJksssoUR+osbZGbgb8r+lrFu/CbUJxSWhyWzXQ9SrXRwpazC5Y9lKK2oyddx1p4dXIbt3q2XX773Z021bd+ruG66PSRaGENl9Sq+FzgMFJvVRkF+FnL3OeiMW68xuZlblPE7K1tIx0XY3uT7Q07NAEIVrnW4A8Qpx4g4nlXq+8OB16eQw+mYj9mSm7H9ww6iLUQtlbMHbVkKCtrGzXP4Co/yLBbteQfTL/wCzNR6y7f8AWfS+0rvHUftvBLqRpvTOJiHYFl+N1Wt3BZph8TPYta6V1U0Hhfwd21Hanv0Oc6eQqlzGubNmjtbjw4WNWbNUY1IzOsgWwuBcHhexP7b0IHIVDe3dmyg3Rr2sb8zyGNANTXBIVze49OJsed/lUgeiYgNcNlFjmIuR8CPG9QB6OV0RlSOzFvzcxmvzxI8xQkSYWKy3HLMJDjYA3GJ8aEEJ7qQ8BLZhYKeIxxw5/hUgkwK0xZpFJeKwALWOHE43qNQHzGkb5swLPcvGDmXE8zje1CSfDF7wCpaXIM0oDADAWwvzuaxboShzV+8RF7CZ3TGQNxCg3N7XwotAZAab2yjMgz5bIeVjwxwvfzFZUIJ2ljM49sPa0YL5uXPy8PGsW6ErSPyPH7TKyscinIxBAPIW5jjeoVQQLsjBWUOzpizBTlBN7EnzrIglzyOQ6oqqJVDSCwBDAekA+eBrFIlmEaCJHNiyOpDGzG5N8fnWZiTl06+t5CcFGa/Aix9Vr41DZI0sTLI8YznADMPV6v6cLVNRQdljaMAFXb03ewygBTa5te17fjUIEOZpnsMVT8wHxxxte9ZIgsj2733s7p+ktp0XUen0B38e625NPpnaRm95mQlgMbLltY1yeZ4fMZYiUrLexopR8BcYS7hVbSmltbpvcPVXYhfcCRbXEWYiRG0jH1XxFyCBYjkbVXSwebPdlym0r+C3lyD69R9ipYhJJp9pbT5jg+iaxte9kCE2t5f11HwebV0OVe0T7fBby5CsHTcmkfuTsraJcmgbqCNtEhHCE6m8V74iy2wrr8YpLBz2tew68dNJSWKO/Gmra6zau7KtF3H61JlJabThglr2Hsx4WPhatbIXXBW+J9LPbMfmJGW66UHsp2vlz5IoZtRmXxze5+6x41qZd/2eIXAuo9sV8ra8Ji9u7KdyGgh1UCxxRapVdEbV5SFZAysVBwFjhzr2uZ/goyabrTgPOOXX2qpa+EyH+RncGOJUSaItlI9tdWbAE2AJJscONef+RYJ668hl9Lvr/cibn2i7i6DQa3Va54JNBtelbUMF1QcGONSz2BtawHCvSznuDnNRjWsnTVuswnl1+KbepLfOKad7uxZFKEFXOANjz51eM0BzUkyoLoLri1rDAcP66IkYhGZSLsRZQ6/K1rfPjUkD0wCAWc/lwxJJW1QgNwF7qLM5NwRbDw4crXqQSUkyyMVjz3BALDja54E8qgCsskkiyOpfPxU4m/8AoBoCFIircB7vE3qXCxHAWqQewGWVkimDAG7HMbfhegJjQqArsfbZAFUBgzcceF7f0NRUkkwASDIhHuyYJGCBxsMcLVDCJ0qGPTvGiWkB/TQm4v8A7JB/CsUSY1nkVD9RFYoRmUY2ZRzOBHjWRA/p5DKwINmkf0ryIA/so9ARkciwF4GzOL+plGAJOJ51hWukyMa5ykyKl0Mn6UNg3A4EA8qzMSWsrLFG8aoJVLBCQLENixvythjWNNJJh9RBGXzyAguSA2Y2yi9rWth+ys0Yj0MGdY7sxAvZr87YrfztgKhskHiySKyXIZjgp4AYG3nelQPe08aBgHJzehQtib8B52thalQRHeUIVQMq/kY3xwxOP9tSQda7Rbr292o79/juLSyaiU6YbU+qhaUADP7gUgG1yVveqPO7OMubHw7e7WjpvULDATsR2vareodti6m7DQSoqwbXEyIMjHSuRlJ44gjDhfj8jjQPCZtJa5cpZK/gluLkJKdS9jZjIqxbUQq3kY6MhQDficuJ8sf31j8Hmq3ZcpPt8HvLkK1909Z0rquqJJejooYNn+kgVhp4jFH765vdKxsBbljbjXWZRbxEMOliKudXrdXTcKbGytyuVt+TRHQ+6KkdO9nJxJkSPa41RBhclYTfj5AVW5I/1GJXp/vNrHr+Xa7P7j//1Pmxq4wmtldgAwlfIDY8L8DjalQbltvXvWW0adtLp+pNZqdCBhtWsK63S5R/CYNUJYxfyFV1/KcJfe1K3Ha314svvRozbtY6/bVIzdN56VyOqHz1f09uUbf4l7ebVqXewk12ySS7NqD4nLEZdOx8vaArxWW3rXucRNcE6XI89JfiPT4u3P3lqL4Y1g+bRzC02jthu7Idt6s3npLUuMq6TfdvXXaYECw/4vQN7gHxgrL22OteXbjcW/CWy/uz0fiI9nhp+TOUO0qrlj+4mbf2t6ln3DbNTsGr2PrPRx63TvLNsG4w6mVIxKmd30kvs6kWFyR7eFYXc3sxhJXVK26Py4tLV5yrHnMoYC45JwcZqq8lro0PmN8+6aVZu6oAUZNPsekSOVSCGHvalgbWOBB4VVdyv+v+3LoibveL5r7K6yuzJlkUmyE2yg4qQB442rrSiHvbT1u3qLY5QLW4HHljQDBsY3ZkxtbKTa/Ll+6gGQjNiB6MhTKPhbEnhQHoR1weNVONmPG3PCxv8aAeiGFic2YALbGwtjxoBLpYPwsDcEWBIPPzoBWnBYyoGUELmJPj4C3nagJUXue4b3X+6B4/CgNl6Nmii6z6VX22N972++VScBqI/wASK0c0+UvdiXqs2cH7+32o9J2P7pXiXrnpto0DD/D0SyAixN9TqDdiBz53rm+49PgZU8/8sS37yfMqvm9bK22PrVUUWsWsAB8sByrsqnPjwjDHPawvaxAGHLlhh50A06RDOVKBwD6cDh+296AZbTI7XWO5SzFgbAsQDQCpoAr5s2OBUnAWA4YcwTxoA9glszHMGN1twuQTbzvQCZ7yRxCQBlB9I44DjywtQD4WWQI6gJkWxIxFuK/2UBDWB1H6hshBGe2HjiKAkLljVSJM2Q+lALYm+JItQE3TOjPG1goSRGKnDgwNQ9QRZv7wdUJ+5HT4Yh/b6fiyEA+tfq5ybX8jXKdz5Vw1zguPoReZ+qXo9nrZXPWySP0hGkYYRHWzfUE2xPtDKMeNq6vdKaGpmJ6PDLukLKLXcKwW2K2OBvWbG4e7C0v8p6mGVlza6PN+XEEtcfOoREdZi9hEse8aRtPZZVkTIRb++vjcUlqMome6kkjbdd0OUoq6iUtmHAAm6/jzqEebLTd/dT9T237AByoaPY5CFxwA0egW+PjXJd3JVxWL7f5pF7m6pZsdnqRUx5EdsmKAn8/wOBt5V1pREd0DMzK+d2FrKLE3wwoBUUE/6gDWZgLLbwuPxtQHk9mkjuir7dgjcbDhcixoB2RWmJ9wXK2CgHG5OAJoBloiAiO4tfPfEH+lqAW+kzJGti1rkC4BGOAthc2oD1Y48LBI0ZWLg/HxN+NqAfWKMraPKbkWYW/dj+6gE5SCoUfkJ/MARb4njjQEeRgsVhEoMoyk2xA4EGwF6mpBcXvNNBF2Z7V5EYn2dpvlX04bbICbrzr593ep9ZxXFL10dVm1fp9n7PqlS0sYmaO6rjytzuMDwr6AcsNKsmUsxVcikm+IPiPDxoCFGM7KbjHE2th40BIRQqlmHG4KqBw5eHE0AwQQTfK9hiCbAi/jjagE+1IM5ye2WBClRfDzHMcONALjA9wKyi4UqWuR5/0FAPRhWLK6GyjA+P8AXQHkiKiZM4y5vz2FyL2w/CgEvHZFVl/hNhfE44X4240Bbjr/AKZ6g6y7Ndjl2DbBrJNv0C/zBmligigi+jhUSzTzPHHGpZSBc1wmV42zhszxjuypWVFrbdG9SSbOmxuGuXsHh1BVotO4lo4ThZ6E2Ta1c9UdyNi0Lp/vNv2FZd+1QJP8RgEemU//AEaum+oXbnubE3wypbXP434Sn+EhH3l2K4FWT5tHON/Xdr9rkRdu6c3vqyeMZRq971ibdpm53+m0Id7HwM1Q7OPu+VchbW9CO1L709H4R7TCw1QlN+k6Lkjp5xyPuRvukZ4un9v2no+ED0ts2gijnt56qb3dRe3MOKj6JYnpvOd1+nJtfdVI8xP1G7HRbUYdlJPldXzmm7vue6bxIZ963fVbxOx/9610z6h7XHAyFrfKrKzYt2Vs24qK4El0GncuSuOs22+F1PdEohm6fdrApvOnKBja4zrxsfA0xGm3LifQLflLjR03vPuG47P3Z0O67Y5Tc9u0mkm0Eirnu4zi2S2I44eBrn8gtQu5e4T8ltpllmU5QxO1HWkiI/d7uiZ9Nq5NN7aRiXJCujKxSZrD1ixvbljXrHIsBRxW7T+LSYPMMRVPqHh3f7nGaaRtMqKQgeM6QqqGO9wbjC5OIw5fOPoOBol1j6jiK16jS+sOv+sertCu29QBF0Ol1PvrCkBiPuoGQAsTjYMf31vYHLMNhZOdrW1TXXQa+Ixd28qT1HPoMoyNGUKoSH487cudWTNYfldHRiJEFrWKDG44Y8RhUJARmWyotogoYkniQMTm43vUgxqLGCtybElxzxIxJ8qkg8doiSFbAqDmBNjfxBoCVFIwRSpKtELh1ub3wt51ACaRkayKcqH02xuSLkm9CSMs6llW95HuUHAjG9jb+upIPM2WcMztmU3JW5Ax/pyoCVN6osCGVicqDn8BUAVFMVBU3DhbgHgw/HjxvQEgbg8kmLWumVZLXAvwFRQmpHKs0qSOhZXBufAcMBytUgyfuGFHAK/kxABLHlx58cKx1kkV4EMYEmdbk2JuQbjDAnlbjWRBJMqlwZR7agDOzkHhbwucaxoTUfTUojSrZFVj6VzGxucQDywqKCpDlZFeN0CyuFGdbYC3DMDYG1ZJEMiyyRylQ5/TUDIovmwHwBFSiCWssBikaRyHLEMDcZmA5HxqNNSSF7isYpY2xK+sE3+Q+NSQTDkaOQBSVkTOiuT6cSLDlyqCTvHRXY3bupeltp6n1HUMujk3OAzGKKJWSLJI6uGYsL2C/LGuZx/eGeGxErKt12Xv69CLXDZYrttTcqVNxH28bCIQ69Ral1lsUmKJlIbBQtjY3uDetL/KbtaezRsfSIUrtHh+3LaPcjy9TakKAVkUwoBmP8Vw2AFuB/Gn+V3P6a5WPo8fPK+dComn7i9OIsokMO9Rwq5wuolKZrA87XtXTZi9rCXHvwb5ipwui9HtG1d2FDdzeshKSmXSqA3EENDHY35WFhWtkPyVvw9LPbMfmJGwdwP1ey/a/NYxuxVshNh+m4v58OPnWllmjMsR+26e+K+VtGKh7rdzztWn0UKOdNpYoIk1sejIlKIQEJYA3JAAJtiK2HkuB9o5PW66K6OE8vj8Rs03FwGRbvF3Pmk07LpFjyFmCroz61IK34YgG+Pj8LV5rIcCk9P4jJ5jiG/9DF713Y7h7hodZtOq9qHSa/TPBqmGmIYxSBkch8LEi4vXtYyTB25qcdadVp3TC5j78ouL1PgONRot2jTIsmF0J4AHxFXTNAne6jAKzRg29WGOODDH99RQkjqyIjW9TNYCY/mNsBY8akEKdU9yUs+b+B2GIIFr24c6kg8kaJbDN6r5TYkMMP31AFQMLMg9QkODC5IPj5VIJEkjFA1mYyA+45way8BY1BJDbUAEtKcoFgUbA3HMf6Kkg8lJOTMzAWGUAm9vPzoCYrh47h+CAMTgcORqANQv7dg10UtYNxsfE48KAlnXyALHyV7lBbA+PGlCajepLzkvjIA1wbWHqx4c8KLQCfAQgVlITMxsWuSpOBHK3GoYGiPe92Vw6h73YXAWxx+WHAUApGCRJEqnKGJVjYCxOOF8LXxoCSuoiR42RkyZbNIL2JFySV+NY0qTUZ1DRyKWJXOWBRVONyLMQ2GB8KlKhDIkswZPbIES/wAaWsOAAsMRw5iskiB3Tvp1ORnKJGje2xBIUXxv86h1JI8kkT+4EJvG4yAsbEcedSCVC4ORzckNkk45Wvf1YWqGgdP7Y9rdH3CXe59Vuj7amzaiGIQQoJHZZUdg1yRYAqB+NUucZvLAOCUdraT5qG/gsEsRWrpQ6zB9u+xkOT1LqdRJFeN8saBVcW/NZiQVwwP7Kppd6rqa/lpVN5ZPB/xCX+3XZpI80XUupRnIZLQoQU42uWvjbj+yn+VXE6O2uVkfR4taJle+4vS+l6Q6o1mwQa46yLSwQyrO4Cm8yZ8psTwrpssxjxdhXWqNt6OJlVi7Ks3HBOtDrHd8mTY+0BYemXQRsGW5ynJASLeBwx8qqMh0X8QvS62buY+7tdn9x//VojvXbjrfbG1ev1HT2p1u2tI+XdNvKa/TFb/+20rSoot4kVXWs3wlx7PtEpb0vElySobc8Bfgq7La314y5VU0UyXYD/cyk5ZQcCCDY3HEGrHhNQbb1SWzXbw5YYG1+NAe5gvqJLlgbfLnQGQ2CGL/ABB0+7P+XdNDdlGIX6iO+PwrxxLpan2ZdDPSyv5keNdJ337rmgHeWV4QQkmw7Y4KglRjqL2+dc73Pp8AqefLoRbZ/X4rT5q6WV1ylmka+cH02JtgRw8vjXUFKDObKf8AdOTlY/D/AEUAhwTIFLXPLww8KAfib02ALMwxPl+7lQDcjAt6CPy4x2uTyufHGgG4kW8a2ZUzZmJ4mxBsP3UBJsgsQyPlK/pA2NzfG9AJn1KB4ywS+Y+6obEC1r4WsLcqAWJmEgtcxyetTxNjwHDyoDbuhWP+OOigxI/7925iMMf+Jj58q0sy+UvdiXqs2MH7+32l0o6r91Usb9x9pWA5VXY47kkWVzqNRe9uPgK5vuS18FOn9R+rEt+8afxEa+aullcVjkytJjIpF8Bbh5j99diUAJZleJmKtgwdsMSf2W50AIxVFQrn9s3UefxtQEnToFIcOsbMCxvwsbW/DjQCJFeSVnaQZAL5/Pn8BQCpgyIMjsbEZje2AFuBoDwBTGqi9kGKqPyjmM3jQHsGVXfNcIqelT4nhhQHryxFo2SUEr/CfI+HCgI8kcZL5hYgfwnNe9AJVHzImcv6lAUcDdgKPUC1v3aQiLrvplAzO7dNxMMxGP8AxU4Aw8a5HubGmGucM+pF73gdb0ez1s4HuEWXoXSkfx6+ct5WUKcflXW7qKWGpmvdGXTdYrASKxZCDwxVsa9JIV0MXsPo2jqjLGLvq41vbhdzw/CsaVIg6MxfTaf9+aKxBPvpmuP9oXwpcWgyh1GzdVxCPft445fqJCT4kjNa3ztRazzZYf7h4fb6E7CSK72fp9jcngDpNCRa1cf3ajs4nF9vrkX2cOtmx2epFUhEGa8jFiRhblwrryhHxlWIKSsasb3v4D8RxoCSHicOqvmbLZT54f6aAixgNlYhixFyQAcBxw50B6zMZlKG5bLmZcL28fhegFyxZh6ZMbHKp/G+PxoBxC7QGNplU5fUOJx42PHlagIpCxsVVLpfOrcxxsCD+6gPEGaUzOwFuC+dsMPhQHkYeQnKHs4zC/8ADyoBicPHG6s97DFPym/HC3gKlAub3dlik7B9rGjP6mbbPecWPq/lsgIw/fXAd3Wvq+Jp6dfvo6jNl+gs/Z9UqM8rIpIB9WKg+fwGFd8cuR5ZwkahvVK5D2JOUKSP2YcKAkNIkoRVyZM1llzAj4/6KAYdUMeZXDMtmDLwOBBw/dQDIADSFQUzYsTY2+Z8aAlowygr6rL+oy8DfmBx50BGexJYGyixscOP7aAVmZUW8hIJylTxPyoBZBdiAmVR6Lk+PH40AyzBYQGJfKb5BjgDyPzoC0XdqPTN9vn29RAn3RpA0wsSSDpT+a/IWFq5HJWlmuMpv/mL7MavBWK/toKtqFjuL5gR/CLWHDh8664oRTCwPquEsTy/pegFZyqA+5gDYg8Tz4UBldr2feN+nGk2PZtZu0wsoTRwSTm7cb5FYf2V438TasKt2cYrhaXSelqzO66Qi5cSqZreOkeoelm6Xj33RDQ6vV7zG0Gg+ohlnjEbRkmWKN3aO5YWzgXxwwNasMdZxNufs3VJPTRpanqbSr4D2nhrlmUdtUbeqqr4UtXhOidz99g6Z737JvuuhOr0m3aXSTNp0wOULKpy3wJBbMOVUeT4d4jK52oujk2q8hv466rWLU3ppQ2c/cV0ygky7BrQLixDR4jxthwFai7rXt24uc9vq9vzWLH3DdNWw2DWu2AOVorW+duFP8Wvf1Fzj6xDzWaJ3P7o7T1f0zFtWg2uTRyrq4tXJLLkYBUV1K+m2LZqs8oyW5g7zuSkmqNdBqY3HRvwUUqaalcM0hYnJnQk3scQL2x+HnXSFWSY5bFShuFa9xbHjx4UAuSQSXz/AKciA5msD+A/GoBCMswEecLICDkPAgH83C1SBcYDiUrZLY+q1r2HpqAPoVQCxD2GJXDhzFSDx52ZgiP6jxUjle/MY3oCMmRZcjJeQfmvhfgf6WoCRLCQRJCpyNw4kXI51AIxWSNFy5i4/MMcb2qQSkjj9kmUCyEkHmScMKgEN1DsRExiRiCQcCfhxqQZrJGQXB/MFs5OUqOdr44+VQSMyD0ZrtGVYExj+6PnjxvRAVNrYZAHzBJhlGY8DlFsRaoSFRo62R1QNlZwwVAF/LyN/G9TQHkcjXU6hFUiwDcm8gCKEEpZSZXYICjAC3NSOQ+dCSJqhklRkkOYubA2w+fCiDIombJIHW4JPqX44njh4VJBkIw7JGbgAg54iBmF+FqgkS8xQczbC/8AoqSDqfTfb3uVvOyaTXbJJLFsu4xyS6OMav20kuShOTNZcxFsR5nCqbFZpgrN1xuU2469FaG9Zwl+cE46nwmeHbLvB7KQe5MkMRQRQprgAnt2KkBXtYEC1ufKvD6xl1a6Kv0f9D0+BxVKaeUNR227ws0ccf1kgJIPt65VH8JuLOMCR+yizfLeD7v+geCxXDynO+iYJoO4XS0DIfe0+9adZB/dKyWIOPIjGrLMWnhLj3HB9Bq4ZUvR40bj3Ye3crraNzmMmkjMQtyEEQC/KxvWpkHyVvw9LPbMvmJftuGa68Ei9ku1oY5VEjh4zxN45Apbwt+NaeWtfU8R4OlHvil+ktG96T7g+mNNpdBB/INYDp9NFFIyNGApSMKQtxcjDCq+53YvylJ+0Wlt7psxza2klsvUPR/cR00wBOw63MbnKrR3DAcPx/pyrF91r25cXOSs3h5pG3bvlsG6bHu2jh2LURT7hpJ9JH7hjNmljZQTYXsCeVeuH7t3rV2MnNNRae7uMwuZrCcGlHWmioUjSM/oAcrYEcLnG5HxtXZMoxaOACB6XI9Q5regJTTZwqSKBe2Q4W8Mf21AILySKJLMskIYBkYAcOGIthepB4hEkigrlY3zH5jGgH0CqWuys2a9lAt4UAqTUZQLNlbCwPiOV7edARZPS6tMLs5urWta1r8MKAktEJIw0SEOo9aqTUEkcpIM7NcM1snG3KpIHdMpkLe6AA62YtyHjbxoBqUR5h7N42FwXPD+nyoDIaWNPZiDH3THmzKxwJ4jHhhUMkXlBBGYqLECS97sRbj5cBaoB4uqhECwTXvHmKucCCRY+dGhUaXWtlZGZHjtfKFN2vYCxsOBFTQCRLKxvIimNrMJMRbDieVCCSZb+yIlBKYkHgwt+b8aARrArRGTMUstwmBwvhwvhREkETSCTECSyAXAxtyBsfGpIJGnLPG5RvbOb0l7HNjjUMD7OY74Hjewwt/o8KA3PorpbrTqddx1PSTSRJpWjg3GaOf2Pz3ZFNiM3AnhhVfj8bhsPsq/TTpWips4exduVdvc16TfIu2PeDTGZIZZUWRmkkdNcoMhOF75gcxHjWg84y6VK0+7qNn4HFL/AHBu2vd6HTLHE2pYooCJHrQMFIsv574cuQtT6xlzemn3R8Dilv8AKcm6s2Tfdi3Obb+oklG6+yjyrLJ7zlWUGMlwzX9PnVxhL9q/bU7Xk13NHGaN63O3LZnrO292HaLYezTSGyLt6q6EXsxj0+J+QtVBkVPiMT2utllmHu7XZ/cf/9b5zabcdftm4Sanatfq9t1BmI9zSzyQtcMTcmMqfxNeV6zbvR2bkVJbzSfSZ27k7brBuL4HQ3Vu5HUWuy6fqPT7V1nBeztvehinnAHIamL2p7+fuVWvJbEdNlytP0JOK+7pjzG2sxuvRcUZr0knz6Jc4htx7a7ip/mHTW6dLTsP/etm1ia6EW4n6bWgOOHBZvhT2GPteRdjcW9OOy/vQ0fhHtMLPyoSh2XVckv/AJCz0T0/ugU9Ndx9l1ErkZNs32OfZZ7ngM8yyac//day+oXrfvrElwwpcXNSX4R8Lbn7u7F8EqwfWucQO3XXuwbxse4a7pbWPtSbjom/m2jVddo/TqEOYarSNLGALcSw86l5phb0JRjcW1svQ/Flqe5KjIWCvQkm4ulVpWla99VOpfdoGXu3I8MKoW2PRekXy2E+psQMMLHjVV3Pf6D7cuhG7n3zP2V1laFObIbMWwTKxOJviT4fjXUlKSGQM5TAhm9R5+eAJBoAfKoFgqixAvYn+v5UAkJc+4Gs+UWUfw+Nr+INANTK812VmvGAQlrEX8fHCgGEhmbMMgX1AghgCbY28R8qARFq4jIPcQXPoWYE+niBcf2igJEmmEjrMjDKDY3HO1hz52oCWiLHjlsSMpk4gXOHEW8aA2LpCD3etOjje6/zvb1YLzvqo+Hy8q0czVcJe/8AXL1WbOD9/DtLpR2P7mNJqtX3N6f0EMUus1Wv2nTxaDTwR53kZtVPGsYRcSxbAWrm+5TjDATk3RKbrXVoitPFQuO8ScsVFLS3FU5WcA12163aNZLt+5afVbVuMIGfQ6lWikjFgQGVgDiCDjyrrrV6F6KnCSlF6mnVFDctytvZkmmtxkYwEyyuZDHG6jIMCQwsTa2GJ5V6GBHSdY0khLesNZXtc3wxF/HzoDyJv0/UFNwfbTkTwseHjagEvE6yXkIVW4RgcTfyoBX6maREewuC3AAXN6A8d5MgQPYDF2Bt54/DjQHsljLgTlbEMLEgjjzHCgG29GQ3UvYCxBHHjbz8KA9e5Fw4LHAG9/The5/YKAXEX/R9s3vKl7cvWAcfDCoep8RK1lr/ALvpll7idPhbLFB03AEtiRfVanAkWxrle57rhJP0+pF1n6pfj2etnCZM03bzTA3Yx67UEgYscDb91dYtZTRNf6Tic71AUUqBdiGw9OVgQPPGsmS9RJ26C2z9R+yhW2pjaTNzAYk2rFGMdZjul4Sd624BGVhKhDMMPzrxqZajNGQ6tf3ept9F7g6hsi4kflFQtZ5ssf8AcNO0/bn7eHUKXGwOJstiCBo9DYEeXnXJd3n+sxa3pfmkXua/L2HwdSKlMbufXdf/AFhH5rEX4cMK6wohTsR6SykXINiSAOWXn8KAGGXHNcAAgAWta+OJHD4UAosyrDkch1uXUG1uGGFAKzSs2dGAt/CPhbnxoBojNGGzWZjdWI4G3CgHkVoVtKFAIOWTncWPAHyoBMcvtTOZCPhxBONr8/OgHIQJjLL7pUHMEW2B5fu4UAsR+1CiyyMpQN7zBgMx5cMfK1AStbse6aXZoN91G2a5Nmnl9jTbwYW9iV/WciSkBL+hvwPhXlDEW5XHbUk5rS410rjWs9JWZqCm4vZep00cpaXu/p5H7G9qy7esnbfbsBZVbbZGUHxNcL3eivrGKpvS9dHS5q38BZrweqVXsApS2ckFBGPzE2+Z5V35yxEn0vuhUjsuYjIDj8BQCZHg00IRh7p/L7Yutze97jhQDETNqMY1AWC3pDYWtgMbigFJBKzZWUoLkkocPjegJgJkWxYsoF2OXKD5DhwP40AnBLJdWAWwYi98bc+eFAOOi/nCgslhblb4g4Y0Al1ARf7pYhiORPhY/wBVAMBpM6qgJVRZy3qxHMf10BbjuntG7bv2O+3vbdi2XVbprm0wMen0cEmpmI+hjUMVjVsLk2NrVxmVX7drMcZK5JRVdbaX8T3zoMbanPCWFBNum4q7hxAdq+pdFHDJ1Trdm6GQ2zjfdwii1XC+Gig9/UfjGKvvrFmXulO72Itr7zpHnKz4C4vLcYdp6eRVfMJbbu2W0so13U+69XTKCWg2fQLoNM3K31OuJe1zxEN6h3cfd8m3C2t+bc5fdhRfiJ2MLDypSm/RWyuWWn8IHq7Y9ts/Tfb/AGfSzRW9vXbw0u8T/wDS/VKQKb+ENR9NvXPf35y4IUtx/D434ifjLcPd2orhlWb59HMY3eeu+sd606wbh1HrG0KtlXbtIw0mmjBFiFg0wjS3/Vr3sZVhLD2o247W+1tS+9Kr5zyu46/cVJTdN5aFyKiNW0zKk2xjMUQbxpvfYsQWGZb+oftrbxFXblxPoNe35S40db7tbdpN472bBs266k6fb9yi0UOp1COqssTswYhmuoxU2vXN5Ldlay2c4Kso7VFwlrj4KeLUZPQ6G/f5IdslJy7vOuayKPq4Tjx5rjccf2VXf5BjvMXIza+m4fzucknsp2wAUrr5YwMMw1yWJPzsb1gu8GO838LJ+m4ff5znfdPtn0b0n0xJvOya6c66TWQQDSyahJVdJA2YhAAwIABvVrk2bYnFX/Z3IqlG60aNPHYO1Zt7UHpqVqR1BOWQixsWx4+ArqCpHfcjfUIEsrWs7N+X/pX86AJI7yEXACn8wNx/ZQDMukkLLkTOoxFjhhe5tyoBT2UKcwBUBiAcf2UA57irYlbkA4MMMeFgKA8jH6nuqSbCynh/VQDixFlSVh6uKqDc8v3UA+Z1VQwVVAtgcMQMDUEmPbUmUtYNmFznx8MQakgVneXEGxJBwtbE0AuVVkKrHg0YHA38MaAfj1crYMPTGMi8Mt8McMaigI2onclmeRXOX187csKkGPM4LNmI9AvccseB50BkIXiF2eb23GClBwI8+V6AyUbZgfce6Ldshtwta2PPCoJIsGX15SWS91LXxPiRxoQNOnuSsWbmMqnDH44+NSAEUkDMHjsjixObA4f21AHUkWNSF4ykPmXlbn/QUA0zNIMxADO3pPHj51IOvbB3q6r6b2Ta+n9CNI2l2qMwwPLFncx5i1jjyzYVS4nIMPiLsrkq1lvM37WZXbUFBUojND7gutlc+5BoAxY5UMJAy3vb818Bhe/9teH+M4Wn8XKZ/Vb3ASYfuA6wVc8v8vLEj2SsPpJvfjm8jR92ML6XKFm17gObdGah5u43TU80tvqN7hkmNyMzySZr/DMb1ZZjGmEuJbkH0GrhnW9F8Js3d1nHdLq9c4WRdEmTHkYEIJ88a1sg+St+HpPbMvmJGwdwny9kO2EiuHjzkNdrnOEkPPHiDWllv/Z4hP8AbUe+K+UtG+bN2Z7b6rZ9o12o3if6jUaODU6t/q4QMzxqzjFbKFY4DiOdV9/PsbC5KKgqJtLQ9/QbNvLsPKKblub5mI+yXbEJY6+Z3/ikGtRGtxxC2thXg+8GOr5K5Gen03D+dzkLduzHbqDadw1+n3TURS6LR6iaCf6yMoWSNnW4I9QuALXv516WM/xsrsYuK0tLU98wuZdYUG1LUnulNM65+JV2GYqQcL+Vdy9ZQIclljKIpu75gVfxHhhUAdmS+TFWLLc5TzPwoBiTTM0d4/1CcGsbH8OfCgARFI8r2je5UC/DD8caAUrqUxueQPLDxNADWlYEfwsCUHL8aAdyGYtn/KhAuTfhblQDyOETLlCleJbja3CoBEm1YZ8uUsLWUKTYeFqkCRI7EITiCVuOPjQC7AwpGx/UfHNmx5eFALhnmhC6cAkXzNa17chjUA9nndgo9xQL+iPhgfGpBi3nBYC4IduAwPHiPKgJEDxtbO4CDEEC5PK1jagMpFJmwSdijCwY2xueJv8ACoA03t/VMUva2VxwGHIcsaEiJxnKKTlWxBte37akgbMEqFJkTMoxzhuAthUAeR0RzLYG11suP5uPhfChIlpGe4YAqi2ueN/6qkg33oruTv3QOk3PTbT9O0e6yRzS+/HnyvGpUFfkbGq3H5VZxri7lfFrq4Taw2Mnh01HdN2P3BdbDKzxaEIF/MILAsCcT6v6WrR/xnCelymx9VvcBJi+4DrEvmlG3LEg/VCw3ItibnNzxqH3YwtP4uUfVr3Aco616o3Hq3dZN81zxrq5tOkWaIFVVYlyqAMbG2NXGCwcMLbVuGpOvKaV+9K9LblrOv8AeNh/hzs6Vcey+hQxm5JuI4cL8bWIxqiyH5jEb+11ssMx93a4j//X+e2/dP770/rZot/2XX7NIZGYHWaeSC4ueBdQLfAmtfD4uziFW1OM+Jpnrds3LXlxceNUMIV9QuCIxc3Ficf4iMK2DyEplYYrhnIBJwGN78jjQDZDXIYY2F6AzXS+7bntG+7W+x7rq9pmbWadZW0U0kJYPMisrZGUMCOVa+Ls271uSuRUlR60nucJ7WLkrc04trStTpuljvu5fT/5uw5HV1Tp7RZlAAAtPqrLa3AWqg7ouuCr6b6EWeeqmI+yusq2v8JP8YLBxYGw5W5V05TCyvqAIIjxJtiTfG9sPjQCEytcEenPgThbG9+V6AWoKgGxMvNgRYcsfG9ANlJAiNbAA3FgBYYczz86AX7j+4wZQoJIVgcoIN7fjQEVkjnfNKlijlgHAOdTdjawF8RQEon1RsP1AylghXAG1hhw50AtSsi5fzFgA5uCThhYgW4UBsXQyFutOimylTBvu3NGCbDHVRi9yL2rSzL5W72JeqzYwfv4dpdKLO93ZDB9wHayYITNE+2ZcmN0/mUuIbyJri+72nJcSu36iOjzV/3Gy+z6zOLd+UY92OqXlZcpfQl1bAi+jhF74CxJwroe63/W2vtesypzv5y54OhHJ2kcG6IAzr6VvexJx5c66AqiMIxM7ByU1IxlCG+a98fnwoDwI/uMjBmjjA9PPA4j8TQD4ePKojN3thxuL4cOAsL0BHBUoxswypwGBJ+dANKWVlaJsgC2LDFibHEcKASilfSYWwW0eNhx54/uoB+MYjNbKL25+rG3CgPWjsWstzlvmHH4UArSrlkRzjd0seF7MCDx/ZUPUyVrLQ/d28cPcTY8c5m6ejIKhQo/4vUEg254k1yfc1Uwk1/5H0IvO8Drfj2etnEJSsfbzSKHDZtfqbhv4hbjy4XrrVrKSO6a/wBJHNvMDRWjUsQxU2uMrHKeHOsmidxknbZhLs/UftD2surjD2Ns12NwfjShEdZjOmJEXetvAyRssqB2HL1Lw/CktRktJkesXSDqbf2OZg07+leVlHD41C1nmyyXfxVTtx2CQMGzbG5OABUnRaBfVlOJAwtXH93F+rxj9P8ANIvs2f8AIsL0epFTkQglbXABwthb/TXXlCPBAsdrBWIGQC+DchQDJH5roWHAhWAsbfu+VANqJVWSwMbSBQQb2NjhfHlfCgHYgubLiDksQCLYePxoB2NgC2By2AbDnjY2+NAKf23JMQJKjMCDcAWvYk4mgG0hMiCSV3XLhIwxGHL5UA5FI6qfbQHSsCEANyTbE+WONAOP61jWye4CpDE3zcyRa3IUBYzqR5I/tj6G07kyRS7+7M4AyemXcCWt4WrkMGv/APQX3/410QL/ABH/AFVrtP8AMbd3mj93sb2tjK2jz7WVGazBU2typIOA4Y1X93n/AHfFfa9dG1m3yFn7PqlR0uXaRkIawALY8fK3yFd+csJdxlcILqAMnA5SGvcWtbnxoBvURQyhUkZTks3uMOCk2IBNAKikOR7IY7t6UJCk3tbADwAoAJkdAMgU4kWFjlFuN7eFAOWdXZWUsuAIGBNsfMc6A8yi9z6luMgJscb48fGgECzByM3uZsLj4YnhQDhGUFmGP5ip4NyucKA8UqudGwPpZfy4Dwv50BbrvLu+46HsN2Ci2neNVoYNdtQj3KPSTPCJlXRQMscpjK5gCTYHCuPymzbuZlitqKk4y0VSdNL1VL/HXJwwlmjaqtNHr0FPEKNeRLFnOaRwDck4m98fxrsCgH0BsCy3BtlBNuPHnQHmDe5+bOG9OHHAYnhhQDgGYqgUtLJisK+ouRbgoFzR6FV6hu0Mxrun972dukNXvG0azaNNrt7gfQS6yB4FlWN4s5TOoLBcwvhatKWKs3oXI25qTjF1o06VTpqPf2M7bi5xaTeiqobj3z27V753Yh2vboH1Gvn0Wli00CD1OxDuFX4C9VHd65G1gNubok22buZxc8TspaaI1iLs/wBx/a9htg1BRlV1UyoB/eUG72vfEjl8a3nnmCX8a5DX+n3/ADWS27QdxFkQQ7TM7qbhllUAFed2ZbeFY/XMFTy1yE/T7/mms9SdHdY9Pbd/NepNrn0mnkn+nWSRlYhzcgGzHEha2sNmGHxEti1JN0qeN3DXLa2pqiOaHOcygsAxvjhxwrePAc0mUSKc3uYjMPIcb0BMkKiQqSSrX9Bx4cKAcMspZGQkKL2IP7waigGnWzyZlIMi4LbC/G9SB6FC8JkayqvDG1zb4XtUA8VFjN2JyqfTEPwx44mpA5mkUNZSovy4knD9tARJI29wCRrpiQBicB4fOgHCBCqmIWIthf58/GgAOrAuI8SSF8/jb91APpIiliSLyC5tib28fhQEcsPcyqRkIwUmxxw50AwqCNiGHDDxB+ZoBA0uUWYYt4ixw870A7dDmRQRJlH5PEcOdAIzu2VmcgAAEjz+HwoCTpsuViQxVRYf1gUAmJhJcm7MSQDjc2PjQD95GWVNRc5rtbjf4VAPSBaNFjvkGUYYnxt8POpBI1MIUrlILBbsRiFI4YYeNQmSWP7d9Y9pdv6S2jbOodHpX3yP3TuMkui9xnYzMyEyZTmsMtscK5TM8DmFzESnak9jRTTTc3i3wmIw0baU1427o4Te4O4fZQe6I9Lo4S7WlX6AAFgbG5AIwtyw86rpZXmb1tv7RtLGYTeXISV687KyxGaTS6Foc5zK+3Bi2XnkyE2sMKj6ZmidE394n4vB7y5Cr/SraSbut05qdIgh0LdRI2jibDLC8zGMFceC2Fq6zHqSwM1LS9jTx00lLh2vbxpq2uszfdxRP3O6zIuDFpRHIxwuRBHY38K8chVMFb8PSz0zH5iRsXcBkPZLtNESCGF8wxClI3Bufnb5VpZbH+5Yj9t02MU/0lo0/Qdpu4jRxarT7FqfZ1CqY29wISCgYNbMLCxuDVhPOcHFtOa0GtHA32qqLJ/+TvcGKIKNmmBsQsCyKSFvYAgNbHjxrH65g2/LXIT9Pvr+Eja7tp3F0On1c+4bLqBodt05mkcyI49tAWYrZzgoGPhWdrOMHOSUZqrdPCYzwV6KbcXRHHpXLSF0z2OHlVoagygs4Jck8QOPHhagMpKQqxsCUsoBXiCeBoA9xvbKQ3sp5H54eNAEmYmOSQH0nF7DG2FAe6dDI7xgBVFyScLDjbhxqCT0xrmJzFVYnMRiW/p51JA4GJIMaEArbMePnbhQEacSMA+ayuPVfmOF6AUqRopZQQeROBw8uHzoDxZA+DpcouLC3LmP7aAeV1BV2yrlJABxspxPwoBE7rmBVrXNnLYXHH+qgIzpZw5H58bj1Y/CgEmDM5mt6Da1xh4HhwoBahIsiMMb4EccfnQCC0limYhQbqDgQLXoB2CzSDi4Ju55WAoBbOpmZTfKljY42Pl8aAeBlRhe4htlGOGJxv8AjUAMqIsiqlszlizDAW/toCUYQdMrEZXJ9Md/VxscP3UrpJOtdouo+g+n238daQQzT6g6YbVJLpvfChPcMgU2OS5IvVHneFxd/Y+HdKVrppvU4zfwF2zb2vaKuqmg7bF3A7IwzII9Ho4njQe3Iu38EPgQOFxzx8MDVA8szRrTJ/eLJYvBrcXIS4+vuzE7Oog0JEaXdm0ACgHiB6cThyFYPK8zW6/vE/F4TeXIVj7ubh0zvHUc+p6T08en2n6OJGWKH6ZGnQN7hVABa+AvbE11uT2b9qwo33WVXu10bmkpsbO3O43b0Kh0XvIVk2Hs9CvqJ2yKSNgPThHpwbfGqrIF/PxD9PrZt5j7u12f3H//0KCaPrnrbZnn0+3dS7hDovde+1yTNPpmGOBgmzxkf9WtDE5XhcQ63LcW9+lJfeVHzmzaxt+1ojNpb2tcj0GRPXO1bjlbqboPZNxdwQdw2oSbNqyP7x+lPsk/GGtf6Zct+4vzjwSpcj+LxuSR7fGwn7y3GXCvEf4dHMJO39td4VW02/b30lO35Yd10qblpgTgB9RpDHKAOV4TT2mY2vKhC6vRbty+7KsfxDYwk9UpQfCtpcsaPmJX+WG96679K7rsXWS5Rl0+0bjCNUTbno9UYJ7nwCmsvrFqHvoztdqLp96O1HnI+AnL3bjPienkdGawNg3/AGHqPYdLvWz6/YNUdy0a+zr9NJpizGeMDGRADY2sRW08TavWZytyUlsvU67j3jwVmdu5FTi06rWqbp2j7pwy92nSWT3pl2LRFnBvmzS6gkHh8K5/uYmsuVdPjy6EWneBp4rR5q6yup90sSQQLj9PngMPDwrqykANaz5rZiQliT5nDDxoAZTIqszYccfjYcaAdOVSigEekByPy2HE0A2WIbFWMnBLk2PPib2tjYUAnMtypbNfGxNr38gMTQCv02bLmUjiptcEnllPCgHgGIFvSsaE/m5EX4k+VAMCSRsAFkLcyeFAbT0UmfrDpSOQFmbfNvBJ4D/iUuB4ca0sz+UvdiXqs2cF7+32o9KO7/cjrdTt3cbprU6PVS6XWaTZYJtPqtO+WSKRdXOwdWHA3GB41y/cq3GeAnGSTTm0091bMdZc94pOOKi06NRVOVlc9fuW4btuGp3Ldtw1G6a/U5fqNbq5GllZVUKt2Yk4KAAOWFdhZsW7EFC3FRitSWhFBcuzuy2pttvdZBJVmuoJIOUHgSAP3V6mA1lKo7La4HzPIg0AuRkK5jIA9rkAluNrC4PnjQHhhyqGuSL8Rb5/GgEOWLWPA4gfvvwoB6MhQwIuxuMoHy/toDyWxK5WDAfmDYknyFARlCkPkY3fEf3V8fwoCS4UC6tmW9s38WONxyoBAGaRTHiquuW1/EcvCj1As992MawdfdMMsYiZunY2YWsbfVz3PiT8a5DuYqYW4qf8j6EX3eB1vQ7PWzg2rnVuiIkWS7JuM5KjiLoDj+NdduopIamYXo0g7rCZCbAkqBgc2VrfjWcgtTPdhKNtHVAbMD9XHk+IY2BrEiGsxvTsjDe9FckAToSQB/fGNTPSjKHUZzqmcS7zvZVhIr6qUnjYgXXD8KR1nmyxv3AQBOhOw4SLKrbCWLKMoY/SaHHDCuO7sr9Vi3T+PrkX2cP+TY7PVEq4tiFUEGQnKQeHleuwKE9kC3QhiRjnTifj/roBlALEKwJuCXcHC/AEmgJoZLDibrZja4U/H40BFfC5GK3wI42/oaAWAXCBiSb3NrAG/wCFAeGNY2ytJl43ve2HiAaAcY3dERgYyGNw18L8LcOVANhbBrjC4zWuFv8AsoB4MpDAYEXWx8ON/wAeVAZN9+3p9ii2KXeNdPsmlkM2j2d5mOmjY5rssZNlN3Y4eJ8a8IYW1G67qglN6HKml+HwHrK/clBW3J7K1LcLRd5VVuy/auckSALteIx47a98L24gca4bu7/3GK+3/wD2I6XNv+vs/Z9UqJeRQWCh1BICuTcHha9fQDlT2P3JcyZwbLmtfHGwt+JoD2SzXd7AkCxOJPh42oBvNHYNcAnEm5BX4sL8fKgAMMuJZlbFrYWJ4EC2JoBYYhCcrC2Crc3y+WPDhhQHkkasUK+kgWUc7i5vQHjPlurN6Ra4F7WPK/C1AeWfFF/MpF3vceA+NxQHhzZLSAgWb1g8QT8qAs33dSd+xnYF0n/Tm0wWKBDmYN9GuAFr3IXh4Vx+SVWa42r0V5PGL7MaPBYfi6jju2dtOu9z0662LpjVbdtjgE7vumTbNJc8xNrWhUj4E1f3s2wtp7LuJy3o+NLkjVlZDA35qqi0t9+KuV0JcnRfTO3e1/iDuJtSSoLPoenopd3nLA3wlUQ6cHD/ANoRXk8fiLnucPLjm1bXJ40uYz+FtQ95dXFFOT5dEecQ28dutpzJt/Sm5dSyqPTqd9130+nPw0uhCm3k0xqPh8fd95ejbW9bjV/fnX1SfbYWHk23J78no+7H94SdzOqYQYNg/l3R0KgBV6f0cWjfKeGbUWedr+clPomGk63dq6/Tk5fh8n8JH1G8lSFIL0Ulz6+c1PU6/c9312wS7vr9Xuepm3vThtRqp5Jne7oCM8hYjjW/O3C1ZkoJRSi9CVFq4DWU5TmnJtuq1nTO8G8avp7vHt2+7esZ1226bRywe6Lox9alXFwbENbjeqHIrEb+XO3LVJtdBYZjcdvFKa1qhP13fXq7S6rSzSbbtw0/6t9NEJCslwALljm9JOFqR7sYbZa2m3o06NH+4ebXap0QiPv71XLJK6bNohGVTJHaTArfNck/xX+ItR918PTynzD6vdrqRg9z6w6p7y6jbuiTptBtvu6w6mKXM6jPAkgs5s2ABPAYmvazl+HymMsRWToqcrWownibmNat6FpOadYdC6/ovcX27ddRBLNFGsrajT5mjZW4C7KpHDhVpgcbDGW/aQqlw6zTxFiVmWzI2jd+zu97J0nD1lNuWik0kkWnmOij9z30GotlJLKFJGYXF607GdWb2IdhRlXTp0U0eE97mAnC17RtU/eQekO1+/8AXek1ut2fVaKGPQuEK6qR0LsVJ9IRG4W5164/NrOCko3E3XeX+pjh8HO+m400b5hNh6S1e+9RR9K6eSGDcXnk0xklZvaDw5sxzBSbHLhhWziMZCxZd51caJ6Nek8rdmVyewtZO6z6D3PorXpot11kM7mH3kl0zO0eVsLetVscK88BmFvGw24JpVppMsRhpWJbMjY37S75B0UnWn8x0TbdJpU1n8uBkE/tSsoHFQl8QbX4VqxzqzLE/D7MtqtK6KV6T1eAmrXtaqmvhNX6T6F3Prvc5tu2rUaWKbSwmV5NWzImBAAuqsb4+FbWPx9vBQU5ptN00Hlh8PK/LZjTwkbeOltz2HqF+l9fLAdwhkiiLxMWiJmtlIZlBA9QvhhXpYxcL9n20a7Onj0GFyzK3PYes2frXtVvfRkGi1W66rR6qLVMY420hdipUXOYMi/iK1MvzezjW1BNNb9P3nticFPDpOVNO8P9JdpN56z6fn3/AG7cNBptLp5JYo4NR7gdzCoLZcqkAcgSawxudWcJeVqUZNumqm74TKxgZ3oOaaojTem+lNX1Lvum6e0UsUOt1TsqPOSsYKKzEsVDHgMLCt/F4qGGtO7KrS3tZr2bTuzUFrZO6w6E3HojXDb931GnmkMQmWfS52jKk4YsqkGvPAY+3jLe3BNKtNJliMPKxLZlTwGwavs7vWl6Nj61fcdFLoW00WrGhHufUCOYrluSoW4zYi9alvO7M8T8OlLaq1XRTQe0sBONr2tVTnNe6N6C3PrnXz7ftOo0sUmkh9ySTWOyrgQLXVXON/CtrH5hbwUFKabq9w8sPhpX5bMaeEgbv0luG0dSP0xuD6cbjFLHBmhYtDea2UhioNhmxwwr0sYuF6z7aNdmleHQYXLMoT2HrNn6x7Ub50LFpZtz1ul1UOtZlQ6VnfKVFyGzIuHwrVy/NrWObUE1Tfp+89sTgp4em1TTvErpTtFvPVvTup6l2/ctBp9HE86jTT+4JHMAzPbKhUA8iTxrzxmd2cLeVmUZNumlUpp8JlYwE70HNNURrHR/RW6dX7rJs21T6eCYRNNK2qYrGAtrXKqxvjyFbmOx1vB2/aTq1Wmg8cPYlflsxp4RjqDpHcOlt+k6d3R4TrU9tjJp2LRMJPy2LKpH4VlhcZDE2vawrTh16DG9ZlansS1m39YdqN+6M2/R67X63Rz6fUt7UY0jSM6HLmObMi3FuYrTwGcWcbNwgmmt+n7z3xGCnYScmqPeE9Edp95622rWbvte56LSafSah4fb1RlzyOihzlyKwAxtcnjUY/OrWCuKE4ybarooThsDO/Fyi0qb5pu3bJrd63jS7HppVXXaucQRmZrIpLWNyAcB8KsL1+Fm27j1JVNWFtzkorWzYese3Ou6Ck25N41mnkn3FGaA6QtIgyEZgSyoeYt/orVy/MreNUnbTWzvnticLPDtKVNO8ZqXtRvcPSUfWX1mjk27UadNQNMrP74jY2XDJlvflevKOc2ZYl4ej2q0rop0mbwNxWva1VOcxPRHb7Xdd6/X6Hbtwg0Z2uJZtU+pDhT7hsFAQMScDhXrmOZ28DFSmm6umihjhcLLENqLSpvnuy7Dqun+6/T2x6545tVt++QRSyQk+25Rwcyk2NsL2ONYYnERv4GdyOqUG9JNq27eIjF61JGS7uPbuZ1qAoHuadLuBx/QjH76wyH5K34elmWY/MSNi68jX/JPtShW4JZscSM8bkkHzJrSy1/3PEP9taPfFL9LaJyd7es49h0SppNuQwaeCI61VkMhCFUDMpJW7AWNvlWT7t4Z3HJt6W3TjI+q3lFLRo3R/wD5geqJ5IfZ2TRIqsxkX9Q5gVsOfIm9ea7rYdJ1lLmM3m917iMbvffDqndNDrtifbNDp03XTPo5pxnzqs6tGWXlwPnXpY7t2LU1cUm9l15DC5mlycXFpaVQ0nq7tJvnR2h0Wu3LVaPUQ64hYl0rO7RkKGObMijhzFb2BzezjJyjBNOO/wD7mviMFOwk5U07w90d2f3frTY9Tv23bnodNp9NNLCItT7meRolDNbKhAGNr341547OrWDuq3OMm3TVTd8Jlh8BO/Bzi1RGtdL9Hbl1hu42LbpoIdUI3ZpNUxRFCC9iVDHlbhW7jcZDCW/aTq1wHhYsSvS2Y6+E86l6P3Do/e22Hd3gk1ojSRZdMzPGyvcLYsqEcPCmDxlvF2vaQrThF+xKzPZlrNr6s7R790ntOl3TXa7ST6TVsqrHpXkZ1LLnGYFFBsPCtTA5zZxdx24Jprfp+89sRgblmKlKlHvB0L2r3nrrRa/cdq3PR6KLRTjTP9UZQZHAD2GRWwAIuTUZjnNrBTUJxbbVdFCcNgZ303FpU3zSdNsOp3Ld9PsELoms1OqGnUObIGzZSSQCbVY3L8bdt3HqSqasbblLZWupsHWXbrfOgDoI931GjmTcs/0z6OR5B+na+YMiW41qZfmdrHJ+zTWzvr/U9sThJ4drapp3jM/5Tb9N0cnWI1ehfbZIfqfpcz/UZM2XgEy3uOF68vrNn4n4ektqtK6KdJn8Dc9l7XRTnMN0T0Br+t9y1u07brNNo5NBANRqZtUHy2LBQLIpJN69sxzG3goKc03V00f6mGGwssRJxi0qb5h+o+lNV0xvuq2DXSxTarSuIzNASY3zAG63AIvfmK98Lio4i0rsapPf1nnetO1NwetG19WdpN+6P27S7ruOr0Wo0urdURdK0juhK5vVmRQRbwrTwOcWcZNwgmmt+n7z3xGCnYipSpR7x50V2k3frzbtbue2bnotJp9HOdMU1XuZndVDHLkVrCzcfGscwzm1gpqE4ybarooThsDO/Fyi0qb5pG3dPanc940uwadkTWanUDTqJT6FObKSbA4DyFWN2/G1bdx6kqmrC25SUVrNh627dbz0JJoIN5m0U0W4hjppNG7yYpbNnzIluNamX5naxqbtpqmuv+57YnCzw7SlTTvGX/yg35ekoutU12jO3SwfUDSB3M4QnKDlyZb35XryWc2Xifh6S2q0rop0mbwNz2XtdFOcxfRPbzcOudz1237brtNopdtgE+pm1Qky2ZsoACKSWua9sxzK3gYKU03V00f6mGFwssRJqLSpvmM3Po7cNo6rk6WaaGTco9UmkE0ZPtMz5cQSLgWPMXr1s4yF2wr6rstV4TCdmULns3rrQy/WvbTfOgxoZ94n0U8W5O0enk0cjvZlFzmDIteGX5raxratpqm+v9T0xOEnh6bVNO8ZbQ9p991vSB6w02s0Q24xyTnTM7/UFI2KEgBCoNxwvXnPObMMT8O1La1V0U0+EyjgbkrXtVSnOYDozoXX9a73Ps+362HSamDTNqJ5tVnyKgYLayhiTdsMK2MwzCGCt7c02m6aDzw2GlflsxaXGRuqemdd0nvWp6f3DVRz6jSe2PehLe0+dQ6lcwDD83MV6YPFwxVpXYppPf1mN+zKzNwetGybt2j3nY+mU6s3XW6M6F0gk9qBmecCa2XMpRRcEgHHxNadjObN+/7GKddOtaNHhPa5gblu37R0oL6M7Ybv1tt+s3PaddpIottkETpqWdGdymf05VbC3jU4/N7WCnGE025b1P3jDYKd+LcWtG+attnTOo3fqHRdNQahdPr9fqDpo5JMwjXLcsxIBNgAcQK3L+KjZsu66tJV4Twt2nOagtbJ/cXoDcugp9Jpdw1un1i62BpoJ9LnwCsVZWDgG9xyrwy3MreOi5QTVHTT/oemKwssO6Sadd46T3etDsPZ1RGLxbYgF/Va6QWGHHhxqqyF1v4l+n1s28x93a7P7j//0aJbp2066jbWa7R7RH1Dt8cj5Nx2PUwbogW5xI0ru6+JzKLVVxzrCV2Zz9m96acPWouRm68uv0rGO0t+LUujTzHPphNpfchnhlg1aNlGk1C5HuPzehgCLVZxkpqsXVb60o05JxdHoYv1kgOqquN4/Dxuakg8dYwPXGrMAClsSDx48qVB0DpDr/rjadbsu26XqrXnap9fpY5tp1E31WmMTzoCvs6kSIuBwIFxytVXjcrwt6EpStx2qPSlR6t9UZuYbG3rcopSdKrRrXIzof3OaabSd05oJkH6ezaH2QcAUEmoBIJx5DHiap+5apl9PTl1Fh3hdcVX0V1leGeWRpWC3Edgt/zYjlzvXWFGeBisUhAYve0aNazHAmwt86AdBkJXOoUEepONjzv+NAPAKq29IOFrY2oBkXLZsDHbBybY24WtyoAsysCpFltc8sbX/ZQCTdRmayhjYWtjf40AlrEKIyVZ/wArDhYDlegGAZQRcC3Jxx8cKA3PoFZJusejApWJn3zbyhb1WP1Mdr8K0sz+UvdiXqs2cH7+HaXSjsP3SxaqHuLs8Tf7z+RREMp4gaicC5+Nc13ITWCmn/UfqxLfvI08TGnmrpZXds9izixym7WNr/gK7I58aYSuQYiuAJVASTxwA+VAeaOYzO8eoQlrE5rYkg2thhQD+WT3vZjAc5bsp5A8CcMflQCVYqfakIYKMym1xfw4UB674D8rKTc4cOXKgPfdUAKVC3NwSxx+VqAXlzMxJUIwBFxxI4AEgfjagEhGGS6ApYkoOFwbUAKyAEC6MADjyv5fGgFo0qvECiqGkQMuGN3AqHqZKLSfd3KF7k7ErEAwdOQgAWxP1WovYVync/5WfbfQi7z/AN/Hs9bK1asI/SKS5wjrr51VbH9T9FeHAXHn411e6U0dRjOkADuunDWQZx+bHMbN6RYnH416EbjPdhRF2nqYgqpGujC4H1YtYD41iiI6zF7GofdtKryewrSpeVsbfqL/AHTektRlFGxb5Io3XeYiBGo1MwC24WY4HCoiYMs99wErt21+3uVQLvsUiZjbiNHob41yXd35vFr0/wA0i9zX3Fjs9SKqgkH1qEHlz5n8BXWlEN2DBmRDmsCrnGxHhy86AWI7MScquACp43Yjh+3lQHmcRhMxW4xtiv8AVQCGk9QIQK17gHEfGgFs6gMSQStyMMb8hwoBFtQyPOAGutyDgVH+jGgHFEYgadh7gyFkONiPDkcaAx8b6mf3DbJGuOOCg8bX86AlAknKbFsvIk34fhjegG9T7/tMVBCKLkDA3+FgaIFwe7um1K9iu1UzsqRH+WZE4n/6XSEG3LjiK4Du7FrN8U36fro6nNmvgLP2fVKeyu+d0Ci4sRY3BvhXfnLCVMgOdzZVtmReYoB8lAwQG1/TY8SDwvcfhagPbSZSmALcbcx/r5WoD23puLFmGC3IN7/voBcRAIEhGZfzoeAxPPw50B44tdlC3sCGGJt8PjQCM0gkRXVVjYENMP73C1ANgSM7KFOJOYSeI4YigHIpDKsfuKMCcxPIcMBe1AW2606h6o6R7Jdltdsm5ybLrN10iRSayFY/f9lNIHskjIxS5b8yEHxNcJlmBs4nNcY70dpKWhOtNe9qfhOlxmKuWcFY2HRteHVzFVtx3Tc941j6vfdz1W96l/UNVrZ5NS1j/tSEkV29qzCytm3FRXAqdBzs5ym6ybb4dJFIsoIChrXBGJGPhXoYDTSMjp7oRIiSJNRhYH50BnNm6W6p6jlKbD07uO7C5DyRQO0QtzMtggHxatTE4/D4b3tyMeBtV5NZ72cLdveRBviWjl1GQ3fprdemdT0jDv8APt8Oo1O9xl9Fptbp9ZNB7TRW99dK8ntE5rAE3NvKvKONhibVx21KiT0uLinVPydpKpnPDyszjt0q3qTTpx01HTO5O4bbs/fTY923iD3tt08Olk1iWz5gFkW5Rrg5WINhgbeNUeUWp3srnbtuknWnMb2NnGGLUpLQqVN/1PdvtrBEDPtUmRmCxX0UTBrm9xjw51XxyHH+d+Jmy8xw3m8wgd3O2UiM77U7lz+oPoY2vfG58fian6Dj9yX4mPqOG83mH9t646H33qPpfR7Fto0+4y65phP9LHEQpgmU3dccSRzqLuWYuxYuyuyrHZ3291Ewxdm5cgoKjrvcDOLd+5WTriZMwKHQadlj5ZgDx8L2FXvdr5RcbK7NffPiR2vuC8kPZpWXKGXQ6EOrCwynKCLDgf6657K6PM/DIs8X8ouJGu/bsiQ7D1G5jCO+qiZpVBJIEZFsoxw41td6qu7bXA+k8cn0Qkc47dtBN3fR8gB+t1jISmX1WcEAMAVxx8RVxmqay5rgXUaWD04lcbJ/3CSMnVejXN6H2xLx/wC1mcC/xFePdf5Z9p9Rnm/vfAdb3WSWLsaJFyq67LCSHFhZrFgbeRNj86o7CTzX7bLC58l4Dk328xKOqtz1DxAu+3Ogk4FbyIb253ta9Xfel/p49rqZoZR718Rje4LwTd3iCua2s0iuzxkC4KkEq4x488PCvfK01l3gZ5Yt1xXhR0z7iZGj2npwo2RTq5w45lci/uwvVP3U95c4kb2c+TEzPZXP/lpOVsjGbWmM24EAgHDE8K1u8FPjlxI9ct+XfhOHdoZF1HczQSyKnue5qWUqotco+C34V0ue6MDLwdRV5f8AMLwmX+4ORk6v06FvQ+2RHJ55nAv8a1u7Hyr7T6j0zb33gOvb/NJF2MSZcoZdm0pIcWBUlcym3lz+dUeFSebfaZYXa/BeBHK/t3iX/E27ahogXfb2QScCP1EJw53tarjvS/08V6XUaWT+9fEYnrh4Ju8LBl4a/SqzNEQLgqQSrjHjz41s5cmst+y/20HjimnivCjpH3FyNHt3TbBsinU6gMOZGVf3G16qO6fl3OJG9nOqJnuzZf8AysmZbIc2vMTAcCAbHDE8K1c+p8evsnrl3yz8JyHsKBL15qNS8SFjotSFZcAuYriBz4Wq97y/KU4UV+Ve+8DGu7T6eXuhlZb2+kVy0ZA5EEhx6rfhWeRprAcpjmDTxHIdU+4FzF0tsZRsgGusRzK+0eFvDCqXut7+fF1m/m/u48ZI7CFj0JuTD0g67UZSBzCDG4sa8+8tPi48S6TLKvcvjK79EA6ruTs0+oiSYxbuGYLgpIkN7XtzxtXVZhowU6aPE6inw2m/HjOs/cXJF9Z03Gyliscx/IwwuARnIseI4cOdUvdRPYm+FG/nL8aJum+fp9iovYZUy7VpjGbZRf3FwAXhjVfhtObOvnPoNm78l4EaN9ubF9z6ocYj6bTgkgXJLHny4CrDvX7u3xs1sm8uXEahu85bv7o1mkQCLqDT+2wBxsVKBud7WH+it2yv7S6eYzXn859pGI7vgx9yus2sVzaYMBib3ijUk+HA2/ZWxkPyVvw9J55j8xI2Xr5Ubsn2sMTZ1jDKsikiwMbjAHz/ANGFaWWOmZ4ip74v5S0dW0PdTtvp9s0Qba5Fih0kKzldHGyoyRqGBxFyDfG2NVVzIsfKcntbr3Xvm5DMMMopbO5vHkHd/tlKFI2t1yqcg+hjJFsSoHmScPnUSyHH7k/xMlZjhvN5iDu3cztprdo3KKDZh9TNppNPp82hiUh3VstjxWxN717YfJcfC7FuehNN+Mzzu47DSg0o6abw13/my9MdLyo+VX1FyOBKNCDw8sKd2FS/dT3usnNnW3D9twy/Y4ue3OsZbJfVaz2yB4LYHDjWt3ip8bHiR65Z8u/Cce7JATdx21MsSM/s6sBlwCswtmA58LfOr7vF8lo30V2WfMco73pkhl7iRIyg5YdOrs0ZAsTgTnHqsb+VO7yawXhYzJ1v8h1Tvuxi6H2do2yZdZCLcCV9lrgAeXKqXu181PifSb2a+5jx9Qj7eyW6T3liLK24OAQPCMG9xjz4VHej5iHF1k5R7qXGV86dDaruXt82ojjmaPfFZwvpVik+NibcbXt8q6nFaMFKmjxOop7Om+q+d1nY/uMliv03GwLsDMyjIwwwBGYi2N+Rqh7pp0uPiLLOXpibZP8Ap9hx7JWMrs6lCAFAPujgB+HxrSj/ANvp87qPd/JeA579u7M+/dRPxH0MWZiBckucPK1qs+9fuYcZq5N7yXEab3SlMnc7coZ8jLHqIVU5b2UgEZg3G1WWTKmBjTeZqY75h8Z2jv45j6N2RkbKBrYxbgSvsngB5Vz3dj5mfF1lnm3uo8fUK+3xi3R272wH8xlykD/5sG9xjWPeinxMOz1k5R7qXGV56Svq+5O1TTxRzNFvKs4XBSVmxsTbmL2+VdTjdGClTR4nUVGH031XzjsH3GSxe903GylmAmYehhhcAjMRY8eA+dUXdOPi3HxFhnL0xNw3C0fYhfYITJtMRQgBQD7osAF88PjWja/7fT5z6DYn8l4DQPt0cyb11KwF1+jhzMQL3Ln8OFWXev3VvjfQauTeXLiNU6wB1HeeaOWNJlh3bS5V4ZgGjYKSedsK3sBoy1U8x9ZrYjTin2kdL+4uWL6Dp2NgSx1EzJ6G5KP4rZbEHgMaqO6kXtXHwI3s5apEz+0hU7EzGEiMfynUlTYKAfcbw+Qv+Na1/wD7dV85dB62/kvAzmH2+O0vV27NxI2052IF7lxhjiPKrfvTT4ePaNLKPeviNZ70mTUdxN00z5WRUgCEA3CsgtmvzBvW53f0YOPhPDMvfyO6dxWii7OaOP2vaQ6PQIIgpcLZVGDC6ix5k/trnMpTeZSfDItMY0sIuJET7fhH/hPemjUKz645xaxuIhxPE16d6K/EQ4usxyj3cuM4f27d37o7ICwd1183qtcWAYgi/LAV0WbU+Bn2UVeD+Yjxm7fctM6bh0/GWURPpJTa3rBz2a18LEWqr7p+7nxo3M58uPERO8Cq2w9oHQ5kG3RIJVzepckNgAfJfj4165D7/EdrrZhmPu7XZP/S+bhLaTXTajQyvpp2ma2qgb2ZFYMbEMhBrGcIzWzJJreelc5MZOLqnR8BucXcjrcxjTbvuUHVukWwTT9QaaHcowt+CyahTMvllcVVzyTCt7UIu3Lfttw9XRyo3Y5jfpST21vSSl06ec8HUHQW5gDeeh59mme6ncOmtwkjVTbj9JrhOh+Adaj4TG2vd39tb1yKf4obL5Uyfb4e55dvZ4YOn4ZVXQSP8KdD7nkXYu5UGgmkAA27qfRT7eRfl9Vp/qoMfElay+MxVv3thvhttSX3ZbMukj4ezPyLlOCa2edVRK0/a/r3btdtW46fZjvm1afW6Wb+c7FqId104CzIbs2keUqoAxzKKiebYWUZRc9iTT0TTg9XpU5gsBeTTUdpVWmNJLmOk/dnEY+60fp9z3Nh0LKSQRb39VYg1V9zlTAU9N9CN3vA64n7K6ytBjSxygMH9LHAG/DCuqKQR9PICbvmJxVr2UY2wvQCczenEkk2zDxxtyoCSsbAoYycuUDKxGI8T+NAGX1mwvhYAY2wsPhQCivpynNb+EWJPG9r+F6AjSQ+8QGIABByA4Yc6AUyhyuQMEBPpHPC1xwwI8aAfi08aMS5L5mzZScQRgKA2voay9bdGsBYDfNtsBhYDVx4Y1pZn8pd7EvVZs4P38O0ulHYPudkMPXm0xyqwdNnW8hbMTfWag3vhwuK5nuN8lP/ANj6Ilv3k+Yj2F0srZJPJKFyllT8uFjmFxe/hXZnPgim5IuFBzFzYFQMbWPIcqAWI4RKjKxDN6lkGFjzuLGgJYMUbM5Nnyf7w8wBgP3UBGYoMCpcNiTfG1/2jGgPVAkcggFDxB5WPljj8aA8yAKcCHfjlOYcybHxoBwuSvqxZeItxAHM8rcsKAaVLEOTYrcmMnAXOPCgPJLnK2LBsAMPM4m1qAkL+m8VlMjrJGRY8syk1D1PiJWssj9251L9w9gaRMssuwR+kEctXqeIrke5bfwc6+e+hF73hS+IjTzetnAtTpSOjY53e5GvmRVvaw9pQeeN667dRSR1MxvRsXubnEFazAlsG/uqxrNsbjDp/Tt/KeqDmayayNjdvBiP66xqRFaTF7BCsu8aWI4q8qA+q1xnFTPUZR0mW6lilh3ndxnLhNXKpfmcSR586hHmyzPfhpl7edhIZYv0V2VijA3w+i0N8RxNcf3cbeNxnb/NIv8ANqLD4fs9SKuSqbqwJOY2BBuRjbhXYFABGZfaJsbC9+QHgMKA9QZWIJJBsfeGLcr2HiKAUWLOrMPQtxkA9IHMY86ASIgASFDFbFCTdjhY3HKgEZlAF1Lst/VfC1seFASI2jQOrNZWF8pOBA8B50AiVIvZA9QjUYQjwF+OB53oBr21VQsZzH87IMBbgcTxoBklkN0Z0YkglRewI/KORFAPNqrhhILMuBS4seOPnhUoFvO7xY9j+2jsrLHJLtmVC1x6dqcNYedfPe7lfq+K45+ujqc2+QsfZ9UqZkjKsGX1LbK2PEcL4DhX0E5YiNp8gIRmb1XzcQMQbXFAePEkuU4q0RuX4E87jyoB1B+XNjbAMMb3HO3I0AtlNiSGYsOJ+VrDwwoDwKxT0GwOBYG5A40AzIDHlAzFiFU3OBPI4f20AjKzk4kqvFbi/C/AjjQClhdLFiJCTZQxtYnGxvQCsiIUEahwDjwFj/poC4HczpnqPqDsz2A0HTuz6/e9T/LlnfT6OJpWRfooQrSlQQikk4sQK4nK8Taw2Y4yd2aim910/ierfOjxtmd7CWFCLdFucSODSdstZthEnV/VnTvRzn/eaLU65ddrVvxA0m3DUuD/ANIrXQ/VYz9zbnc4VHZj96eyukqfgXH3k4w43V8kajEkXazZ8pOt6i63myqAsEcOy6NzfjnkOpnIv/sqaiuYXdSt2lw1uS5tmPSTTCw86b8EF1voEr12miYjpbozYNgKYLq5YDumtHgRNuBlQHzWMVH0l3Pf3rlzgrsR+7DZ52yfjtj3VuEeGm0+WVegwe8dV9XdQhP8QdSbhu8Sm0Ojn1DCCPNbBYVtGo+C1t4bL8NhvdW4xe+kq8uvnPC7i713y5t+HRyajCQxQRS7Aqr6RvWnzrGoBFyl7W+de9/TblxPoPG35S4zrndfaf5/3v2rY55W0UO5x7foxrVszKGDFmCmwuLkCudyW97DLJXEquO06Fpj7ftMWovRWiN/1P2/bLqEEbdSavLHhGGjRrNe5vZhxH4VXrvVd/prlZs/R4ecPR/b70/DGYo991/nmEZ4+OHDy/bWP+VXvMXOT9Hh5zF7V2j23orqTpvqDQ75qtUW3NNN9LqFUKyyxS2ysmN8OHClzPbmMs3bUoJeI3o4GhHLo2LkJqVfGOOd/FH+PHBfPGuj0xZLWsSCbYmx/ZV33b04RcbNDNNF98SOz9fs8nZLSlpSrNodAXldfUbBbkrh8MeWNUGWJLNHxyLHFv8ARriRi/t3nkPT3USohnfT6xDCDZQxMZOUMRbEjG9e3emK9tbroqus88ofiSObdtpJp+8RlkjEDmfWnVRlg+Q5WBAPP1WFwOHlVxm6Sy6i06I0NLBVeK06NLHvuI9PV2hUvdP5fGzpbhd253seXhXn3X+WfaM82974DrG6tJJ2FQmUozbREDI62YAPhZcLkAc+PH40tlJZt9p9BvXNOC8BzP7dpb9TbrECXU7cWJAuAwdbHlyJAv41b96V+nj2jTyf3r4jF9eTanUd5Ilk04088e4aNUjzrICgZMrY2BuMctq2MtjGOW6HVbMuDfPHFNvFaVuo6L9x+G0dOFZPz6qYFbE5gEU3v/aKqO6nl3OJG9nK8WJmOykjHtjryrEiOXViLOMqge0MARe4J5ivDvAl8dHiXSemWv8ATy8JxPsznPcvQH3Q4A1fuy2A/gYflubEm3Dh42roc++Rl4Csy75heEyX3DC3WWlGcMn8viZ0twJZud7cLeFeHdh1wv2membe+8B1zqEu/YaK8pRn2jTZpJFs35x/DhiB48sfjSYVJZs+0zfvfJLiRzj7dJT/AIh3iEEujaDOTa4VlcAG/LAkC/jVr3qX8iL9I08n94+Iw3Wk2q1PeeISacaadNy0iiPOsgyKy2bwN1F8tv21tZeoxy3Q6rZfAeOJbeK0qmlHQ/uPAG3dNkSfnnnGS17gKuN/7RVT3UfjXOJG7nOqJm+zbH/KvXZWNlfWrFmGUAe2MARc2JviK18+X6+P2ek9cu+WfhOUdgJCnXOqg9wzrJoZ8zhbC6sCGIxtz586uu8yrhE+FGhlPvvANd2JtVP3VgjfTiCWKTRpAvuK4dLrlbGwx4kVnkkYxwGh1VJcBjj23iNW8dQ+4j09LbIUktm1xUCxxHtk38vmKpu63v58XWb+b+7jxjnYBy3Qe7gMcqauX2wwyqLxAmxx4niRwrHvKv1UOJdJOVP+TIr92/lMPcfZl9wzM27FJFC8VZyGBGPjY410+ZKuCn2Sowui/HjOrfcfqJ/rOndO8GXTiOZ4dSJBd2JGYFcCLYY+dU3dSK2JtPTVaDfzlvajo0G89Rhk7FRF5AkqbTpM1gCMxZAR6bfiP21XYV1zZ0859Zs3l+iVd5HPftuZv5v1KmZrHSRlxl9JYSYEnxAJsKsu9a/lQfD1Grk3ly4jUt1APfnTtJIXD9Raf0xjEAsLWPMc71u2v+q+w+g8J/N/aMb3bzt3P65MkJCnT2Rr3zBYYhmPhe1q98hp8Fb4n0s88x+YnxmwdwGK9le1GSJmiBlkkZsCpVGFgPMk/KtPLF/csR4D3xT/AEtrwnQ9n7FbTrNj2ueXqTVA7ho4NVqFEceUe5GHIUZuCk8TxrQv95rsLkoq2qJtbu4zYt5TCUU9rWqk7S/bzsGnF/5/rmkbAsqxqOPJTmIPnevF96r25Bc56LJ4ecyFuvYLZ9PodduOn6i1qTaDTTagIUQxlo0LgNbEA2tcY/1etjvRdncjFwVG0uVmFzKIRi2pPQhrv96ukukWWW5kkXAgnMPp1N7n48xU92/mLy/bWRmvuoftuGY7Fuf8t9zVScseo1XthxlUAxC4BF8CeNq1e8S/Ww4l0nrlj/kS8JyfsXIY+4bwe4ZxJp9XnbLbFTcFhjax8zjV53jVcFXhRoZXov8AKL70zaqbuPpon04hkiTSrpR7isJFuMrm9gLniD86d31GOCqnXXX9wzJt39W8dU7/ANx0TtTJJYvrY1tY+oe2T8sbcvwql7s/Mz4n0m9m3uo8ZF+3aQnpPfQGORNZdMwsoPtnNY48efhU96F/PhxdYyh/y5cZwLpOQw9ytsBkMzNvWV0UcVMpzLbHkbceFdPjdOCl2OoqLGi+u0dk+4+eYHpzTtBl0/6zRakOLs+GZSmFrACxvVF3UiqXHXTo0FlnLdYrcNu1wdOwyl3EckeyxE2ANjmUZfTa+HMceONaNt/3fR57PeS/ReA5p9uLkdQ77GC5vobyqBdSfcWxJ5EY28ate9S/kQfpdRqZP7x8Rp3c0yv3R3ILIryHWwCNBaw/La5Y2Pib/C1qsMoosDHiZq435h8Z237hAf8AB2zMkuLa5ABlPqHtk/LlxH4Vz3df5ia4Oss8391HjEfbyx/wZvdmIVdc2QMLKP0rmxx4nj4VHedfqYcXWMp91LjK/wDRMph7j7T6zMzbwVkVV4q8hDC2PI248POuozBVwU+z1FThtF9cZ1/7j55/d6d07wZdOBM0WpEg9bEjMCmFrYY3qj7qRWzNp6dGj/UsM5brFbhue7Ky9iEMjiOSPaICxC3F8yi3psOHMceONaFhr6u6eczYuL9F4DnH24m2/dQoC1joVLgKMpb3FsSfEC9qtO9a/kwfpdRqZP7yXEav1TM0PeqeX3TI/wDOdMfaQXNiVBA8bj4ca3cEq5al6DNe+6Yp9pHTvuOnnXQdP6b2LaVtRKyaoOPzhQMuTAgAY3NVHdSMdqbrpotH+pvZy3SKpoNh21WXsOSze3ImzStgAbeo5R6TY4W5/jjWref93+0j1gv0XgOS/bu5/wAY7kmZrPt8nuAD0mzLlueVuVXPehfpl2jRyj3vgNd7ysU7kbw7TXJWDIg5WQWxx4/DD9tbeQfJw8J4Zj7+R3zuXqtQvZ/SumnMianSaH6uQsI2jzKpzZTxLNxA8a5vKIR+pOr1OVOEtcbJ/CrRrSIX2/KT0Zu+dgEfXSZOB9PtLcm3nfAms+87/UwpvdZjlK/lS4zgnbyRh3T2VvcYs25OA6riVJYMCDwuONdLmi/Qz7JVYT5iPGb99yoJ3fYD7gCropR7dr3Ocnjfl/Q8Kqu6nup8Zu5z5ceIhd3ix2Ls0EidoF2xGLsfVdhB6bD4Xr2yJfz8Tv7f7zzzB/y7XZP/0/n91B0f1V05PqX3zprcNqhaRimqn07/AEzC/FJgGja/k1aeHzDDYjRbuRk96unk18xsXcLeteXFrwaOXUauSpIkViwubNf03txw8uFblDXI8zLZGJuubEHgcoxvjgTwFAJb23IkZrM4vl4WIHAUBlumdRqtDv8Ass2i1M2ilbcdKpm08jRSeqdARmQqbEedeGKip2pqSTWy9encPSy2pxo6Oq6Sw33XTyP3bImPoTYdB7UfECP3dQVXC1q53uc28BV+fLoRbZ/T4rR5q6ytasPURZcwzA/w+ZFxjeupKUcYC4YZrBsDyvjY4Y/CgIsxUqpJOXMA3hh43OGGAoCVFJmjUnDnktawNrCgFkDEEgsRYAYcsLE+XCgPGVgbuHJvYAcm53+NAIcXCKVBJIu2Obne4oD0EDNdQxU3VRjywv8AjQC4i10UFgbAm17/ANPAUBs/Qlx1z0YI8Qd924kWuTfVIADbhwrSzL5W72JeqzYwfv4dpdKLKd9NubWd9u3Wl1OR4dWdpieCRQwMcm6SIVZW9JBBN78a5LuwpLKr+mjrOnB4iL7OafHWt3RH1mce7/bPptj7rdSaHQaWLSaGKLQexHpohFCQ+kjYlERVUZr3wFXXdeU5Zdbc5OTrLS3V+U91ldnSisXJRSS0aFo3Ecf91cTcAW/K5Nhmwx+WFdAVQznTKWuoB/3gOGHIUAFypzICoIAX9l7edAeM4ZkY4uMY0bEHEW8+eNAOZTiP4hfMTxLC3EeFAOOCQFtctcnkw4m44XHGgPIi9je4NvzHh+AoDySQmYqgsBdcBx8je9ANuMtwQSOLt4Dn/aaAkJMHYXk5jBTcYMLDHlfjUMFovu7lWXr7pmaEFlbpyLIQtwzLq9QSwPleuT7nSUsLcp576EXufql6PZ62cHnUP290UmGG4ajC3O3GutS0opYamYHpFcu76dHvcOSMLfwNYVm6EbjHNohMWz9SGRSt9ZEU/wDTOHxqBDWY/puMtve35jYPOhUkcLMKT0oyhVchler2y9Tb+oByrqXLMBexy4GoWs82WU+4OaMdA9g4sxjkg6dYSLwN/o9AMfAEDjXId25KWJxdPP65F7m6pZsdnqRVB5Q5ABEhW9he5tzuK64ojw5lQsrEBuJ4kHw/1UBIR88YKjKQCGUX5AfgRQDAz5ibEhbWDGwFzzNwKAckBPA4WJDG4xsP2WoCPJYLiAEucTyZbnA+fCgPTKcFBJU4Y+FsPgf6qA9DAFF4S2xLc8aAUkiXKrlsRYE8flwuLigPc3uFQuYluJFyDc8B+FAWK6r6b0em+3PtlvaaPTafdNdu0sWq1IhRZ5EH1+X3JAodhdAMSeHlXK5fK485xKcm4qKpGrovJ0pai7xSisustJVbemmn+LdN+7zxzx9he1IYhizbZkky3Wx2xyBVZ3eTWbYmvp+ujczWnwNn7PqsqAlgrMhIxDELwxHiOd+Vd6cwNg3bFSQVBDcgR4UAggHKxUMM/K9iL2x+dAOEXtdTZgLKl7ZjhxvQCrMMXNwARnPjccOFzQBwtYg4YHy53oCFM4aVQbkhgUcD1ZeFgD4UA8MfRjgQPSTe4PEXoBwkKMeV7g2vy4cudANqyqCLZXGINjmN+NxhxoC1Pd7cNwXsL2EiTWTxR6nQqkqRysqyxrpEyJKFIzZSDbNe1cfksVLNcXtJaHo4PG5i/wAxbWCsUetaeQqSqIufPZRx8Bf5V2BQC2KL7cYN8hBDgerE2IA5nnQEq4N48SRYWF73ve4oCTp4JtVMml0kEms1LEhdLEhklY/7KqCf2VjOSgqyaS33oRMYuTolVnV9l7RdT6vazqt5jTox4tZHNt8m9o2nlmspJkSNrOMhC4sBxwqkxOe4eOi3/N1p7GlLgb1aeAsLWW3Xpn4m9taBW7dpuod33KXXbr3J2fUbpp8q6TV6rVFpJAt7LmL5lycOFa1nOrNuCjCxJR3UloXVpPSeAnKVZXE3wsbParquaI6Ve5OwhoHXNl3KbOtrkXvitZPOsOtPsJ/dRHwFx/8AJHlNi2/tx1BoNHNBP170/qpWZZE1Gq1mpPsMpyjKgkVSDfmONa884sydVYn4IrTzHosDNKjuR5WS9j6D6l2PfNJv69wunt41OhLmHT7hPK0WZ1KFiBJcEA4HlXnic0sX7TtewuRUvNSr0GdrCXLc1P2kW1vsj9Zdt9y693dt51/XHS2jmMawtp9GXdFVBhmLSEk28bf2xgc1hgrXs42bjWvTT9wxGDliJ7TnBcRm966Y6z3vpODozX9adHpoEhgiEsQlE7LBbJmb3CMStyQuNeGHxeGs33fjau7Wnepp8B6XbN2dtW3OFOc86F6R6o7e6fW6Ta+ruktXDubq7fWyTeiRBa6qsihsON8aZhjcPjmnO1dTjvJfuGGw93DpqM4ad8w2wdtN46d6nj6pXrjpnUbl7000sMub2maW+bBZFsATyOH7K2cTm1rEWHZ9jcUaJaNejwHlawU7dzb24VF9f9v97643SLctz6u6S24RRrp4EhmkAKi59RctdvIHhWOW5nawdvYhauvTXSkTisLO/PalOC8JkZen+rtd0cehJOueiW25NMuj95GkOpyIwNmPuBb+eXHhzryWJw8MR8SrN7arXcp0GbtXZWvZbcKc5jehe3O+dv8AdX3HQ9adKamXUadoX0+olmCNG1mBOV1PEXxvXpmGaWcbb2JWrqSddCRjhsHOxPaU4cozvvbPf996nbqvVdddKruInilOniLrEohChVAzknAczfnes8Pm9qzY9jGzc2aPj0mN3BTuXPaOcKmw9edNdQ9faXbdDrerejtGmildwdPLKGYtYC2eRuVvSPxrVy3F2cC5Sjauuu+l+5cp7YqzcxCSc4Km8MdN7B1f0TsGs6e2zrLozUaOcyyqdY8iyo0qhWGZZAAPDA4ms8VicNjLquztXU1TUlTR4DG1au2IOEZwozVeke1+6dH71p+oNH1z0nLqdJmKwzzOYmLrZlbKysLXwsa28bm9vFWnalZu0e8tJ42MFKzNTU4VXCTuuugt8653c7jvHV3SO0yQRJBpooNQ5Dx2uHbMxbHhjXnl+Y2cFa2Ldq7JVq6rd6DLE4Wd+e1KcF4TMbhsPV24dHf4IbrjomTaY9NFpDqw8i6jJEQbMRIy4EAE2+VeFvEYeGI+I9je2m26UVNPgPSVq7K17LbhTnMd0H293/oDcZty0HWPSmrk1GnMGo00802QqSpB9DqTY8Cfwr1zHM7ONtqErV1UdapL/Uww2Fnh5bSnDlIu69u933rqh+rdw6+6Vi3D34tR7ELH2lMdgigGQHLYYkm5416Wc1t2bHsI2bmzRrTr6DGeDnO57R3IVNm666Y6h6+h0Oj3XqvpHbo9vzSK2kklLtI9gQ3uObLYcq1MuxljAuThbuty36avAe2Ks3MRRSnBU3hPTHTXWHSmxajpjbutej5dv1BmYSagSGdWnWxClZVW3hgbGoxeLw2Juq9K1d2lTVSmjwCzZu2oOEZwo+U17ortlv3Qm6rvu09YdMa6b2nhmg1EsqQlZLXF0YEjC4/dW1js2s4y27Vy1cSrXQlXnPLD4OdiW3GcGe9Qdvd06t6lbqXX9e9LR6lTEY49IxKIILBVylyTwxJPPlU4XNLeFs+xhZuU06+Ei7hJ3bm3K5CvAbb1t011H1ztuk2ndOp+k9ug0snuxzaYzM7vlsB+pJZcLE2xrSy/F2MFNzhbuyb36dSNjE2bl+KjKUFTeqQ+kelurOhNp1e0bb1p0o+k1srS59YkjMsjgJZWWVMCBcYcazxuLw+NuKc7V2q3qfuMbFm7Yi4xnCj3zQ9m7Pbt0/vOi37T9ddMtrNLrfegDTSBGkBzBbqwOJNiAfmasL2eW71t23ZuUapqRrQy+UJKSnGqe+bn110R1D3Al0M27dY9K6JdsjkEOl0RcoMxGdmd5Cx4eGHhWjl2YWcCmoWrr2t1/wCiobGKw1zENOU4Km8ZXU7J1PrejV6Lk6p6OGjSKPSPrleUzZV9S3GfIHI9XD4V5QxFiGJ+IVu7XXTRTorQzlbuSs+y24UNR6N6N6h7e67VazaOuOkZU3UjRznWNI6+k5ly5HUhrixubWrcx2Os4+CjO1d8XTooeGHsXMO6xnDTo0mF1Xa/eN76k1fVDdxumdLu2r1R1KzaCZrJMv5faJb0kAXGOFe8M3t2bStewuOKVNK3OE83gpXJuftIpt7jMlB2c3LcdZuOv3PuFs+86zU6WQPq9ROZZHYAKCTmYmwFZW89t247MbE4pbiVERLLpSdXci3xkLc+0++6zR7ds+t7jbQdk0an6PTy6g+xpSAR6ImcDH8uFRbzqzGUpxsSUnr0aX4SZ4CbSi7iouHQiHB2p6n0q/TRdyOnwsiEQKdwlBIUWBVL2wHhevR51Yel2J/dRgsBcWj2keUzGy9rupdtlWTU9wNk1yFDGNJLr9SY2zDLfMroSRyx+NeF3OrEloszXDsrrqekcBcWu5HlYrU9sN+1zozdy9iMC5Sugjnl9jICLKAZCSDbGpjnVqGrDzrv0VegPATl/wAkeU2vrXpvf+vNDodq3Pq/o7bxt7mSP6N5WdzYLweQlRYDAA1X4DF2cFOU4Wrr2t+n7jZxNmeIioynBU3qiOlel+sOitk1WxbX1v0hNt2qleQT6pJDKGlQK2XLKowtgDzxpi8XhsXdVydq7tLepTR4BZsXbEHGM4UZrfR/a3fOid5j6h27rTpjUamJZFkg1MsqRMkuBDFXU+GHC9beNzizi7btTtXEnvJV0Hjh8FOzLbjOFeEldV9tt96t309Rbr1x0vpdSqQpp4dNm9pViPpHqck48STjWOCzazhbXsoWbjWnXr0k38FO9PblOCfAbL1v0/1J1lsuk2fV9T9IaXR6RhK+qjkmWQlBlH5pHCgc8a1MvxNjCXXONu629zR+5HribVy/BRc4JLjMR0T051T0JpNXtm09c9EzabcZRO41TySSK2XJdMrxgjyNe2PxOHxslOdm9WOjQlTw6zDDWrlhNRnDSajt3Znd9p3iDqBOvOmBqYNWNWhMsgT3c2e1wwP4G9btzPbdy27bs3KNU1LVqPCOXSjJS9pHXvm69fdGdR9wG0A3LrTpHQx7cJDpdPpWkGZpCoJZnkY/w2wwFaGW4+xgVLYtXXta26bngNnFYa5iGtqcFTeMi2y9TDon/BR6s6M+nGmXSjWs8olyhrm49zLfhY2+VeaxFj4r4j2V2ta00U6KmXsrnsfZbcKGsdGdv+o+gNfqNz2jrbpKeTXwiCeHVtIyMpYMChV1N7jjf5VtY/MrGOioXLV1UddFOc8cPhbmHe1GcNO+YPd+1u8dSdQarqbX9ddJ6fXa2cSyJppmMa+3ZVKhmx4cL1s2c4tYe0rUbN1pKmlHlPBTuTc3OFXwm79bbJ1N1rtW37Rr+p+i9Jt8DmT+Y6fUShmkjGUKA7txGJtVfl+IsYOcpxt3nJ7jS6kbOJt3L8VGUoJLdTInRnT3VXQ+26natk666J1cOumOokXVNIXRiuQFSkinEjgRx51njsTh8ZNTuWbyaVNFP3EYe1dsRcYzhp3zTNl7ObvtW8aTfoOuulzq9NqxqoLTyZS4cNa4KkYngDfzrev55buW3bdm5RqmpGvby+UZKSnCqddZuPXfSPUHcCfbzu3WnSG3Q7eHXTwaV3xMli7Eu5YnAWANhWll2Os4GMlC1dbeutP3HvisPcxDW1OCpvGZk2bqSboyLowdV9HPtzQrpRuOeT3zEjXLBfcKFwRywrwWIsRxPxHs7u1rpopXkrQ9HbuO17LbhTf3TW+jOgOo+gtdq9w2TrjpSdtwhEE8et9xkyqwa6lZFOYW8a2cfmVjGxUblm6qOuin7jyw+FuYdtxnDTvmO3DtPvu6dUajq2Xrjpv+ay6qPWCOBnSMNHlKkWcleAtjfzr2tZ1ZtWVZVm5s0oYTwM5z29uNa1Ni656b6i6/TbdJu/WPR+3rtztJ9LpJZCxeSylmaRyTgBYYCtXLsXYwLk7dq69rdaW5xI9cTZuYiilOCpvGa0mxdSaPo49Gw9UdJzbYdO2m/mchm94IzXYlRJkJBIF8K8J4mxPE/EO3d2q1pop0VM1auRtezUoU39JqfR3bTfuhd2m3nZ+tum53mgbTyjVI7xmNiGJssikMLYerxrcx2a2cbb9nctXFprop+48cPhJ2JbUZx8JhuqO0+89Wb7rupNw656WGo1UaO6QO6xhUARfSWewsONz8K98JnNrDW1ajZuUW+jzvYGd2Tm5w0m+bxsHVXUXSWn6S1XWPSMGgSOCM6yBpZJ5o4SPbuZZbKTblx4XqusYnD2MQ78bV1y06HSirr1I2blq7ctK25wpziOieneo+hNv1+07f1V0jrIdW7zZtU8okRlXK2COLqvE38fhU5hirGNnGcrd1U0aKdaGGtXMPFxjODrvmhaLtbvOwb/D1PoeuOl23HbpDrhDK7eyCSSQUDXycRhjVlcze1ftO1Kzc2ZaNWn/c1Y4Kdue2pwqtJP626M3vuFuGh1m79e9HRHQabJAukeRbJIczM6M7kcuJ4V44DHWsDBxt2bul7tDPEWJ4iScpw1bgy3aPe9xm2qDc+521bpptsaNNHpp9QWSCK4ssalzlBCjAV7W87tW23HDyi5a6LW+EwlgJy0O4nThP/9T567f1N1NsGt1K7Hv+4bVF7rF4dNqJFhbG9mhzGNgfAqa1MTgMPiV/NtxlxpV5dZ72cVds+7k48TNjl7gPr42l6o6R2HqMglDq30v8t1zeLfU7eYbkDmyt860/pCt+4u3LfBtbcfuz2uahsfHufvYRn4Nl8saESBu1u5I5zdQdFamT+/7O96TNfxH004Hyan9xtf07q8NuX5o9A/ST8+2/BNdTJadto93IPTHWfTvVcrC30Q138u1gv+UDT7gunJPKysay+qq37+1O3w024/ehtc6RHwO17ucZ+HZfJKhjT0h1P0rv+xf4g6Z3PZlXddEY9RrNLIsLgTxkFJcpjYfAkGvV42xiLU/ZzjLxZanp1Pc1mCw921cjtxa0rc4d86391QP+bUzE3/7h24Wta9mnGH7ape5v/XrtPoRYd4PmvsrpZW8xZpRYCw/iHw8POuqKQcdGyPKC6GNrLmOJNx8eANARoJEVXY4M3FmN7kf2UADUCKc52DJIhu5ucjWww48eAoDJKVeIetWIWy2HzvjhQAEAzEWGVbkrwx5geXKgE2upWwZgeP8AZ8aARllYe0ouwBtYCwFuPyFAeFDHdnbMFGA8xgcCL0BsPSEj6nq3pbTQKWeXfNtVcrFRf6mPj4441p5jT4a7XzJeqzYwnvodpdJ3nv1v27dOd1+id2UafU6jYtt0mri94M0ReDXTSIJcpBYZlxscfEVyvc60ruX3YNukpyXgcV1F3n9xwxcJLWop8jZxDr3qveuv+qdf1bvC6WDW66GCCTT6FHSPJp4xGhs7ueCjnXV4HBQwdlWYNuKrr16XUpMViZYi47kqVdNXAaLKkyuLXNl4EHKfI3rbNcIIXVjmTMGIGK3N/DiRgaAnzQMgziNi393EHLbA/M0BCija+ZfQc4uMBwB+BoCcntgm6+tiBFKcSb8fjjzNASJgrWYlSR+ZSPK2I/soBkAAh8SGYqFPE28Tyve9AMv6XD4MwBzLz5YnHGgCRvdsMrMtrPhgpGPhfG1ANrGoaM8WDqA5seY40eoFm/utZx190xGihEj6eiEY5erVT4kYAcLGuP7lL9Jce/c/Ki/7xe/j2etnG8B2+gzEZjrtTkt6bYG4viK7BayiiYLpP2xvMHuqxJuExB9dmt+UCsmTuEzQ5Rs/UXvKxvqUENzezZjl4cPnUIxjrMZ0uVG9bfnzZPcS4LA39a8gATUvUZUH+sPc/wAQdQLcG+pIJA5lB58BULWYMsN39vL0L2JkkSzybEfctYlv+F0RBuRc+JvXG92FTF4xen+aR0Gc+4w79HqiVe9vKbqhcjBUHLlXYnPj0kgdcoubLYu3IjmfxoBwWCWBut7Ky8L+FvOgPci39vAFDYk8LDG4PKgH5DGAgezxXylQDYknhe9+VAQHQsqhPR6gShta3AYcPnQDMEbZigjJBPqIwwvjyx50BKmgKKo9u9yRGxU2tfAjn4igMX7UyAgAgNibDEeS4+HjQE2OGZlADMhZbZ7HAf0woDo+8dyuo9d202HtxPp9uO2dOTe9tuohjkXVMbTklmMhUj9dr2UVoWctt2sVPEpvamqNbm5q0cG+bVzGTnYjZaVI6t/d/edr7wNrm7O9qtfMc8CLtahI2K5L7ZJxHjbDhXId3afVsVp01l66L7N6/A2Ps+qVUEyzWXDML8rYg+dd8cuKEUoAfMWCj1kDEY8bkeJoBShiwdlBU8MLH4WoBSjNmAbAg28rc+PLlQHqKuZSQqqQcPD43xtQEbU6lYhJiJHMeWJACDcWFxj4eNAMxSBFUNIGup48AfAX4C3KgEQDPIYlLRoTjc3sQL8LUBIkjLI4KsGRipVuBI8CPPGgPEUAIBYGx+VAWk7rQyz9jPt80kMMmpmfTgQwRxNI7EaXkqAk4Nyrjsnko5rjG3RL/wCR0GYJvBYdJVf+hxzTdpus5tMuu3PZh0toZL+3ruo9TDtMeU/xAapkkfx9KGr6ecYVPZjLbe9BOb/DVc5WRy+81VrZW/JqPSe/4f6C2hrbv3GTdio/9y6c0Uurx/ujV6v6aEDzAasHi8Zc91Y2Vv3JKP4Y7Uugn2GHh5dyvBBV53RdJHg6h6G26Vodk6CO4ucPruptfLqhm/vfR6QaeP5FmqPg8Zd97f2VvW4qP4pbUugn4jDw8i1Xhm6/hVF0jms7kdZzQyaTQ7kOmtIhKjQbDp4driIwBGbSqkjfFnPxrKGSYRPalDblvzbm/wATa5iJZjfa2Yy2VvRSj0GL2vbtZve36qeTbN23+ZdUnvyaOXPICytYys8M5a+U5bkYg/LeuXrVhJScYrc1I1YwncbaTfORB0ZPJJqH03QfVGpk05P1AE6Bowb5b/8ABXxHK1ebzDDqlbkdOrSZLDXHqi+QhN0RrrPI3bjqo5myBjOvEY2t9BT6jh/6keVD4a75r5B3/BO6uiSHtx1UQ92XLqEZrA2sV+gvUfUsN/VjyofC3fMfIe/4L3KIs0vbjqlgPzXlTAHhiNBy/ZUrMsM/+WPKh8Ld8x8gh+h90dQYe2/VhVuAEqgGxsf/AICoeZYb+rHlRPwt3zHyHidDa5Y0KdveqhHYliJlBHLAfQ3NPqOG/qR5UR8Nd818hOHReqhZkftx1TO17g+6pB8P/wBHmn1HD/1Y8qHw13zHyCh0RrnBKduuqUle9v11GC8sx0FPqOG/qx5UPhbvmPkGv8J6wBoZO33U7BGCsPeGGJBAtt9jjU/H4fX7SPKh8Nc818gP0fPqsyp246qZEUZh7w54YX269HmGHWu7HlQ+GuP+B8gweidSxKf5b9Vs5xce6BY8ScdBY4edPqOH1+1jyofC3fMfIOSdI66KKKNe3HVg9WBEgNiwBt/9L6LMMO/+WPKh8Nc8x8gl+jtero0nbzqpRMxVrSD1MMCDbQc7WvT6hh3/AMseVEfDXfMfIPT9GzpG5bt91WY4QDJlcekHiT/wGNqLMMO/+SPKiXhrnmvkPP8AB+qa0kXb3qrOihic4zWYcT/wHOjzDDrXcjyofDXPMfIIbpmaT3Uj7fdUSGEgTe3IpYNhe9tBcWFZPHWFStyOnhRHw9zzXyDzdKapUfTnt11TGxszH3VGYcj/AO4EC45Visfh3p9pH7yJ+Huea+RjY6U1l4xB256ruFBV/esLXvcE7fhxxo8ww/8AUjyofDXPMfIejpHXOHWLt31TeSxBEykAA8m/l+FHmOHWu7HlQ+GueY+QXF0hrpFaP/LnqjNlzk+8oYq2FyDoBfE8KPMcP/VjyoLDXfMfIRR0Nrppvbm6B6qVQMxJlUW42/8Agf66j6jh/wCpHlQ+Gu+a+Qmr0bqUF5+g+p4R/AxlU5gTbAfQ0WYYd6rkeVD4a4tcXyEj/BkrSCH/AC16l93/AGtQv5floLWPxqPqOHpX2sacaJ+Guath8gn/AAfuRYiDt91QBGLMq6hbem9jb6AefCjzHDbtyPKh8Nd818gmPondSS57b9Tucoyt9XGTb4fQ344UeZ4X+pHlHwt3zHyECfovVhg0nbfqm+K3XUBhdcW4bfyFqyWY4d/8keVEfDXfNfIexdE7gqpInbrqtYyCVczrw+B0Fx+FR9Sw1feR5UPhbvmPkPY+kdexb2+3XVCoxIy+8tjjgP8A6X+NS8xw/wDUjyofDXfNfICdKasMsTdveqM7OY0jEykXUXIw0FhcVP1DD0r7SPKiPh7nmvkCPpPVyyHJ0B1URYhgJly+nje+gHA1Dx+HX/JHlRPw9x/wvkM1tPR+tSTW26H6m0o+llZrzKSeAsANDT6hh3/yR5UPh7nmvkMbqOjpZtRHEOh+pptRIt4NN7sa57Ytl/4LkKfH2Em/aRpxj4e5Wmy+QhSdE7g8rFu3PVbCEFj+uuFja9/oOVqj6jhv6keVD4a75r5BMXRO5ujBO3HVPtx2Uf8AEIMWvYgHQY0eZYZf8keUfC3fNfIKHRG6+kntx1XltgrSpjbiSPoP20+pYb+rHlQ+Fu+Y+Q9PRe4SgtF236rVgfXllXC/jfQDhapeY4Za7seVD4a75j5BmPoTcv1M3brqtZ8A6NMg4+JOgFR9Sw39SPKh8Nd8x8hMTorWRhJJO3nVcoYEWMykqb43/wCAP+mn1HDf1I8qHw13zXyD3+DNU5Lf5b9Uxqgug90YX5j/AIAWp9Rw/wDVjyofDXfMfIIPSG4aZzHJ2/6ozMCSpnVhzAxXQHwwqVmGHeq5HlQ+Gur+F8h4Okp3EcEfbnqkyOcQJhYk48Tt9vnR5hh1p9pH7yHw1zzXyMjnorUJYHtv1X/sL7oxHE4jb/E0WY4d/wDLH7yHw1zzHyDqdG63TxTW7bdVgm4KiVTwsb4aA0+o4Z/8seVD4W6v4HyDTdIbi0Xunt31XaNQQfcXMFJP/wB4eVPqGH1e1jyoj4a75j5CUvRmqZEA7fdVlpb2AcAt4Y/Qc6fUcP8A1Y8qJ+Gu+Y+QZj6PlmQInb3qo3ZlUM4BzDEqL6DCxqXmGHWu5H7yI+HuP+F8go9MahXSCTt/1OdRICcjSLmyg2JAOg8afH2KV9pGnGh8PcrTZfIORdK6qJVdu3PVY9y6h2kFwf4h/wC4cvGo+Pw7/wCSP3kT8Pc818jGf8J6lVIXtz1VI2ezES3Ga3AgbfbnU/UMP/Uj95D4e55r5BwdJ67Opbt31SZFspAmV8TwuBt/hUfUMP8A1I8qHw1zzHyBF0huCMEft11QXchFZplFmONgf5fbnT6jh3/yx5UPhrvmPkGZ+itxLhf8vuqlSRrBfdTne/DQm9Qsxw39SPKg8Nd8x8hJj6H1UNk/wD1R7K2HuGZcCeR/4Gn1HDv/AJI8qJ+Fu+a+Qf8A8IPkRj266m1Cy3ySmdVDN8PoMD8afULFfeR5UPhrnmvkFP0bro2EcPbzqaNzZrJqF5j/APAOYvUfUcM9PtI8qHw11fwvkEf4K3Z3Abtz1PIFb8rauMWI4YHRU+pYVf8AJHlHwt3zHyEbVdF66zGXtv1TZAGOXULcDhfDbzztUrMcM9VyPKiHhbq/hfIR4+iNc2cw9uOq/QQHAnVQCMOB0AH4UeZYZa7keVD4W75j5Bz/AAjr/dATt31TnUC8nvL8v/0f4VP1HD/1I8qHw13zXyHjdKauAuZe33U6IF9w2mU3ANr2Gguf31KzDDvVcjyoh4e4v4XyHsnSerDrGO3/AFUsq5WyrMt8eH/wAGPxqPj8PSvtI8qJ+Huea+QnaTo3WrrdMR0F1NC3vIPcaZLD1cwND5Y0+oYd/wDJHlQ+Guea+Q//1fnHuOn1Oj3LWRa+CbQaqOZk+mnRoXvcj1I6qbVjCcbirFprfWnoJlFxdJKj4SHIM4LH1XFlwtbHhWRBjwSpC5SBm9LcL+IoB1kUoLRH1A5gwBHla9Kg3Ho7rLq7p3cNsj2vqHc9s0Ums08eo0EOpcwPGZUDK0DFozcE8VrQx2Aw9+Enctxk0npa06t/WbOGxN21JKMmlVbujXvajsv3SD3O6YbKUDbFoMMQ3+91ItiPLjVF3LltZfX05dCLPvCqYqnorrK6YtIzk5fbsEy4cRhe44V1hRg658Sc/IWHA3/0UBjwSDkykDNYNe3mRQDjxK0YYKbm+BOB8LUBK0oUo0YDkn1G35Rw5/CgJGdQYlKk+4St24A3xvjhQHgmiVnhzDPgSL4C/CxxoBX5sgEhvwI4mwGN/wAaAxs41AlbOuZQ2WIjBTf40BunbhW/xr0cBGQX37byzE8vqY+Qx+VaWZ/KXexL1WbOD9/DtLpR1b7oY5tN3C2rSDUSalV2SB4nK2J9yedxkU3IGPP8K5vuQqYGS9N+HxYlv3kdcSn6PWzgkAkS7NmMhGZixxAtgPwrsTnx4MjRlsbBgABxv4UA0CgiR3BVr4W4E2JPKgG5ZJziUujXsVOVjw5XvQDasxezYcWsCDbja/CgIzErkAYvIDgxOAHnyoCYHlkjsL5lxZ7YN4W4UAotIP4rMq4tYYWHL8KAbzxC3uBs7i7MLfswsL0A4QHGVDmDsJAgPlfj8KARGT78IysAZ47+Au6i39VRLU+Ilay033aEy9yNlEsagJ07AFSNcqgDV6niAfLGuU7muuDl230Iu8/9+uz1s4LqZQvb/SR4C246gFb3sbX4/OusT0opoLQzX+kGzbvA352DG9scMjYn+2s5DcY5s0jPs/U2YFrayPxwGc/h8axIjrMd03Nl3vQWZbLOgTn/ABDE2qZ6EZR0s2DqkJL1H1A5XN/xTeoHwWx54VG6ebLD9/ndu2n2+lkXMNkZQyAKzD6LQn1EcSK5Du8643Gdv80i9zX5ex2epFWUBOV8rDK+YueV+RrriiPWeFB6/UxuxtiDc8xxGIoADEXWM2jy3CNYk/s/ZQCv1WZGU3AGGH7MDQEWeVnYEg+0SP0+DeNALS4DsHLWylQLYW+NrUB6JJRbKMx4q2YAY242tQErOSVjnGT1elVHnbjiKAUmX3cpUqLqFIxx8/lQHuckyKovbFx8Dw86AxeoEsYBBcxcUJF1x5XogXD7qQyjsP2x1bTvO+rO1uYnBBRRt8yXDC6kGxtz8q4Hu8l9YxL39rR9vrOozX/r7P2fVKcyKwkcLEQGayi4vc8BzrvjlydCJ/ZzzNkINuBzZRbjQEgyJG2ZnBC2FycMPDA0A17sYiEy+tXNlHFsb8BfxoB02zO9mIQY5ccbeFAYpkWSUkAkMSQxPqufEUB7IFjb0qwFx6SeIPKgFQKXzMyEE4EHxtQEwguMhfjgLYWbA8OYoBKZnWO+GXAWva1/6Y0BbLuN1V1D032T7IQ9Pbvrdkm3HbFj1c+hkaB5I10kbZBIoDAXb+Ei9cNlWFs4nNMX7WClsy0VVdcnuajpMdfuWsFY2JNVW5xIqLqNRrdbqZdTrpZdbqnNjqtRI08jm/N3JY/jXcQioKkUkt5aDnJNydXpY3JlQnKjBbg4nEipIFQqWZiyEE3BB/ZQExiMuR5coNhe4Wx5caUBuGydVdW9HbOG2Zp9ti33WrDHqTDZJ2gUhfbeVQpt7uNjhfHlVfi8JhsW6XKS2Nyuqu/TiNmzeu2NMara56f7mW3Xr/vPs/UsXT+7bx9BumolhRdKqaaVL6ggRlmjVh/EMPCq6zluW3rPtIQrFV06dzXrNm5isVCezKVH4DbuuNz7zdAw6PW7h13Br4dxdo0GlhQ+00agnCWIXBB5XrUy6zluObjCy0477/cz3xVzF4dJynWu9/sedL7r3v602vWbts/V2ig00Ent+zOqI7WAYlLQv8MT+AqMbYyvB3FCdptve/3QsXMZei5RmtH7bxr/AEr113c6r34dPaHq2PTa5veGeeGJY19kEubiItywwraxmW5dhbXtZ26rRqbrp8J42MVirs9iM9IvqzrXu70RuMm27t1emqmjRZTPFBE8dmGFi0SnlwNMFl2XYy37SFui4W69JN/FYqxLZlM2veNd3q2bpPT9ZanrbRT6SSHTytt8enVZVXUWyE3iVSRmFxf91aOHtZZexDw8bTT06a6NHhPe7PFwtK45qn7cBjuj9972dc6TW63Z+r9Hp4tDIEKaiKJDISpJAtA9+HOvXHYbK8FJRuWm671f3oxw97GX03Ger9t4weydfd2d/wCpU6Yg6pig3KSeXTD3IYlhV4sxY5ljJI9OGFbV/LMusWHedusUk9brp8J428XirlzYU9JO616w7vdF6yPQbr1dFJIYhOup0cEZQqcADmiFuHC1YZfgMtxkNuFrRWmlv95licTirEtmU+T/AGM5Lqu9EPRi9cDruB9DJpk1v8vMKGYRysACM0IQHG9r8K1YwyyWJ+G9i9qtK10VXhqerli1a9r7TRrp+yNc6S6x7x9c7lLt+z9YQaabTQNI76mGFI7AgWOWF8TfwrZx2X5bgobc7Tab3G69J5YfE4q/LZjPl/2Iu79wO7uxdQSdM7j1RGdySSON5IYojCfey5crGJSBjjhXph8ry69ZV2NvxeN10eExu4zFW57DlpNn6x3XvV0PFpdVuXWWn1UOtdkj+lhR8hUAkMGhW9uRrVy/D5Zjm1C01Tf/ANz2xN3F4dJynr3v9h3pTWd5etdh1HUO3ddabRaaCSWKPTywoHdoFBYrlhYLfhcnxrDGQyzB3ValZbbppT3/AAk2JYu/BzVyiX7bxp/TnX3dfqbftL09o+rmg1mrd0QzRxLGpVSxuyxMeA5CrDFZZl+GtO7K1VLer+81rOLxN2agp6WT+tOr+7vRm4/Q7t1eryNCkyy6SKP2ivAcYlIOGN68sBgMuxlvbha0Vppbr0meIxOKsS2ZT5P9jY9TqO8+k6MXrRuu4ZNFLpotZ9CIkE6xzFQuJhCXGYG1+FaluGWTxPw6sutWq7mjw1PaUsXG17X2mjXw9Br3R3V/eDrjXz7ftHV0EMmmh92eTVRxxqSGAtdImNz5DxrZx+By3BQU52m6umiv7zyw+JxV+WzGfL/sY3devO7ez9RS9L7h1V/3iksUOeJImiLS2ykMYgberHCvaxluXXrPto2/Fo3u10eEwuYvFQnsOek2vrPd+8/REel1G6dYabUx6xmWP6SFGCMgu1w0K1p5fh8sxzahaapvv/U9sTdxeHo5T173+w/0rr+8/V/Ts/U23dcaPS6XTvMq6XUQLnkOnW7kBYiq34A3tXnjLeWYW8rMrLbdNKe/4TOxPF3YOamqL9t41vpHrnu91lubbNtXVUGn1CRNNLNqoolUBbYFljfE+Qrcx2W5dg4e0nbbVaaK/vPDD4rFX5bMZcpC6g657t9K77J07u3VpfWoEYvEkckTCX8pDNEpH4YVnhcty7E2ldhb0cNdzwmN7FYq1PYlPSbn1hunefo7Q6PcNy6s0Wog1UgRPpIlZlOW5DAxKCLY4c60sBYyzGTcIWmmt/8A3NjE3MXYipSmtO9/sedG7l3i682nV7ttvWuj0On0U7QBJ4FDyvGoY2KRMLEG2OHlUY+1lmCuKE7Tbarof+ow88XiIuUZpU/beNE2zuT3X3nedHsWk6qEeu1WpESNLDCFBJscxVDdR4Wqxv5Rl9m27jt6Et9/v1mtDHYmclFS0s2DrLqvvP0JqNFBvnVOj1H8zVzp5tJFG6+ki980SEEXwtWrl+Cy3Gpu3ba2d+v72e2Jv4uw0pS173+xm5Nx70wdIx9ZHq7STbdPAmpTT+2hnVGOUen2QuPMXrxjZyuWJ+H9k9pOldzpM3cxite121Tn6DB9F9Q92u4Gt1236DrZNC+0Kmpmn1EQAu7EKgEcZJ54HC1e+YYXLsBFSnartaNH+rPPDXcTiXSM6U0mE3Lrru5s/VEvSh6pfXbpHrRo45AIvbklYhVsZFVQpJFswFe9vLsvu2Fe9nSLVd3QvAeUsViYXNjaq60HX7p91un903fZ973hk1+3QSrqYPbgfKwAwZowQTjyNZ2cny+/BTtwrGWp6esieOxNuTjKWlcRF3fuN3i0O07Pv8+7Nptn3rP/ACrWBdK7ye2SHuigstuBuByrC1leXTuStRhWUda06N7gMp4vFKKm5aHq1G8fV96X6Lg66XrnTJofpBq/5YIU94xMQoJvFkvje160Vbyz4r4b2L2q0ruV5amxtYv2XtdvRvfsjX+kOtO8PWu4ttm09W6eHUaeJpZZ9XFEqEKRZTlibx8PjetnHZfl2DhtzttqtNFf3nlh8Tir8tmM9PD/ALEHeuve73TfUDdNbl1Uja+IxhpIooXjb3fynM0Sm2OOF69MNlmXYi17WNvxfDXR4TC7i8VbnsOek2nrHce9fRUGm1u6daafVwaxjGkeliRshAucwaFeA4EGtTL7GWY2TjC001v/AO574m5i7CTlPXvf7Ejo/ce8/W2xarfNu640Wk0ulmkiSGfTKJJGhUM1ikRAGNrk8fhXnjrWWYO6rc7Tbe89GnwmVieLvwclNJL9t41fpfrvu/1hvH8j2zqqDSar23d5J4YVVQgv+YRufKtzGZZl2Et+0nbbXA3+9HhYxeKvS2YzoJ6o697u9Jb1/Id46pifVpGkvu6WGJo3Vyber2kI4Y4VOCy3LsVb9pC3o4W/3sX8XirMtmUtP7cBtfVW496ekto026bh1fpNRptYyoi6SJWkjLrnBN4VBw541qYGzleLuOELTTW/q6T2v3MXZgpSnoe9/sMdDbj3j690Ou3DbOvYdHFoJ/pWXVwr+o9g9gEhItY4kmpzG1lmBkoTsttquh/vZGGni8Qm43KU3/8AY0vSdy+7G4btp+n4OqxHrp9UNOrtBAoDZ8pJZYzgPIVv3Mny+3bdx29CVdb/AHmvHHYmUtnb014DY+supu9PQcmgXe+rdLqV3DONJLo4omW6WJzgwp44f11qZfg8sxqfs7TVNda/vPbE38Xh2tqeve/2MqNw71ydJR9ax9ZaU7a0H1P0gjQz5M+W9vZte44Zq8vY5X8T8P7J7VaV3Okz9pjPZe129HP0GJ6M6q7t9d7nrdp0HWcWhl2+AajUz6jTxhbFgoWyRMSb/svXvmGCy7AwU52m6umhvrZ54bEYrES2YzpTf/2ML1H193X6X3zV9P6/rBptVpHCNqIYoiklwCCpMYIwPMVsYXK8vxNpXY2qJ79f3nldxeJtTcHPSv23jburdf3p6R2vRbluHWUE+m1LhUOkjR5VLrms5aBbi3hWlgbOV4y5KELTTW/WnSe+Ini7EVKU9D3v9jzobXd4uudu1m67Z15DpINFMdL7eqiW8jqoc2yQnDEYk1jmFvLMFNQnZbbVdH+5lhp4u/FyjcpTf/2NL27uV3W3HeNLsWm6qtrtTqRp0aaKHKvqsbkRm6j4XtVheyjL7dt3Hb0JV0N/vNaGOxMpKKnp8BnutOpO8vQk+3x7z1dDMm4Bvp5NGEkX0WuGzwoRxrWy/CZZjU3btUpv1/eeuJv4uw0pT173+xmPr+9K9HwdYjrHSttj6f6j6URodQY2YgX/AEctweV68fZZW8S8P7J7VaV3Okz28WrXtdvRz9Biuiuqu7vXe46/bNt6zg0Mm3QCfUTanToFszBQuVIySb+PhXrmOCy7AwUp2m6umh/6mOFv4rESajOlN8x+49e93No6ol6Tl6qh1G5x6lNGs6wRe0zNlsy3jBAsb4i9etrLMuu2FfVukWq63XpMJ4vFQuezctNaGS623zvT0L9HqN56xhnh3J2j076MJIoZBchlaFOPzrxy/DZZjaq3aa2d+v7zPE3cXYptT173+xmNDuXebW9HHq+Dq7RttvtSzew0S/U5EcqSLRWvcYAnhXlcs5ZDE+wdp7VUuDpM4zxcrXtNtU5+gwfR3WXdjrfd59i2/qzT6OeDTNqZ9RqdOmVUBVcoyxk3JbD99bGYYDLsFbVydptVpof+p5YbE4nES2VOnGYzqrr7ut0lvWq2DXdXJPqdMEUaiKGL239xQyspKKwNjjfGvXCZZl+KtK7G1RPhf7zG9i8TZm4OelGyb3unfLp3pqDqnW9WaHUbY0UDtFHHGZ0EtrBlMAB/Njj+ytLD2crv33Zjbalp36aPCe1y5jLdtTc1T9uAX0ZvPeXrjQa7dNq6v0kMOgk9qWDUxomZmTP6QkTcBwJOBqcfh8swU4wnabct7/cYa5i78XKM9C/beNU27r/urvXUOl6Yi6r9jWbpMdIjPDGkaZQczkrHcYA3IxrevZXl9i07zt1UVXW69JrwxeJuT2FPS9BkeuuoO7nb3U6HS7h1t/MhrNOZIJNMgCqqNkIKtGpzYXvjXhl2Gy7HxcoWaUe7/uemJu4rDtKU66Nwx2r7i94tifYNXu28NFpN+ji1O2Mq6VzJCSAGHtg5eOObGvazleXXpSUIVcHR69D8JhPGYqCTlLylVatR/9ajUnczrWAy6DcN7O/aJXZU0W9QxbnCoBIyj6pHdbj+6wqruZLhJvajDYlvwbg/wtc5uwzC/FUctpb0kpLnIh6n6N3RxHvnb5Nv1BJvrOmNbLozjgW+k1X1MPyBWsPgsXa91fqt65FS/FHZl0mXxFifl2qcMG48zqhY2HoPdMdn66/leqf/AHeh6m0MmmFzxB1WkOoi+ZC0+Lxtr3tjaW/bkn+Gey+dj2GHn5FynBNU/FGq5kezdquuxENZtW1x9U7fa413T+qg3RLW4lNM7yAf9JBWcM5wrezOTty3ppwf4tHIzGWX3kqxW0t+LUujTzGn7dpdVot+2rQ6uFtHqk3DSA6fUo0b39+MBSj5SMfKt65JStSknVbL1aVqNaMWppPQ6rpLHfdu5fu6FaMKU6f0KkJicZtUSTb41zvc/wCQ+2+iJbZ98z9ldLKzu3t4SHE4Bl/hthjzrqClITNMHKA+rMSiC5OOHKgHc629a5peAHK+PLzoAt+WxLLYAjGxJvQHqxg51uQhGYA8GPLEW540A3LEc0iOyhwLo9yA1ziLY428KAZj2+R1MoltluMrcTl5eGPCgHgs8cV4zZWJAI4g+A5+dASIY3aNRrSfaYhoBcg+njY0Bt3QskGn666KmL+0I9820gY3yjVx3bDmK08xf6W72JeqzYwnv4dpdKOxfdfqNNP3H2TW6OUl32GL3XANwy6nUjmPC165zuVNSwc2vPfqxLfvFFxxEU/N62VrMshZfbUFXTK68yx4sG/0V15QDiu8amJxeS5uUOAscBceFARn1TB2jK44kDE3AtbDCxxoDwGexIkUPlysoGAtj8RQDaSe4VX03UWuBe3gL+NATmUqoBjX1ABQcBj58OdAPJGqRZbH3L2BIxFib4H5CgI+rZWhVwozBirBTxy81HH40AxIkqxB7HLcgKbggHG/woB+HAGWT0gW8bk3JBtQCS5MqvLdWDqSoHG7A86h6mCzn3WJIOv+nJArZ5Ono2DEE4DVT8DXIdylTCXP/Y/VRf8AeL38ez1sr/rJ3j6PjgIuj6+ZkcW4+0pZTw/Cuv3SkhumL6NlaPdIcoOZmyY2H5lYYXrNkbjPen9Q42nqe6kB9bGhuQeLMbfsrEiGsxWwT+zvGllsxCyobC2PrXhc1M9RnEz/AFEZm3XeWdRd9TK0yC5ANyLYVCPJljO/g9voLsRE+dP+4mZb42B0eh5Vx3dlfq8Y/T/NI6DOPcYfs9USssTF1EbYAm8XHE2t8K7E58hkSe4kYU44C3DkL/OgFOrLOiuDi35zfLbAXubcqAyV0Z8uQe1GcrLxJ4Yk3oCM6BJC+UFW9N28bXw8flQDU6lBcqBh4YmgGElkdm9tlUBbGwvYcMQfCgPTNJDckh0VfTILk4XuL+NASI9Q2USFSACcoFzhwF+NAeO0y55EC5HuqEm+Xn6hgbg0AzqJCYvbBKqVHvKP4mHMjkP66IFze8ur0I7Cdp9vhn/3f8qMuDWB/lchY8ORNcH3emnm2JS3Nv1zp81i1gbLfo+qVByac5GbB47FG5HDA2v867w5giN9ckxWVru1rg3sb4jjh8qAbOjlnd0LhGXFyb/+jz4eVANrpfadlkkusdwxxF7cl5XuaAlpGxUSMQpsTGBfA4cbniaAQEsB+YOxxJwOJ8scaA9ugy5xnBUZuRB+fjQCHd+KEiIEeqxt43Nr0A5FIVBaS7Z2JQLzoB9gQASM4IIXLci3HG1AWk71yM3Yn7eJT7USJt5XP/eYaKIYG4te1clkn/Z4xcP5mXuZfKWHwdSK67F0V1h1IrybB01uO6xNa+o0+nf2VF8M07ARqPMsK6PEY7D4f3tyMeN6eTWVNrDXbvkRb8HXqNjft5/KiB1d1f0906QB7+i+rG561ceA0+3iex8mYVp/VXc9xZuXOGmxH706cyZ7/A7PvLkY+HafJGvSMNJ2x2tfTF1D1lInEkxbNornxy/VTkYeKmopmN7dt2lwVuS59mPMya4SHn3H4ILrfQOxdxZtAQ/TXS+wdKhTaLU6fSfX6xjhYtqdwbUG/moWjyeNz3925c4HLZj92GyukfHuHu4Qh4KvllUwu+dS9RdRS7FquoN91W8zxbpEukfXzPNHHmyFlCcFBwuFAvW3DB2MNalG1BRTTrRU3P21mvO/cuyTnJyfDpN37mxS/wCdG155o5X1Eu2GyoAYxcLlYY3IX8flVPlEl9NlRato3Man8UvAb79xcsqbLsABXJNrJFlUg3vkuCv7arO6iXtJ8SNzOW9mPGTOwiR6foneSECM+tkdmUFr3hUWyrjhblWHebTiocXWTlWizLj6jl/ZswSdzJJEQKQNa0d0AOIbAA4r+/lV1n9Vgadk0ct04jlGO/Urp1xMuYMv0OnZY74Zgp4+F8Knu18ouNkZr798R2ruDJJB2bDLlBXQ6FXVlwKnKCLDgf6657K6PM/DIs8X8ouJGvfbskcWw9RvkyvJqonaVQSSBGRbKMcOPzra71Vd23xPpPHJ9EJHOO3Rgl7vq4QD/jdWyEpl9VnBChgCMcfGrjNarLnxLqNHB6cUuNk77g5GTqzRrm9D7ZHdPPM9r/GvHuv8s+0+o9M3974Dre7PLD2NEilVkTZYWIcYWNiwNvEE2NUdhJ5r9tlhcf6LwHJvt5iT/FW56hogZH250EnAi8iG9ud7Wq670/Lx7X7zQyj3r4jHdwX083d1gVB/4vSK7PGQLjKQSHGPH4VsZWmsuXEzyxbTxXhR0v7iZHj2rpwo2VTqpw68yuReXlheqfup5dziRvZz5MTNdls47aTslo2MutMZA4EAgHCxPCtbvBT45cUT1y35d+E4b2ikXU9zNvllC+57mpdSqi18j3C34Xrpc90YGS4uoqsv04heEy33ByMnV8C5vQ22RHJ/tZnAvyxrX7sfKvtPqPXNvfeA6/v80kXY1Zkyhl2bSkhhhlJUMDbmRzqiwqTzb7TLC78l4Ect+3iNB1Nu+oaIGR9vZBJwIvIh4edquO9Py8V6XUaWT+9fEYjrh4Ju8LhkvbX6VXZoyBcFSCVkGPHieNbOXJrLl2X+2g8cU08V4UdH+4t2j2/psq2RTqNQGHMjKv7ja9VHdTyrnEjeznVHwmf7Ol/8rJmWyHNrzEQOBANjhx4Vq59T49fZPXLvln4TkHYULL15qNS8SF20WpCsMAuYriAePC1X3eX5SnCivyr3/gY33bfTy90MpQHL9IshaMgY2IJDj1W/CssjTWA5THMHXEch1L7gmaPpfYijZFGusRzK+0Rhbwwql7re/nxdZv5v7uPGSewmY9B7i3ANrtRlIHggANxY/LlXn3l+bjxLpMsq9y+Mrv0RfVdytl1E8ccrR7uGbLgpKyG5HzxArq8x0YKdNHidRT4b38a751n7i5I/rem42UsyxzG2RhhmAPqIsePL51Sd1F4lx8KN/OX40TdN8Ht9iovYKpk2rSlCAFF/cXgF4Y1X4bTmzr5z6DZu/JeBGjfbkzPufVLgXH0+nBNhc3Y3x5cBVh3r8i3xs1sm8qXEaZv08h75xKxiZo9/0wQMpKlcyEBhxJy4fGt/DpfS/sM1rvzf2kY/ugPa7i9bCWVJWdHd5EULiY0wIvxAAuefGtnJHXB26KmjrPPHql+XGZXrZZW7Q9rpnngMafUqsCpYtmzXcMcTwAbDE41qZe19QxCSddH+x64lP4a34TtmpaaHsSjqVEkexxscwstiQWBAtxBONUEKPNvtllKvwXgOSfb5Gh6w1uoaMF226VVfgRdkN7edrVd96Pll2l1mhlHvvAQ+5rQTd2GUrj72kV2aMgA4EEhxjb8K9snTWXriZ5451xPhR1D7h3aPYtgKtkX62QMvMr7f9WFU3dX3tzi6zfzjyI8Zkux5c9udWwspOp1hjIHgtgcLX4V4d4qfGriR6ZZ8u/Cce7I2m7jtqZY0aT2dWAy4BSwtmUHjwt86vu8WjBUW+iuyz5jlHO9LwS9xYkZblYdMrs0ZAAJwJzj1Wx8qd3k1gvCxmbrf5DqnfdjF0PsxjbIF1kItwJX2WuBbyql7tfNT4n0m/mvuY8fUJ+3y7dJbyxwVtwcAgcggxuMeZwqO9HzEOLrGUe6lxlfOnb6ruXt8upjSdot8DMF9KsUnxtfzF7V1OK0YKVPM6ins6b6r53Wdk+4yWK/TUbKWcGdgMjcMAfURbG/AVQ9006XHxFlnL0xNq1A9rsP+gVjy7QpQgBQD7ota3nh8a04ac30+d1Hu/kvAc++3di+/dRPb/wCCizMRiSXNx4jhVl3q9zDj6jVyf3kuI0zunKZe5u5Qz5XSPUQqpy8FIUrmDXvarLJlTAxpvM1Md8xLjO0d/GaPo3ZCjZQNbGp5EqYWvYDyrnu7HzM+LrLPNvdR4xX2+MW6N3YgYfzGXKQMf92LG4xrHvRT4mHZ6yco91LjK99Jk6vuTtU2ojSZo95DNlwUsk2Nr/C9vlXU43RgpU0eJ1FPY031Xzjr/wBxcsXvdNxspZgszD0MMLgEZyLY34CqLuons3HxFjnL0xNu3ACPsQvsEJl2qIoQAoB90WsF88PjWla/7fT5z6DYn8l4DQvt0Zn3nqZgLj6OHM1hckufw4VY96/dW+N9Bq5N5cuI1LrAe/3omjmRJlg3fS2XhcBo2CknnbCt7AaMtVNHiPrNfEfNPtI6b9xksX0HTsbLmZtRMyeg8Ao/itbEHgMaqO6kXtXHwI3c5eiJndpVU7ETezljB2nUMDYKAfcbw+Qv+Na9/wD7dV85dB62/kvAzmP29u0nV27txttpzsRc3Li4xxFW3emnw8e0aWUe9fEax3qL6juJummfIyIkGQ2NwrIPzccQb/Ktzu/owcfCeGZe/kd17jNFF2c0cZj9tPo9vRYlUuFIVVFmFwMeZNc5lKbzOT4ZFpjX+kXEiJ9v4j/wnvTooVn1xzAAA39rmRiaz70fMQ4usxyj3cuM4d27eR+6WyKWEjJr5vXa4sAxUi/LAV0ebU+Bn2UVeD+Yjxm9fclM6bn09EWAibRzMB/EGD4kHwItVX3TX8ufGjczny48RiO6AcbN2jnkkhN9oiRYYky5QPbJYEkkqTwB/rrayVr22ISr5f7zxx1di12T/9f5uSmFpNQ8ZWQJK91vcqb48+VKNAZMZYkD0EDMYweNr4eWNAQJApjv7mUgi5UY4A3tb8KAkaB9RFPDqtNPJpZomDRyws0bqV4etCGvhyNRKKmqSSa3npJTcXVaGdc2Lud1xPufT+2btvA6j2ubW6SL6Tf9PDuhRXnRbpJqUeVGAOBVxY1UYrKMNsTlCOxKj0wbhuPzWk+Q3rGPvbUYye0qrykpbvDpN2+6yYHu7KLsANl0Ch3wa2fUY4+q586ru5zrgK+nLqNvP1TFfZXWV0QRshdbMFxyNxBwv+FdSUoGIs1h+mbZinjY8MOHnQEB1Ux4SZSCBdRjh4W4250B4s1shDZVAsBe7W5mgJkM4TOctmC3PHAgGxxvQHrvppCPcU57XWQcSeNATE9tbZTZzgzA4DyPwAoBp9THE6xshBAzC3gR87YUBBdjI62CkkmzNYhsb3N8cOdAbJ0Xp/8Axd0nGxPq33bVdy18oOqQHKOfiK0sy+Vu9iXqs2MH7+HaXSix/fHZYv8AOftvt+sg/mOl1ke2Qa3TtfLKku6yxupxBs6VyXdStrKrzi6NOT8KgtJfZ34+OtprQ0lyyZyjvbt+ybH3O3zZuntsj2na9LptA0W3wZjGhl0yO7LmJOLG/wAavu7mKuYrAQu3JbUntVfhaKvN7ELGKlCColTR4Dlcz3BdLtGeFgAWvb+yrwrSJcFAwXOThcm5APKgJEMMcnqKPJEoy+ocwB6gAOFADpFEyJ7LZjfMzAKeRGAva+FATWyTQxC97WBK8yDa3jjagF5AiHJcoZGKryFzzJ+FARzaUZzlSzFWXC1yRa3xoB50zOyqzHMpDA8D4EcKAjyxskV2bK9x6eNARXkzNkWMBgwBwtz/ABueVAWb+6WSWLrjpsSgpN/hxC6E+q51c4tbwrje5Cawlyv9R9COg7x09vGnm9bOA6x3/wAIrGUDF9dM0jkXy/orlseIJ512O6UUdRiujxl3TTm1/WFYMC2Fm4eB86zZG4z3YWJ2nqYZPza6P8yHAEte3gfCoEdZjNhzx7xpXjj91lkTKjguD615E0nqMomwb/KV3Td7E+3JPOyE/EnGoiebLCd+zMOi+xkhQmFthJQk3BJ0mhLBb3rjO66axeMT8/8ANI6DOaeww/Z6olao3ErREfpqTa4FgfA4V2Zz5JEMi52BsAto3+P7BQHrxqyIqt+a6r7nHEcaAUjZmKKuCvYMvEk/6RQA0KZ81yXMjEtyNwLA3w872oBjWSRliQgkCKBkFjxxI/A0B59NEwZliYsw/TJGA5Zgw4/OgIbAZwuRnP5JA/x5YcCaAUjXkKLfHC97qoI4eR5UBKeUBcblwfWoXgDzw54UB2/qzYOnl7B9uOo9v2OKHf8AddweHdt6XN70yAa4BW9Vh/ultbwrm8Djb1zNsRYlJuEIppbib2S4xOGtxwFq4l40m6vlOgd5ttOm7Ndqpy5f3/5UvtG4/wD0UWcg8OJsKpe70Us4xXDteuiwzZ1wFmvo+qVDMRQF7gqSMWNyPhfljau+OXJSahI0YSKRYj0cQLAcfiaAmK6uoexCygYX9RBPEG9ARphpQQXuUAJUDHHwIwtagPV1Cj0ouUZbhBgFIPG/woCC0wCgL6FIsDjYj/R5UA3cSSpdypWwY/wnjYmgJcUeb3CrhRGBc2+NwQPG9ASFQHKCgAIzZyb2w438r0AyzxqxCtma4zDkTfgPhQFxuuuqNx6b7EdjNdtEei+vk0ghh1Wu0MGsaFRpQ2fT/UJIkbEgAsovauGy7CQxOaYuM9qiepScU9O7SleI6TFX5WcHYcaVa3UnubldRWHqPqzq7qlVHUHUm57sIwpSLUaiRoRxFkhBES/ALXX4fA4fD+7txjwpKvLrKG7ibt3y5N+Hq1GkAfqqjPkykYgWBF+fwNbR4k2JMzMUbKEFy1uFj4DjegH1VTlUxixFwxNyLc7jwoB2KaGPU7IyOGZN5gzuDgpDL+6vK+n7OXE+gytvxlxo633gkVO8OzGMOs0abfldU4es2Kj+O3+iudyJVy6VfS/bgLPMH+qXgNy+49Sdp6c/UEca6yUleZugsMOHjetDup7y5xI2c58mJk+w+om/wNuzRQnUSafWSjTRsQgf9MELnItxvevLvLFPFwq6JpdJnlTfsZcZy7sw0s3c7UzFfbBi1hnDEMQxPAHjieY/dV13gosDThiaGW6cRymN7+ZV69cF8yDR6YslrWJBPM2/dWfdvTg1xsjNNF98SO0dfNJJ2R0paUozaHQGSSRbNgFv6cPhjyx41QZaks0fHIscX8muJGL+3eZz0/1EqIZ2g1aGEHAMTGTlDEWxPG9e/emK9tbq6VXWYZQ/Ekc27bSTajvEZpEEDnUa06lM4fISrAqDxPqIFwOHlVvm6UcuotOiNDRwVXivCyT9w1v8XaFC90/l8bMhHDM7c725Dwrz7r/LPtGebe+8B1bdmeTsMn6pRm2iIGR1swAfCw52A58ePxpbKSzZ9p9BvXNOC8BzP7d5P/E26RAl1/lxdja4DBwAeGGBIF/GrfvSv08e0aeUe9fEYvrybU6jvJEskA086bho1VPcWRSismVsbDEC+WtjLVGOW6HVbMuA8sU28Vq3UdE+4/DaOnMsv59VN6bH1AIuN/7RVR3U8u5xI3c58mJmeykrf5Za/ITaOXViIOMqge0MARe4Jvw4V4d4Evjo8S6T0y1/p5eE4l2YznuXoLSiQAasyyWH91hwJJuTbEcPG1dDn9PgpeArMu+YXhMj9w2HWWmXPmT+XxM8duF2bztwt4V4d2PlftM9M2994DrvUBkfsLFeUozbRpg8kgs35xywvbz48fjSYaizZ9pm/d+SXEjnH26zX6i3iAEuh0Ge9rgMHABvbDAkC/jVr3qX8iL9I08n94+Iw/Wc2p1HeiMSwDTTJuWkURl1kXIrLZuQN1F8v9dbWAUY5bodVsvgPHEtvFaqaUdB+5DDbenMkli88/ptxAVcb/2iqnup5VziRu5zqiZzs07N2q12VjZX1qxZhlAHtDAEXNib4itfPl+vj9npPXLn+ml4TlHYCQp1zqYPcM6vodQWcLgGVgQxHLnz51dd5lXCJ8KNDKtF7wMR3Yl1U/dSBH04gmik0aQL7iurpdcrG9hjxK1nkijHAaHVeMY49t4jVvHTvuHw6X2QpJ+fXZQLH1D2yb+XzFU3db38+LrN7OPdx4x3sE5PQm8AMcserlEYYWUXiubEX4njbhWPeVfqocS6TLKn/JkV/wCgJGh7j7KvuGZn3UpKoX8ys5DAjHxsceFdPmSrgp9kqML7+PGdV+46ef6vp3TvBlgEczw6kSD1tcZgVwtbDGqXupFbE2npqtBv5y3tRVDeeowy9i4vckCSJtOkDWAIzFkBHpsPmP21X4V/3Z0859Zs3l+iXEjnn23kjd+pUzNjpYy4y+ksJLAk+IBNhVl3rX8qD4X0Grk3ly4jVd1Yp34gd5QxfqHT2A/hDMBa54g+fjW7aX9q+wzwn839oi93WjHcbrGyHMunHuEjLh7Mdso5jz517ZD8lb8PSeeY/MSM911LE/ZTtgWBbM7hSBcAqjixblhgBxPyrSy1f3LEeDqPfFfK2jquoMsvYNf1Cjts6gu62IAkwsOdgML8ap4pLN/tdRvS04LwHLvt5kt1ZroVJeNtudmNrgMGWx4Yc7Vcd6V+mT9I0cof818RC7ky6rUd3IlfT+xNHqtEsSF1kUoCuVsbDEY5a9spUY5dodVSXAYYxt4nVTSjpH3HWGwbAVlsW1sgAsfUojve/wDaKqO6vvbnF1m9nHkR4yf2KcntxuYUnKmo1PthxlUXiF7EXwJ/CvHvEl8bDiXSZZY/5EvCcm7GSFO4bQ+4Zw+n1fuMFwupuCRjbHz41ed4lXBV4UaGVv8An8o73pl1M/cfTRPpxDJGmlTS/qKwdbjK5vYC54g/Ond9Rjgqp111GZNu/q3jqnf7Doraisli+tiUek+oe2T8uXL8Kpe7PzU+J9JvZt7qPGRvt5cjpTfVVjlTWAoGFlBMZJIbHjz8KnvQv58OLrGUP+XLjOBdJuYu5G3D3DM7b3kZVHFWlOZbY8sOPCunxmnBS7HUVNjRfXGdi+4+eYHpyBoMun/WaLUiQXZzbMpTC1gBY1Rd1Iqlx106NH+pY5y3WKNu1wZOwyl5AkibNFcgAgEsot6bA/EXv51o2/8At/ts95fJeA5p9uTkdQ77GCxzaG8gC3UkSLa55Wxt41a96l/Ig/S6jUyf3j4jTu5rSv3R3MCRXkbWwCNMLD8trlsCOZB+HCrHKKLAx3qM1MbX4h8Z237hMOj9mKy2La5FAsRmHtE/LlxH4Vzvdf5ifF1lpm3uo8Yj7eWb/Bm9gEhV1zZAwso/SxsceJ4+FO86/Uw4usZT7qXGcA6JlMHcfaR7hmZ94KSBV4q0hDLbHkbYHh510+PVcFLs9RU4bRfXGde+4+ecTdOadoMunAmaLVCQepiRmBTC1rDG9UfdSK2ZtPTo0FhnLe1FU0G6burJ2JQu4SRNngzEKCA2ZRb02HzHHjjWhYf920eczYuL9F4Dmv24M38+6iju2OiUyAKCpb3FtdvEC9qtO9a/kwfpdRqZP7x8RrXVMrwd6Z5fc9xjvGm/SQXOUlAQPG4+HGt3BKuWpegzXv6MV9pHTvuNmmXb9g05gy6U6iVk1QcD1hQMuTAgAY3NU/dSK2puumi0f6m9nLdIrcNh20MvYcl39t02aVsADb1HKPSQDgRjfHzxrWuv+76POR6wX6LwHJft4YjrHcUu1n2+QyAD0mxXLc8rY2q570L9Mn6Ro5R73wGu95WKdxt4kaYE2g9tBysotjY8fhhy8a28h+Th4TwzH38jvfcvVahO0GldNOZE1Ol0P1chYRtHmVTmyniWbiB41zeUQj9RdXqcqcJa41v4VaNxEP7flJ6M3cOwCvrpMnAnKI1uTbzvgT++s+87/UwpvdZjlK/lS4zgnb1iO6eyv7jMzbk4DqtyVLMGwPC4uDXS5ov0M+yVeEf6iPGb/wDcnf8Am/T5LjIuilAh/vHOTx5f08qqu6nup8ZuZz5ceIa7sSRv072iYgyPJtqMj2sCSkNyW5k+Hzr1yJUv4nt9bPPMH/Ltdk//0KOavuJuG4ajUx9U9P7B1TZ2/wCJ1egTTaw4m5+q0X08hPm1zzqo+jwh7i5O12ZVj92e0uShvfHyl7yEZ8ao+WNGNtru2G6u3uaHf+jZnASQ6aWHeNEGOAIjm+nnA+DNTZzG1qlburhTty5Y7UeZE7WEnrUoPgamuR0fOMxdA6LdiV6Z602HqIGzR7fLqG2vWDNhb2dcI1J/6Mhp9Ulb9/ZuQ4UvaR5YVfLEfBKfurkZcDew+SWjnMVvXQ3WPTv/ABG89M7lt2mH+41j6dvpyoHETRhojw/vVt4bMMNiPd3Iye9XTyPTzHhewl6z5cWvBo5dRjtjcnedlaF1H/eOi9V7qCs6EZjwr3xC/ly7L6GeVp+PHjXSd4+62GSTu3JLKV9ybZNE8lhe1pdQONuBrmu5tfgNPny6EXHeD5r7K6ytqRBGYNggUBYxiPOuqKQc+of3STl9sDIyjh4A25nGgGV+nkYoM0qD1ZQOHLGgE6iE+8IwM1kvGq2AsBhfiMDQCUj9Fx/CLZb3xucMPK1AO+2WfAkEXdiccTwv+2gFuyhLRoxkb0q48MTjfzNACQSRZT6JH4MrX4WFrHyx/CgIrgrIpV8jrwsLWIw5G3GgNs6C1BTrbpBpYrhOoNteRxa5/wCKjwHwrSzJ0wt1vzJeqzYwnv4dpdJZD7j94l0HdvoXfYdKmrj0W3aLXfSMfbLnT7hNIIy4vYHKQTbnwrlu6dv4jLbsK023JcVYpF3nk/Y4yEqV2UnyNlc+uOp5uteqdx6lbQDbG16QRnSpK0wDQRrEPUyre+W/CukyjLll+Gjh1LaUa6aU1tvrKjH4v4u87rVK00a9SoayQSDEy/l48rkcRf4+NWRphGlrqYibkWvwI/18aAkaZ5S0yFFUA5hjw8MONAPtLECochcpsua1geOF+WN6AaFgsjLlZs4yhQMoAvflhhQEdpGXOI2YZpGcKhtYMALXv8fjQDUcUuZfWLLjlve9uNrjG3lQEyOR5Be+Uh2zMOdj48aAJnRrR3yvmylccRaxoCCsRh1UILkZ5EDKBxBcXt8L3qHqfESizX3Ya+OfuBsUUdjHDsUUSSEhmb/itRjfjY8geFch3KkpYObX9R9ES97xJrERr5vWziGpjJ6E07+kmXctRlYHGwQC9/lXX7qKWGpmF6LUJukIYZ1YlQAeBytjXpJEV0MXsIVdo6o9BJbVxhTfgSxxrGhENZi+nIz/ADzRk2P66Bhf/aFTNaDKBmOrG+n6g3pWy4ayQBeXq9XyqFrPNlh+/msTV9uexMisY5U2Z4pVBBUAaPReoAYKDwtXG92pJ43GJbk/zSL/ADeLWHw79HqiVkiiEKq7OVViAW52/oK7EoCcXzrmjNgpIFuBt/roCLKXmEgUiMRvcE2vwGPxPKgGUMsTElmF7Z7HgRjiMKAmRMMxuAwaVnkOBNjw43/GgPVaJFIkZD6sBYXJ8/EUA+HJBZFzFeOY4kjD4YUBj4y7gvJGPzEhh+25+VAIVMpzFGUg3XNxt/poAYSMA4BUNdbC1s3+qgN+3LrrU7h232HoVNnjhHTur+pXdTqGdpGYan0tEyAAEz3uGOIqnw2UKzj7uM26u4ktmmqlN37O8WF7Hu5hYYfZpsOta69e54SxXfDVgdju0ukyAyxDaXJUALjtT4Y+A5mub7vSrm2Jju+N66LfNY0wNl8XqlLTJI6kH9GMsXEY5Hw43wrvDmCTGjGMqgRlICl2Frc+WJ42oD3I0EgY5pIGNsq44X8DQHskYcWj9JTgvw4Ww8qARkBsouEa7Aknnh+NARmiJztlJyKCzqQbMOP9dATjEgijkkUs4UlCgxAFyL2/HGgEJMio3svmlfDMcLcTgb4UA4HEqLm9JVcqsOPLjxxvQDSwHKr2Ga1zfG9vHCgLU92RPD2K7BQh1MKabPGFwZi2jS58bY41yGR1+qYzj/My+zL5PD8XUVj0+j1O5TJotBpZtfqHwGm0qPNIx4C0aKW/ZXWzkoLak0lvvQiijFydEqs3hO1XV6Qx6nfdvg6VgAJXV79qYdtGXiDkmYTN44IT5VWSzrDV2bbdx70IufOvF5zdWXXqVmlBek1HmenmG4to7f7VmbdOuZt91RHq03TehZ1ucbDV64wIMRxCNWPxWOu+7sqC37ktP3IbT/EifY4aHl3HLggvzSp0Dn+KujtEIxsHb/TTvACBr+pNXLuUpOGJ08Q08Ax5ZW8KfA4q773ENLetpQX3ntS50PibEPItJ8M25cypHmMXu3VW9dTT9Jru76OPS6PeYho9HotHp9Fp4FleP3CqaeNBiFW5a5r2jgrWGtXHbTrJOrbcm6J00ybPKWInelHapRPQkkkuQ3ju7oNw3TvHs+3bMkZ3jUabR/QmRrKZUzPd78AAPwqoyO7C3l0pXPJTlXiNzMISliko63Qz/WvQ/d/ruHQR72uy5NveSSKHSN7Nmew5ls2A8cK18BmOW4Jv2e3p39J64jDYq/Tapo8A90t0b3i6M2/W7Zskm1rptTJ7rCRklOe2XNHnsFuONxyxpi8wyzFzU7qk2uNctCLOGxdlOMKUZoI6e677Raxet9ZpNFqFWd9NaSX3UdpwxuyoVYXAJB5GrL4rCZrF4eLa0V1U1Gr7G9g2rrS10Od9Z9W7h15u77zuGj0+jm9pYhp9KGKhYxYXLkkn41ZYDBQwdr2cG2q10mtiL8r89qRnd47odUdQdJQ9HanT7edtjigh9+KJ0nZdPbJdi5W5IFyBjWrYyexYxDvxb2nXd0afAetzG3LltW3SiDobuTvvbzTa3R7Zt2k1ibkyOw1funJIgsCoR1Hxv+NTmOU2sc4uba2d6n7iMNjJ4dNRSdd8w2wdUbnsPUn+LYIoNVr0lmmlSZSIC0oJYEIQRxwsa2cTg4X7PsW2o0S0a9B5Wr8rc/aLSx3rnrXc+vdzi3HX7dp9G0MKwRx6XMVy8fUXJJNYZfl8MFb2INurrpMsTiZYiW1JJcRl9X3P6o1HRcfRM2l0H8pfTJo11QjYaho1OYXIfLfDjlrwjk9iOJ+ITltVrr0dB6PG3Ha9k6U5zXuiOt9f2/3N9z23SQayaaFoJdPqTJkKMQbn22U3BHO9bGYYCGNt7E20q10U6zzw2JlYltR08Yneurtz37qZ+rNdHp03EzwzJpoVIiAhsEUC5JHpxxvzrLD4KFix7GNdmjXDpMbl+Vy57R6zYuu+6W8dfaPQ6DcNt0OhTQO0l9L7mZnYW4uxsLDgK1cuye1gZSlCUnXfp1HtisbPEJKSSpvB0t3T6k6P2LVdObbpNBqNHO8r+5qY3MiGVQrZWR1BGFxcUxmTWcVdV2baapq1aPALGOuWYOEaUZqnR/UGv6T33T77t2mg1Or0ZfLpp7+2wcZTfKQRa+GNbmMwscVaduTaT3tZ4WLzszU1rRluuOr9z693SPdNy0Ol0DRQLDHHps5XKuPqLkknGvPL8BDBW9iDb010meJxMr8tqSS4jI6/ut1DuPRq9ESxbe21Lp49L9UsTrOY4iCLtny3Nhc5a17eTWYYn4hN7Va69GnwHpLG3JWvZulOcwXQ/Xm4dvtwm3PbtFBrZdTC2nkg1JkEZS4NzkZTcEXxvWxmGXwxttQm2knXRTrPPDYmViW1Gj4yPunWW6b31Seq9emnXcW1EU408KkQgxBQiAXJtYYm9+JrOxgrdmx7GNdmlOHSY3L8p3PaPWbP153P3jr6Pb9DuO36DQx6BndZNKJMzs1hcmRjYYcBWrl2UWsC5OEm9rfp1HtisbPEJKSSpvCemu6fU/SfT03TW16bQ6jQappmSWeJzMDOArZWV1HwuKYvJ7GJvK9NuqpqejR4BZx1y1BwjSjMD0R1PunQ28rvW26OHUzey8UkOp9xYyklr3yMp+HKtnH4KGMtezm2lWujXznlh78rE9qIvqbq3dOqOom6l3KPT6bWgwhIIVIiRYbZFsxJPDEk0wmChhrPsYVa069eki9fldnty1mz9c91N8632zRbTuG16DQx6VzMH03ul2YLlGLs1h8K1Mvya1gpucJSbe/TqPfE46d+KjJJU3iN0Z3N6o6K2nV7PtGl0E+m1kzTMdVGzSI7IFOUq64c7EVljsns4y4rk201vP8A0McPjblmLjGlGaTsu56nYN50++Qoh1m36oahEcsq+4GzWOVlax8jW/esxvW3bepqhrwm4SUlrTNk657j7z3D1Gjm3TSaPQw7ajrpdPpAwH6hGZmd2ZjiLDwrUy7LLWBi1Bt11tnvisXPENOVFTeNi1HdnftZ0QvSEm2bf/L000enO4KJPfMcZBuULZQ1+dvlWvDJbMMT8QpSrWtNFP3npLHzdr2VFQ1fo7rzee32r1us2aPR6iTcolinh1aM62U5gy5HUg8uNbWYZdaxsVG42qOug8sNip4dtxpp3x/pnd9Z1J3U6f3vcFii1e7b3BNqfaBWNWzAAKCTbgBavPF2Y2MDOEdUYNE2Zu5iIyetyNj7uSW7mdZogA/4NS6XJLH2Y8SPE15ZB8lb8PSZ5j8xI2Lr4xJ2T7XlsrXa5a5wvG2YAc8TbyrSy2rzPEftumxivlbRtqdLd49f0Rp+kiuyx7NNoooo1Y21DQsRJZ5bkA2Njh5VqPGZbbxTvePt1fFXVqPb2GLlZVvRs08JiOku1/dLo3cRumzHbY9VJE8MgmlEiZX4qym1+AIOI+de+MzjL8VDYubTVd6h52cDibMtqNEzHdUduu6Gu3PWdY7xHo59Ro4hq9Q8UsagJpQTlEa8bKt8OPxr2webYCMVYt1SehaH/FwnnfweJbdyVKrTyGk9b90t66+0Wi23cdt0Gji0MhkSTSCTNIxGW/rc5RhwH41u5fk9rAzlKEpNvfp1HhicdPEJKSSpvDfSXdDqbo3ZtX09tOn0E2l1EskhbVQuZVaVQpysrqLYXFx51ONyexi7quzbqt56NHgFjG3LMHCNKM13o/qTc+iN5j6h0Oki1GojWRTBP7gjdJBiD7bKbfOtrG4OGLtO1NtJ72vRxnjYvSsz246yX1T1ZuvWm/jf9wgh0+rWONYdLpkIREiIy/mLE48STUYLBW8Ja9lBtrTr16Sb9+V6e29ZsfWndbfestn0ux63adBpoNJJnafS+6XJjXKPzs2UW42rTwGTWsHcdyMpNvfp1HtiMdO/FRaSS3iH0V3K6m6E27X6HadJoZ9Nq5ffmOsjZmR8uX0lHXDnYg1nj8os4yalcbTW8/8AQxw+NuWE1GlHvmibfuuo2neYN+jRW1kOqGsjW7Kpkz+5bBg1ifA3qwuWYztu29TVDXjNxkpLXWpuXXHcjee4bbcd10mj26Db1k9iHSh8XktmLs7Mf4bDkK0cuyq1gVLYbblv8B74rFzxFNqipvGW/wA3t7/wWOijtmg+kOmGmXXESe8Ywc1yMxTN4G3yrx+iWvifiNqVa1pop+89Pj5+y9lRUNa6K623joHX6ncdog0uok10PsTQ6tGdCoYMDdWVgcPGtrMMvt42ChcbVHXQeOGxMsPLajTwmH3zfdw6h6k1XUWsihh3DXSrM8cAIjDJYKAGLHl4174fDRsWlajWiVNJ53bruTc3rZvnWfdHf+t9o0ezbhtOg0UGkkEhm03uFyVXKPzswUW42/GtDAZNawdx3ISk29+nUbOJx078VFpKm8QOju6O/wDQe363aNoi0Gog1cxnk+pid3RioX0lHXDC9iKyx2T2cZNTm2mlTQ/9DHD425Yi4xpR75om1bxqNl3nT77AiSarR6kauP8AMEMgbNa6kG1/Ag1YXbMblt23qaoa8JuMlJa06m2dc9zN67hS6GTddJotvg29XGm0+kD8ZCM7OzszHhgOArSy7K7WBTUG3ta2z3xWLniGtpJU3jO6ju7vr9FR9Gfy3bzom066Ya4rL72QNfFc2QN52+VeMclsrE/EbUq1rTRT95m8fN2vZUVDXOi+t956B1ut3DZYtLqX10Ig1MerRnQAMGBBVkIPzNbOPy61jYqNyqo66Dyw2Knh23GmnfMXr9/3bdep5ertRp0Xc59VHqykSskYePLly+q4GA53r2tYWFqz7FeSlQwndlOe29dam2dedyt+6+i2/T7rotFoINvZ5Yo9IH9buAGZmkZjwGAFamXZTawLk4Nty3/9D2xWMniKbSSpvE/R92t90PRTdHJtm3y6FtO2lTcGEplyOxJ9IbIWHLD5V5TySzPE/EOUq1rTRT95nHHzja9lRUNT6L6u3rojdpt32eHTTaiaB9PJHq1Z4yhYG/pZSCLcb1uY/A28Zb2LlUq10Hhh8RKxLajTwkHqfe9w6p6g1W/7vDDFrNcqmSKBSseWNcoC5ieQ5mvTCYaGGtq3CtFvmF667snJ62bdvvd7qHf+mNN0bLo9DDt8KQQzayMSPPKsFsgLSOwW9sbca0cPktmxiHfTbk66NFFXiRs3cdcuW1baVOce6C7pb50Vtut2vbNt0G4Q6uUys+pMgdGZcosUYBh5GmY5Naxs1OcpJrep1jDY6diLjFJ13zSdt3/W7Lv2l6o0ghGv0WpbURxSpeIvc3QpcHLjwBrfvYaF607Uq7LVOE1rd1wmprWnUlddde7319qtLr9402kgk26BodNHpEdFIc5iTmZibnzrxy/LreCi4226N10npicTO+9qVNG8dg7ukQ9P9nRGyljoYwktzcgpBgPLzqnyF1xGI7XWzdzFfy7XEf/R+cuq/wDe9SUKqfcdchxBN7DnQGNaMtaOYgwxk3IP76AXGsd3UflDC5K4WviKA2baureounCzdP8AUe5bM2Fk0eokiQ484wch+YrWxGCsYj3sIy40q8us9rWIuWvIk1xM2jbe4+4btue1p1P0x031TLLrNOi7jLoF0GvVmmQK/wBVt505Ygm93VgTxrQu5VG3CXsbk7eh6FLajq82e1zUNmGNcpL2kIy0rTSj178aHRvuvhmg7sQwyOZGXYNEHmJuLGfVWBFuJtewqs7mprAUfnvoRuZ+64n7K6yuh/MSrKpUWyNiGNvjXVlIQ2iZv05SPZVvUQccbXoBcYjDusZsBazW5XxA+IoCTK8PqcnMQpKgC18ef40BAJV8TkjJBEY5m/j4eNAPJFYKDcsWyLY+YFreN+VAekhI1axDM+BHL8ONAKtOVurKbqVZiMvEWJHGgG0WK5Ryfd4DiT58TQGz9EwZusukVHqz75t4KZcB/wASgxPwrRzT5S92JeqzZwXv7faj0o7d90MRPXGxxsqosfT8IBVsxsNTqPzGwsb1zncdUwMu3+WJb95NOJXZ62VsICACOzBhdSP6eddic+IdkZg2BLgGxviRzvQC1eUqAAji9mQ4Ww8eVAIMZjcJI3qkuYxx4KPTxoCSY42Ksy5SBY58Tj/ZQCyi5WUKbG6n4Hjhy40BB1OniZBYlStrhPzYc/6qASsLMcpLAuAS3MDC/HD50BNhRUCJG2XDAnhh5UAxKkrrIVYBiSQOAtje48xQHqKJV0r5wzZ0HmbMMSb+VQ9T4iVrLEfdPpoou4OxqDYNsEbFhyH1eoHG5rju48dnBzX/AJH0Iv8AvI64iPZ62cmZVPbrSKowTXagseJ4HC3HG1dmtaKGO6YHpNT/ADmARKWUEswtay5WBONqyZO4SdthEez9R+wGe+qjaW/IBiSaxMY6zG9MRqd627Li/uoSCtr+tamWozRL6zWJupeoHub/AFBNhjf0DlzqFrPNnf8AvdpUTt/2LK2AfZiT5X0eithfzNcX3YjTG4178/zSOhzl/p8OvR6ola2DPqMqSDLEozgeHlfxNdmc8SIwyxuGYWU3w4kYc7+VqAjywLmaRSSQP1F8R5nHnzoCMYAzxh2cKPV/s4nEm9AZFI41YFRe4ysVH44ftoD1442U3AUsbeoXthbA+VANT5EXMQ0aKvPhxAsKASsc0WNlcsTYk3yi/IXxtQCHfElypC8HxsD/AGUAoPlCquIQer4nG9AemFOIIL5blR4Hy+FEC3XeiFn7K9q5SiqRHtSXQ5sP5dIRgQLHhevn/d5f3nE8UvXR1Oav+32fs+qVEEcSZmka6f3svjjX0A5Y8RZCWMNgjDKwY4AYcOPCgFM7KyK5JFwCgGU38eONAesgDOLELmsCMOIJA8eVAMSRhWbOwVMVxx8wP7aAdikjJKSKF9JIZPLhYigJDlCqgNcAHMmXAi1v6qAg+1E6q6H9YHgcMKAlRiQhy7opkOJ44g8LjxoAkuUTIMx4ZebY/MXPhQFvu4+6Q7D2V7D67U9ObX1M2q2xE0Ee7e/LDpmXRxEt7MUkKyMQbWclRbhXD5ZhZ3syxdLkoLa/hpV6XutOngOkxl6MMJYrBSdN2ujRwNc5Xybun1zPG+ih30dPbaRb+WdPaeDadORbgRo0jdvIsxrpo5PhU9qUNt7825v8VVzFPLML7VFLZW9Gkeg0yeU6lxPNM2onckyyykyOwsb5mJJN/jVikoqi0I03pdWY724nUMv++DenlhzqQSIxKQ7uyqX9JPE3HmOF6AkFBLJ0/GLWbd4gWIzCwZL3UG5+ArzvOluXE+gyh5S40dO7zbxr+nu7uk33b5wut2zRaWWB3UFUNnGUg8QQxvjzrnshsQv5e7cl4sm0yzzG5K3idpPSkjCf559xJA/t6uHGzW+lTAAjAYc+HwvWyu7uDX8L5WeP1O+93mFp3w7gnKo1sCEkZc2lTMbDEDDnxp/j2C818o+p39/mML1Z3I6i6v2z+T7tqkeCCRJ3jEQjPuqGAOAGADVs4PKcPhZudtaWqa9w8r+MuXo7MnoNJCLHE3quwjRs4HI/A8qsa1NYhs2REETML2YlhxHwOFSD2SZZI8gA9Cli/A5sCT48aUAaZplIZs3tjAi1sSOFud7UYJ7oG031EKZI4wMrnE3vlNwL1inpowRpCjSp7ayMhvlcgZsBY3xPCpBGOnikVcvrlxxII4DgBfnU1A2G9xDmIDgAAJyI+NqECvazRJIGuyG5w4f3jfDC1AJVwsv6ikRkNkxwNjcXt5eFATIQI8UUe3/GoJzD/aP7sKgkDKuqbNYJHDYiNjcMePlTUDH6qOKEgRx8FPui+N7/AMOJqUBYgaUkocxKAsVPAHAA0qQPrpSxuLZmAEYvYA8xflSpIpNP+oxkdVZblgfPx4DhSooSZI43eH1nKUvHGFPFTwv+6oQGPcGbNfMgIyRnC+XHE8cDUgYnzSucsYiZiT4n9mFvhRAlQ5rrHLG2ckZBfgT4jzvUAJ39t/1SQMpbBbHMMLk3H76IDc2ojlWzRlVY2Pp5+I4VKBYbonsVs/UXTOz7/qN71Onk3fTtK2nhRCsfrZBYm9yAt8edcrmHeKeGvztKCey+Ut8NlkbttTctZtKfbtsiAqOpNYzKTmvFH+UWwsOBB5/srU/yq7/TXKz2+jx88RN9uOzaiRB/iXUxjN6i0CE2NgP4+RvjUrvXcX/GuVj6NHzyu3SGlWHuV05okcMuk3yGIy5Syn2p7XABBxteumx8q4Sb34PnRU4ZUvRXpdZtPdpX/wAzOtnLmRfpUxPEfpxjL5hR/bWtkPyVvw9J65j8xIz3XkLL2U7WR+5e0jlogpAJIkzNjfEX+d78K08uf9yxHg6j3xXytoxGn75dfpHpoIdZCy6eNIEzaZGzZFCgsSOOGNbMu72DbbcXpddbPJZnfSSrzC4++PcJRZ9ZCCAczvpUtwsDw5cah93sG/4XyhZlfW7zC9Z3l601ug1G267XR5dxikglYQKl43Uq1iBxN6yt5DhITUox0p117pEsxvSi4t6zlmliRQpJuDIVC/3bDx/AVcNmkkMEqqyOC3uXK5rWANuVSAXUWQxsA8j2BLYYA4D8eNqUAzH7wdhHmyqx4YYA+PlahBl4lXU50jjJfAys3gRa4AxPiawboZEGR1aHg8ji/ui2AubDLwrMgQ8UTGQSXLC2VGFrcBiQRwoBgDI7QSZVVSSLXub88aEHscQlEqFifAEXNuQ8sfOjA2zMmS4OVcvusCMLHEefzoCWgUtnhUZ+Vybtb+FTQkdknEpXTqPbLf7yS/Lwxt41AImohhWMOqL7pKhcSFIXAnjzogR4kMyxhb5s+VE4MCef4VJBJXTE2z8ASXHMjiD+2lQKbSsHRZGVR/Ab3wxOBH9dKk0JbpGICvuAKrgS5VvmvgPnUIDTkRn21coI/wAx58LAj4+VSBqds6qBCq5Vyq18LX8ufxogeQB4xaVWaI3HHLf4fC/GgJc2ZERjdUJA/KScrcQPOoQGTqozGVVCQoPrte4xwvjUpA6r2u7W7b3A0+867VbnLt42yeGJYoVW7+6rOScxNrWsKo84zeWBcIxjXaTfIb+BwSxCk26UOsf8uuxpIxHUmtBfGNPajwJOH/SHKqZd6rtPdrlZvfR4eeeTfbrs8seReo9SpIsCYUNjfj+bwBwou9dz+muVj6PHzyuncnpLTdE9RTdP6XWnXpHBDOupKhD+quYgi5AsfOunyzGvGWFda2atqnEVOLsKxccE6nUu7UTLsPZmNZAwj26Ie3lKqBkh9QBuQcLceXnVTkTrfxPb62buYe7tdk//0qOa/qjovdNTPHvfb7T6HUu7N/MOnNZLoWYgkFjp5/qYCb8hlqpeCxdv3N9vguRU/wAUdmXSbyxFifvLVOGD2eZ1Q3HsHQmvFti67k2liT/wPU2geAEngPq9GdREfiUWo+Lxtr3lhTW/bkn+Gey+dk+ww8/IubL3pr80armFT9tesDA+t2zboepNIoLJq9i1MO4oAeF107NIo/6S/GpjneFrszk7b3ricOd+LyMh5bfpWKU16LUujTzHO9TFqNJqfY18Umk1kY9WmlUxsrDDFXCkVaQnGa2otNb60o0pRcXRqjMjsKu+/wDT0atmzbpowEuAMv1EYwuDzrzxD/lT7L6DO15ceNdJYn7tnUd4HJcR32Dbx7hP5/1NTe1/Cue7or9B9t9CLTPfmfsrrKzSuGdVYAZxdQP4suFr38a6cpzyItGWVbe3mNyeJvbjQEpgts3puT+mBhjbgDjQEFszMolb15fUEN7NY0AhwYQw9w5RcOy8Th5+N7UA763jLBXV0xve4IvxvbkPGgHWmjaM2HuAWLMBwtxsL0AlpUi9v2gHBxve2Hn50A6knvAgZQbm7HiVHjagNr6EfN1n0XlK5Bvu2qVJwJOqivy4fKtLMvlbvYl6rNjB+/t9pdKO4/dc6DuBssishYbBHgMRf6vUX8r1z3cx/o5dt9CLbvD8wuz1sq+7JnAJNrASNfgTblz4+NdcUI3lVHAxJv6VbiTxzW440AqMoXJlW4NgQcLKeY8eVANyrJePP6AMMRwwx8xQEh8rrkdwZWHoa5HzxoBcbEqUe4a9s/EkXt5UA3NIVysFMljaMKeJx4n4UAwruz58rRpm/UcnFfAEjDGgJHrUX/MtyFe3jwxxoBJUxkgDLgM2U4CxxHha1APKqMiElYlVlOUczcEHCjBZb7uUUdf9OlBbN07GJlGGA1U4F/Hjxrke5vy1xf8Ak6kX3eD30Oz1s4lJaHt7pslwG1+oBBwOAIBvXXrWUkd0wHScjneYPbdspJDEnN6crEjG9jWTQeolbdOH2fqP2Cwtqo1lvjcFiCBfhUGMdZjOmJSN728Bjm91ASXuB615VMtCM0TesownUm+mMMG+oe5GAtlBNuNYrWebLKd/Ioh0H2DRGCZdifIwwBI0ugvy/bXH92fmcW/T/NIvs491Y7PVEqy5tIcq25tlsCw8+ddeUIlVKhcqg5xbxJPwoDyQSWYL6pWYZYR/Fw8L0A0spsEMbZc+Mn8N+WHH40BOU4qWNiMGUDyJN8fKgGCQX9yX0xIfShbDkb0A3qLtks4K4ZVtf04Y40A4B6bzJdiAqsfDHMbjwwoBkEZLMDYGwc4ciBiaAUAqrmBYs9wik2zW53ta1AOl1yBQwyOpz+IIvgOB40QLld6yv+RXaZUZLj+VgsDY3O1ScfLDma4TINOb4n7fro6bNPkLP2fVZTktmdmBGZAPcBJufH4iu7OZGH1X5lCggNy4WHPzvQCs0SyIQod/zMo4ADgfjjQCSwmdVRiQovIBe4+NsfKgGJJGz5QHiwOVb3uMLg0B6Ywqli5JJIsvC4PHGgJEWY2EhBisuU3v6udxagHZGZFyplL8jwv5fCgIfpQNK/pOYsTy44YHHEUBIMgCorssJt5DjY8LmgLUd5gT9v8A9vTKvthNIA6Zvyg6Nb8RztwFcnk2jM8WuH8xeY/5OxxdRU12VQ3uSG3Jjxw/Le/lXWFGbTsPSXVfUQH8n6f1+56bKL6qGF/aB4ktKwCAeZa1aeIzDDYfRduRi95vTya+Y2LOEvXvIg34NHLqNkfoQbddepOsOn+nHW5bTLqDuOsH+yINAJbHD+J1rU+rO77izcnwtezjyzo+RM9/gVD3tyMeCu0+SNekis/a7aXMqwb/ANYyqc0jTtFsukJFrZUT6mcg48Spt4U2cxu7tu0uBO5LlezHmYrhIbk5vwQXW+gjbhv2h3jW9Gpoeltr6a0ek3qIiDb/AHmkkzmNrzzzyyO5AXDha5wxr1+GnZs3Nq5K43F+VSi0PyUkkjyd6M5xpBRSe5Xnbek3PuzuGh2bvLsG67tH9Vtemj0Op10BUSXjjZwVEbYEYA2PGqjJbcruWzhDRJ7ST4Xwm7j5KGKUpaUqG+f5w9pZIjN/Ks6OVVwdujva+F1tyPhwGNVqyPMF/H+Jm19Qw3m8xLPeTta2VTo5GzEJlOhTAHxuQLCsFkOPX8X4ifqOG3uY593U696F6j6ZbbNh0g/mg1kU31Q0qwhI0ze4BILE5s1rWq1ybK8Xhr+3dfi0apWvFoNPHYuzdt7MFprvFfNBJCoZ1kORB60YYlBewB+Jxrp5FUmM6jKJIykisGAAJGIJswBI4calAejJcxRhU8SoFswucDjj40YPJ1a8bBFkYD8xU3xNuXwqEBcLmVQDZeAsMFI4m/PDlQHhkWICx9wlioUYrY+JuThb50BFKyO4dXxjH6bXFiAceIGFSQMaoNEQsgzJfMCARcnmPGiA6swmVgGCooyOt7DG2AFCQXT5nDMnoY/pXwGPgP7aVIJsKH22dm4IoWRcSMLhWB8fGoZI9qETSZGyZmexcg5spPO4J+QNRF1JegbCqzrMpuSpJQ2uTiCQPLwNSQSoEJjHthY81mYYC5twJw/11D0Ei5VjZCWIRVQ5kNy1/NbHC4qKgxwiiWJJGldGdcyZLWN+FwRyrIgzOWJYiyS3UC8JAAyhBiCLC9yOVedWZaDCxDJKbhZLECQEHAEk+Rr1MR8JK4c5lcMLKDiQQOFr4Y1FQMRSSxyyMQEJW7YW/NwF8ccaUAmSBXgjV2ABI9TXJA4twPCpB5qJ8iKkYQi/rY8QTyHHClCKm3bT073F3Ha9Nq9k2/dNRs13+jlhZhESHKv7YBGGa9+XG9aF/F4S3ccbkoqW7XX4TYt2b0o1inQzkfRHdotIV27djle7M0jI2bjcZmBPHiK8HmOA86J6/C4jeZITo7uzDGRHsm8Se4chCzFmHjYh8eA4GoeY5e/4ocn+gWGxO8zWegkkh7k9LpPGySpuqe6r4FXQkWbncHjWxmbTwlxrU4nnhdF6PGbb3czRdxOsr3k9zRpItzci8KAi2NrWtWvkDrgrfh6T1zH38jYe4it/kv20kjbL7WVMl/70LC/HEgitHK3TMsR+26e+L+Vtm5bF3a7WQ7TtWjm2oDV7fooIp1Ohit7scQViGOBuQbk/Oq/EZLj5XJSU9Db/AInqqbNvH4ZRScdKW8ZiHvL2qWFRHoZIYwCyxDb1Wx44LyNeEshx7emVftHosxw1NXMRt27q9sNVs24aePbvem1mimj08H0UeYPIjKmZuCkM17gm3GvWxkmPjdjJy0Jr+J75hdzDDODSWlreKgaUoJwnulJr/mIuuexF/hjXbyKBEnWtE6tJG17NcxsAT6QMR541CqSxmNyI2AKerKFl58DYg1JBImjPt5SimxHoIw4Xvf5VCJGoJGvkZQhXH04MMMPzeZowOtliLEuBZQcqYm/HmfLGgIshacgflVmDOF5E4DiBxNSQNzJKkWdiHuMknPhyJAt+FCRvTzgqsUZ9s/mBFxwPOhAsw+56guZMTKwwXHHjQEuCL1KtgYwSwjHEekG6448eHPnUMlEtoUEJna8pDFUxxKi97re4+NQnpJoRvRqUU3MbC2BsBYjh44nC9SQS4VvI5CBJLkZrC4Bte2AqGSSCmGRiFcMLsWwI/wBm174i1qioMd7ULPO/uMkaPlDxizDmTiPwrLSQZDSJD7QIlLBc3uIbBiTguOXgLeNYSrUlUMdqFI1JOYOVJCAjjkBF/wBlZrUQx2zuylMqKguYjcDEDEAm5saAjOJUmQZVFmsmHK978ThY0A4R731EjHNn/Nc+nAYHA8aAaUrpoMkeSR7Ws1wMcTzOIPOpoDN9N7V1hvI1q9K6TW6sKIzuQ0hKoA2b2/csR4G3zrVxV/D2qe2aW9Xnoetq3cnXYTe/Q2mLoruxKYyu2bvdkNlkd1AUEi2ZmA5+N8a1HmOAX8UOY9lhsQ9xk2PozuxE5k/lG7yvGL5TMTe3DDOQOA41j9Ry9qm1Hk/0J+FxO8znfVOg3zbtc8HUOk1Ok3QRq0sOruZMrj0tc3wI4Y1ZYa7auwUrTTjwajVuwnB0lVPhO9938Nm7TzKbxjRrH7dzYDJCQQOfDE+Vc73f99iF6XWyzzHyLXEf/9P5oTSD6ucgl1WVzmIxJucLeVASQ+WQNcFjcg39VsfHHjQC4nm07rqtLJJpZ4nXLqonKOpseDKQfPCoklJUelcJKbTqtDN303dXreHTxaTXbwOptuAypt3UOlg3WEgYYfVI7r4elxVbPJ8K3tQjsPfg3D1aLlRtrML9KSltLeklLp0mW2rqroPX7xszbr27j2bXfX6Vo9w6a182lQSrNGVZtHq/qoit8SFZMOFq8b+ExVu3L2d7aWy9FyKluP8Aijsvlqelq/YnNbVujqtMXTmdV0G6fdhIz93XOQJH/IdvWNhe2D6gX54VX9zpVwH25dCNrP1TFfZXWVrVxnBDZ1X1FiMThe37a6kpTIZ8roxYFiTzxA+fnQBYlcyqbqy+om/G/Hhx8qAjhkUh8xs+BYj8xH8XyoAkcXIcZghwYm9iOXLnQBc3K4BQbm5NqAQ7NdbEG5uqG5vfx/CgECSyqD+UHgQcfEnlQEmJpVVAUW2DKoPC/hbxoDZOh5cnWXSUcjZWXe9BiALqo1SY3x51o5n8pe7EvVZs4P38O1HpRYHvmun3jvJ0FtGtLybfuWm0Ok1vssFZ4ZdfMkmVwCQbHjXHd1MRKzlF+7GlYOTXGoJl/ndpXMfag9UlFPwyaOF9zNg2zpXrnf8Ap/ZI5I9q0J050keokMsgE0EcpzMQCfUxwrqMhx1zG4K3euU2pVrRUWhtaimzTDQw2JlbhqVNfEjS0Y+rMwW38Vzw4YVbmgIjmGZPX+U+lvLxwxHCgJokdlZhlLBbGx9TcAQB8KAYRZA6TAARnMrODcAqccON8aAmNIUS5FmkUEAre3A2AtztQEKRpV9vMpLuWx8VGHkMKATmZGDAZVOC3vcfjegJLEl5FaQHISkn8IXDG16AQzLYtgCwCorDjhhx4UAofryRoxzTFkEWNifUAbXsKh6nxErWWc+7V3j7h7DCSQYunYg2axsTq9SMt7eVcl3M+Un230IvO8Hv49nrZwbWT5+g9Lit018/pAxxQHh8663dRTQ1MwXRZD7rES2RVJYEDicrYV6SZitTF7CVfaOqBnsV1cZAtxIY4VhWohrMX04//fmiGA/XTMbYfmFTN6DKBsHVeoL9Qb2QQf8AiJBhjm5W8+FEebLGd/FEvbvsFqpSTCdhYM7GwB+j0BtbD9lcf3b0YvGL0/zSL7NtNiw/R6olXTISyB2AX8qZsbEnC3CuvKE9BGCr+YCwBPEX8Te/CgEPI3toQ4kDMyA25rb+goBlmaNMVxFhI3K340BLV3idhIvoJIVGF+I4X8Te9AGoz5CigsWW4wxYE42OHCgERh42eMhVKKVlxuAQOBOIoBE011Kkqo4ZRjzx5+fE0A1HJnLnPYn+A8xxHDnQCCzXuAOeW5vbz86A6ru3Sux7b2a6a6200epTqLedzk02vnMxaAwK2pWyxFbA/pL+2udwuaXrmb3cI6ezhFNaNNfF3ftFvewVuGAt31XalKj3t3c8B2Tu/qxJ2U7YF2GZf5ZmhwNh/LXxIHlXP93JVzjFfb9dFnmypl9j7PqlTY3c5nADq7AIb2uAL/ur6EcqMSO+e7hSz5SHHE3+FiKASXZmY8MxAZrc/wDTQD1ybG4zfmBuedAJzL6S6ZifUFJuSRhzNAOGX0AlyC2C87EfLwtxoBcS+pY0BwZQ0dgMfEXtxoBRcBGW1g1rhjh4c/KgGdQxChbg45lPLC2HO3woCKrAi4a5/wDZ2OBvYfLCgLmde7l0zo+xXYc9U7Lrt4EegU6LQaLWLoUMi6YYzymOZ8lm4IAb864fLlfuZpi1alGLT0tra0V0bKqlXfqdJinbjg7DuJyVNCTpubuh8xwY9yf5XYdI9G9OdJZb5NfHo/5lrgQcG+q3FtQQfNVWujeVq5767cnwV2I/dhs9JUfG7Hu4Rjw02nyyqa1vHVnVXU8qrv3Ue57yQVA02q1DtEBxGWK4jAPgFFq28PgrGH91CMeJKvLrPC7ibt3y5N8b6tRgbqiOoUKvNSfTgbVtVqeI1M1owtwb4rbhhb8PhQEzbGvqNkcAv7e86d2itgCGU2GHO1eOIVbcuJ9Bnb8pcaOzd1Nn0W/d5th2fctUdJod2g0sWp1F1Uxqwky5S2GLKBj41zeTX5WcsnOCq4tunIWuOtqeLUZOidDcP8jO3Wnnh0km96sTahWEWmOphDO0Y/UYDKfw5Vof5FjXFyUFRcD3dRsfTLCaTk68ZLfsj29aUq+5zx5CuaJdRGv+8wQXYMRfKeFYrvFjKeQuR7hP0yxXyuc5f3Q7bdK9GdOabX7Puc+q1mo166dklkjctG6O7EhFH5coFW+T5tiMXecbkUko13deg0sbg7dmCcXV1OGRCIe2t3yuSDhfDla2HOuiZWDk+kNswSQwsAb3sDjwON+WFEw0ESomTLmlJ/MwwynwVsfDnQDiRSPZJMpcvma2BIIwUD+ylaAYKe0RGAEkA9ZtYgHlfGpA5G6M+ChrZc4sVspwzLe1qgDc2WLUSJnK5Bdjwxw4YnGi0oDEyxkPa6qLZQxuGFzY4HC9SgRA7rKWjQCOQgLGTj8bfLwqSCRdpLvmZmTgz48zwHlUAymkEpLMkjBpCA2Wxyg4Y8bDEcqxkZIf/OoAYyMAR7LG/lYDxFGDHOoEqRliwsckYxItzNj41JBlYWi08d8RLlKsRYDMRbn5nGsXpJRAmWb2SylA4Fmjy442538eFZIgmgRPNDNHg62uyH1kcP2c6x3CSdGYZGeIiR2GbIQpsbnC9zy+dYOq0mSMXqIVEil0dVK3zX4WwsBwxPCvSL0GLRF1BkUOkbZGbKXk5HA2vcYH4VKIPUhd43c3uWHptcWAxzC/lzNKoCXkYvdgskRwTItvPAcrfHhSgALG6z/p5QiiRZQOItY0B1no3vhu3Suybb03Fsml1Ol0AkEOpkkdXIkkZ7MOGGblVFju79vFXZXXJpyp+4sMPmU7MFBJNI2uP7jN8OYN01pHs2DCWQEryNsbX8BWm+6lrz3yI9/rM/NQ+v3HbqqKz9N6U6gk2j9yUKAMR4k8v7Kf4pa/qOnEh9Zn5qOR9HayXW9yen9zlRTJrN8TUyqo9OeaUswHHAFj8qusfbUcHOC1KFORGhh5Vvxe/I2vu4jHuL1aAQxXSKzA2wzRR2AGOFuZ/qrXyB/ooeHpPXMffyM31/mPZTts4GUxMUVCMCQklifjlrSyyn1PEL9tw98V8pbNx0fZPt2m06Dc9X1BqFTUwQTy6kaiJYyJlWyjDAZja/8AZWjPP8Z7SUI21obWp7n+hsRy2xsKTlroZqTsf2/QRRHctRH7mYK7TxFmIu7HEZcFB5C1eEe8eMdXsrkZ6PK7C/i5zBdQdmug9q2TfN30u8an3dHt8up0qvPE4DxRsy2suIc/6K2MLn2LuXYQlBaZJPQ9/qPK9l1mEJSUtSKqRZArPmbOcThhc8eGN8a7JlIia2m9xA8CyNj6iBYgHHmeVY1JoRo4o0DcSy8IfzC1sSefHwrIgkssjMxNgjJliD8QcLsTh8MagDckPtG5UBpLe0WHE4Y+X4UTqBIdSVU2ZyTkBBsxPI+JtQC9SFUQPipm4jiBwvzOAP4UQYw3ttYgsb3zS3uMwv6beQqQY9yVKNCFHtXzvewPgBjzqSCQrNLZGzC4BEf8A4/vqATdKJGdLMc6XCIoFyfAL48KhkoyLZiXV5iGazeogA5hxNgMKgkgapSgY4w5z6k4k34ZRh8alEMl6VIkGZ1YG94rcl4YnCodSUeSs87ySKyLnbNEzrckCxH5efjRaANxBJdMkcuT3VZjdiMCTh+ym7UGUV4w0ay+62ZVBFiWUjzw5YcqwdSSNrYBiVicqGwHAWYYeeHjUwYaIL/poGizM1nEbHiDaxw4WrPXrMRmCOSQ+tyxUN61wJPK3P8ACjdAj1y8aqg9siLGVctjcf3hjeiB7GI3kjX2SQ90YEYqSMB+ygN16F7ma/t1JvEeg22DcY91eETNMzIVMOYAra4/j51WZllUMfs7Ta2a6uE28LjJYetFWp0//mM3v3bDpzRyRsoI/VkBDeGF/wAf31U/4pap5b5Ebn1mfmocT7jN1Gcz9N6ZFVR7SiSS7NzufnyFP8Utf1HyIfWZ+ajjXXnVur653tt61Wki0TnTR6VNPEWYLHHmsxLY3OYk1fZdgY4K17OLqqt6eErsTiHfnttU0HYe7N5enu0zCyGXRRqsZsALJDe/O9uVv3VSZDoxGIXpdbN/Mfd2uI//1KL6rUdrt01E6na9/wCjdYXbPJpdRDu2kJJuSY9R9POo+EjVUuOYWvJlbur0k7cuWO1H8KN/awk9alDipNcjo+cS3Qmj17g9L9abBv7Xuuj1Mz7Rrbnl7euWNCT4LIaj6pO17+xchwpe0jywq/wkLBRn7u5GXA/Ef4tHOYTeekeq+n9O7b303uO36fEx632C8LZv7s8YaMg+RrZw2Z4XEOlu5FverSX3XR8x5XcHetaZwaW/TRyrQakjRu4IAXAWAN8LDnW9Q1ibtICbptIy3I12myiwvcTITY35153vdy7L6DO2/GXGuksF91MIj7o6VAWa+w6Q5mPE/UaqykXrlu5Spl1PTfREuu8TrivsrrK4qCHVB4fqOcGN+JJJ5V1pRDrGzW9o5ka7Nz8L3wtegF+4BG6MCMCVK2vjyv5/CgI11JBI9vIgZAbm9luAeHHhQHuYuzSFSCy+q9iL4g4mgPbZmDKqlVuwsLEYcPnQCHFwLxqAn5QcQSb3bA/LGgHo1WRSzKSyWBN8OQ4edASVQZkRCFAXEkg8j+zxoDZOiNPH/jLpP9LORve2XZj/AA/Uxk2ArSzNfpLtfMl6rNjB+/h2o9KO9d+59HsvdvoTdp9PL9Jt2h0evmiiIZpY4dwmf05iMSotiRjXH91MPK/lN+1Gic3JKvpQWl8p0Gd3Vax1ub0qKTfgkzhncvftB1d1lu/UW0wz6fR65dOBHrFQSho4EiN/bdhYlMMcL10+R4CeBwcLFxpuNdK1aW3ulNmeKhisRK7BNJ018VDRvbZSEj9JAGIOPnVsaBF9mUO4EYC2JCjDGxwx8aAS91srRspuACMOHM+IoCSkrQuiEBgpBCgkA3N7kC9AOyzM07kenMVKxC5xH+14UA/qZfbUkMZVka6LYEpfn+2gF3UH12BkUeQFz8eIOFAY55Gl9YYXY5iLcgeC440BMhaP2gPUxc+jMQbc7/KgJMSX1GmYgZVmiIGBIOcG4NQ9TJWss794el9juXsDZ/cWbp+NgxGIH1eoBW2HxrlO56phJr030Iu8/db8ez1srhrosnSEUiuFtrZhIua2Ye0MpAtckc66vdKaOoxXR923WAAkDOCSxK4WOA8TWbG4GwqRtPU5D/l10d8znEAtw8T4VCIjrMXsIZ940iI/tO0qWdzkA9a8yKS1GUTP9SRIm67qEGH1EoVSMbZje/mahHmy033A6QQ9sft8Rmzs2zPJlsMqn6LQ2GNr2vYGuS7uqmLxb35/mkXuav8AkWF6PUiqN1QqXAw4nzOFwOVq60oiBNcSnIx9JLMHNxbGwBHlQEiCVbMrNcJ+U8xmHEC/K1AKeUwtCAlwwBXAWHC178wBQHs7FFjHvM5DFmlte17AYUAydQRpokK+rMbyBiON6AhyE+iVsfcPBcDgLAnE/hQHvtyMCREQQDb+HG4wAPjegHIYpVS9gv8AfPAH43oBz2WYoVAUuLH5eHD40B1Teur9m3DtP0z0TptLrI912TWyazU6l1jGmbMdS2WPK5b/ANcMCo4GqDC5Tdt5rdxjcdicdlLTtfw69FP4d8tb+PtzwMMOk9qLrXc3f3nbu7+khTsv2vA01iw2l2DsblDtb+o2uBc3rne7i/vGK0Ufjeuv3Frm7/QWPs+qVJWEIjFPTYD0PbkcK+gnKg0UblfSWuvJscB40BDbK7hSAVU5QTxwPEWOFAKIaRT+mM1gSP7xHjbxoD2/IWJINyqjgfjQCcwZBE10WNcy3vcsbXGHDj+ygHYZFV1LIy2TC2IbE2uKAU7Fsfbz5jmy8vK4HGgEvcxl1BUHDG1iMCTbz4ftoBllwDgZQbEILgZudsb40BaDvHGsfZrsMSCyybepKGzKLaGEW4+JrjchX91xr4fzM6DM3+iw64OpFYAi2cscWtmNrXt8K7I58laCGbW6mLTaLST6zUOCI9PpUad3JJsMiAm9/CsblyNuO1NqK326LnMoQc3SKbfBpN7HbXq4oNRvGh0nS2llIf39/wBXDtykcrRSN7zfBUNVbzvCt0tOV171uLnzrxfxG4stvJVmlBek1Hm18x6+x9vtsCtunWuq35wD72k6b0J9u/gNVrzCp+KxsOdR8Tjrvu7Kgt+5LT92FfWQ9jhoeVccnvRX5pU6CHrdb03qZ+mR0j09q9lSDd4hNNrtedbNqnZkCFwI4o4wuU/kXnzsK9o2r8bU3fmpVT0KOyo6Hq0tuvCzzlO25R9nFxo911b6EvAbd3a2fV9R93o9i0AQa3X6XSafTmQlVzFHkLMQDgADjVXkd+OHy53JaotvnNvMLbu4rZWt0Ef5C9drkkj3PRe4AQwM8ikXwGUgNy41K7y4TdT5ER9Jv765RxexPXSvI43LSOxXKGXUOpcDAYkXHwp/kuE3nyD6Ve31ymodVdrup+lND/N98lgl0UuqXTCSKcyMC+YqxVuFwDxrewOcYfFz2Lda0rqNfEYK5ZjtS1Voc3kKIzRe4yFzhbEE+ROGPnVoahIsyCNDKXRnUtc8BjwP7OFAIlFnSSJcQCFjBsxAGOPjY4XoBhJlzrnvG/EuLW9QsMb4WFGgIjyvPIyoZkC2BDDNYD05sbX5mpBJiUqshlQBWAUq5vwxsT48KgCp5Lup9jOhWwBtxHPgeF6JAxsaZpB7j2s1lj42v5c6lkCpdKFmZbh1Iva1jiDb8PjSoERRzxmN5HtAwxjHLzINAZQgxp7wYrJGTkKYEWxAv40JPVdD+Usrt6g+ILXFjiKigqOvFGfbOZQzALGtrFmYXBJBve9RUk8kVrLzWUKr3wuBxJ48D+zlRAc1UUVjJGxZRlJRVswv4nh+PyqE3uho8Y6cxs8CSRf3LenPcDNa1sRa9jSj3QMCVpiMs7emwY2IIHG5vfD4VlShA1J7ry2KrIWAysz2Jwvc8QOFr0BH1InjazR/po2VTmGItjby8xUp1Aymoj9sqj+213OHHHgpN+FuFKAdRBIsKKsgWTMSwwGHjhSoHnVY7Kys0jIVB4Zcbm9j40BY7oXqbtFoejtsg3/Q6N9+hhdN1SbSGSWWRHd0IcgghgwGB8jwrlMxweY3MTJ2pPYb0adC0KpcYW9hY2kppbW7oN2/xr2W+lhkOl0EXve2ZNKNHZlMlgS+VbEqCbnwqv8Ap2abTVXx13jY+JwdNS5BMnV/YxDG8uj21TGCi20QDZDbA2UmxvfH58DRYDNdW1L7weIwW8uQrT0KzHuB07LpUEcc+8xnTxWsqxmUlb+FlrrMxX6Sal5j6Cmw3vo0842ruYc3cbuBa6lIVC2GPojiuT+OHKvDI/krfE+lnrmHv58Zm+v5HHaTtX7wsxMrm391I2sPjYjCtLLEvqOIpwHvi3+ltV4RrTdh+ttRpYZV12ihE0cc0UDTOAA4DWawwIB8OP41lPvLhYyao9GjURHKrzW4Sv8AInrxmjaTc9GWU5s3vuShOHMDlzFY/wCS4TcT5CfpV/fXKY7deyfXGk02r3DUT6afS6DTyamZfqmZssQZmABGJyj9tetnvDhJzUUmm2lq3zC5ll6KbdNCrrOOSe1AEcSMBlvnGPG2BA8ORq+esrxcYdIzJHMzZg2VCcDhhgDhUA9lVGhFrXVQxcm5JwGFvjRAjyStmYToVJOUEWYjmTicRUgTM6yyxe2xlN81icQ2GAtyA8qLQB9FZZgwiaNIzmVWIawGGFvOoA5K49oLHGCqt6stiLEkYX8b0QMbKM8hBA08bAEx3w/EWqSBeo0y5YpFYeocCtrYYmw+PhRMljBgnDOYT7UaMLrzIwwHGhBlI1WRDjZbXFhje9iT8KEnqyq9zIXZgPb9xscoHCx5DCooKj5RHiLu4HqLNIwzNZQCACTfGo1EnpRljzJ/Ac0eOFiLrY+B5/vpUCxDE8EYDBJfVmULcm+OBGNRWjFBuD6YoFKSRyKD7sxt6SCCtyP6qOoQz77H9L3GVrkiNgScMbAm4P76ySIEzGULGC3vKv5s7Yg2vaw438KAZnj1CRi0YysC0lmBAtw/dwomCJHPGrPn9DlQGIxIN7sV86mgHFbMszjPK9wC635njfH8KEEkxLCt3VnCuGCcz4c+PGoJOwdpd67f7Uu+jrbTad9U0sMu0zamBtQoQK6yILBgDdgcR+0VRZ3Yxl3Y+Hbpp2qOm9QsMBcsQ2variOw6PrPsmyThNHt+jSJ2ijY6MAyIBfMpAJytc4GqOeX5oqeM3u69RYRxOD06EvAeDrDshNp1aXRbcolyytn0QzB8P7y3upPw/bR4DNYvRKX3h8Rg2tS5CtfcbcOn906s1+v6UjSHZPYgEJgj9sNIsY90hCF5+NdXldq9bw8Y3nWdX06Cnxc4TuN29COpd1Gc6Ps6sws/wDLFeTL5iFbA+XPCqnIl/NxFPP/AHm5mHkWq+af/9X5tasL9ZqMnryyOSeYOIsDzoBTABXQKqXBJa3E2wPy5UBkto6l6j6cuNg6g3DaXOBXSaiSOM2xs0YORh5EVrYjB2MQqXYRlxpPn1ntaxFy15EnHiZta9xtTuLIvVfSvTXV2BEmr1G3ro9aV521e3nTSfM5q01lMbfuLk7fApbUfuz2lyUNh45z95CM+Fqj5Y0H9rbtNu+67QItF1L0Zrm12l9uJJ4d70Dv7yZUIlGm1CKThfM9vOsLyx9qEtMLio9dbctXBtRfIjK28LOS0Sg6rekupm9/dKZR3dmgmzLJHsmiH07G4RXl1DBb+AueVVfcuNMvo/Pl0RNzvC64r7K6yvL5RJ6fXkF2N8QQORHOusKMfFkuABGWF85Fr4Cx+VARjdEaPOS7C1x/qoASAuS9xmUH1ccMMATQHhgyGyszA3YKTYHkDagCNly5h6VYgNcXucAOPnhQCzHmzEA3drgefw40AtIDE7LKl1K5VsSQDY+A+PzoB+KNRIxzgi+U3xsfgfjQGydGjUv1r0ksUkYz75t+XNc4/Ux8a0szVcJe7EvVZs4P39vtR6Udh+6h5P8AHvTyMQk0OxRoSuHDUai9rfPjXN9x6/BSr579WJb95PmY9nrZW2yMWBJsoBQcfn+2uxOfHhJGELk3COLsosBf8aASWEiAhLrJgrX9WYnC4tQHkaCV2jzFLCyrwta17X/oaA91CoHKixN7mxtYgWvfzHhQAI41swKrmsHB53XzFANNG3tRtiMbkMbkfDjx8KAciiRwAxLOtyinEgniL8cONAN/SKjKq5WeTD2zwN/PlQHjvkuPayvycXJwvexoCTBqApjZ2zMGVltxuCKPUCzf3bs8/cTp+ZMoibp+Jk9ROVhq5yLAj41yPc2VcNc/9j6EXveBUvQ7PWyvet08rdHwzyN6U10wRVtxMSgk3HE+NdbuopobpiejYml3SLJfMrZsbHgrHCs5EbjPen9PIdp6n9RKprI2a4A4Mwv+2sSIazFbBD728aWL1DNKgFrf31OGHlUz1GUTYOpY9QN33ZXKM6amUjkCwJAa9uONEebLMd+tSqdvOwsEtiybE7MwJOP0mgABrj+7Uq4nF9v80i+zhUs2Oz1RKpPMc/qtInErxHwwrryhDJnTMYxGt8pY4kZvKgHE0cSBs2KMAS3HH9nwoBpkLyCxz3N7E4X8BbwoB7IBIys1i2UB2N73OJHH8KAbdI0y5VBAxte2N/C1uNASTEhiD5wFUNmItiTjcg/hQEdCWyuVLsLpckj1G9rnGgHhIhkEJHrJF1WxHDlgKAbJjdjdrhSWsBiPj8qAjzE+1i//ANsvfEA2GAogy4/ec6mTsn2smjMaRIu1pjxuNtk5rytXAd3U3nGK3vH9dHU5t8hZXZ9UqaoYxMHZc4J4cMfC9d+csMCNFRuMjYotiSQ1wBjQDA0zoI3cYHAEG+I4DEYfOgPR+mAowYsbEi9yRf8AdQDOUEuFBX2+Jvax48/GgHRpcwcZiQ4JcNjcH48b0AlQ0T3ucoupAJvjQD0d1zN7gKsMB/T40B5KAB6YwL+sIcBg37fKgEtl9tWRrixVjwIuccOVAWz670/TWp7H9i9Z1duG7aTRpowdv/leminn1J+kRTEHnkjSFVC3zEN4WrhcreIjmeM9jGLrLXJtJKr3k2+LQdLjVaeDsO42qLcS06OF6Dhq9TdBbasg6c7bw62VQLbh1XrptzY//iunGl06/Ahq6b4PFXfeX2lvW4qP4pbUugp/iLMPItV4ZNy5lREfV9zuuNTH9Pp96GxbaRl/lmwwQ7VDlOFiukjjYj/pE1MMmwkZbThty35tzf4qkSzC+1sqWyt6PirmoaVmkkmk1Ms5nlkHqlkJZifEs2PPxqySUVRaEabdXViZVFgVjADXbLwGBH9BUgyOjKFdojF2WfdoEkJuFUFgCTaxFr15X9FuT4H0GdvylxnSu9W86zYO6eh3fbJfp9w23RaWSGWwb1gOoJHMFTa1c/kFmN7AOE1WMmyyzKbt4lSjrSRrB7y9ypA+Tc2xs2U6aPAA8rrwP7r1uLIsEv4Odnh9RxD/AIuYe/zh7lcP5k8V+AOkW9gMRinA8caj6HgfN5x9QxG/zGG6n7hdTdUbeNp3nWvNp4JEmMDRCO8ihgDcBcAGrZwmWYfDTc7caN6PAeV7F3Lq2ZPQaM7ZUVPbVg1iAeC3JNrnhwwqwNc9lV42gvIJo3UZiBmYE4cTiahMUGnLj0gqx4NmFjj++pBHmMilEdwozWZStzib43+FCCYiZJA6ERxXDSOv903sL8bGoJPZGBPtC7ODlZrC5tjfHnapQI0RZJg5R3NjaMm+bhj50IHgGklbUouSM/mtwN8AD8aEmSvGY0ZmuQAFZ1BuVvcX86woSRs8DmRkiV8rYRlSMwsCCAfD91ZECNXKpWOKI+2gJbKSMzH4iiDI0a5VuCSc13U3GIHnWRBk0nga8MRuMoZyGN7i2FvG4rChkNTaguzB4PbzISqHG/mb0SoGzG+5chUc3AJy3tck3w+VZGJKiU5FKuTkOYg4esG5sL3wtyoSTIkSUhWPtD+KZTY3wOI4kfGsW6EkVA2Sa5Gct6gBdWB5YDjhepIGNS8893Ugopski42BsDgcfjUrQCFEgzOhcMTb2zY+kHHjx/ZRkGYiVkVlY5gG9MRIUZRhwsRaoJIEzEoHH5Q7KAotYeZ51JBZbobsr031B0nse+bhu+pTVbtpmkmhiaMLGS7LZb8SoHPn5YVyeY94L2HxE7cYKkXu106C5w2Wwu21Ny1m0f8AL90jcoN81zOCc1zESQMLEADnz+Van+UYjzFznt9Jtecwk+3vpeZ4wOodZEgbH0xNgbDx5HnT/Kb6/wCNc4+kW/OZXvpKKOLr/YNCjZ4l3uKH38Qp9qbKGwP8Vq6jHybwk5U/gb5UVGHX86K9LrNo7qyqnc7q5kU3GlW6DiW9hARh41rZD8lb8PSe2Y/MSMx14EXst21H8UkzuLXNs6uWXHHC9aeWt/UsRxLqPfFL9LbNWg7y9xRFpooN0b24I1hi/QRlYIoUEkqbnDGt2WRYJttw0vTrPBZjfSXjDyd4e5aoL7i62GMh0qkeAP5OIrF5HgX/AA84WYYhbvMe6vu11zqtBqNv1+5yZNfHJDMxgVAY2UqwBCixN/Gs7eS4OE1KMdK06yJY+9KLTes5eh9tGYIDjlKcb2ub24VbPWaSAo/03uRul89jADcWt/Dhh8qiukkSxNgy29YuqOuXzwNSCPI0yRsxITMMwwvwucPwoQLjjLRo0QDSEEZgBx4nDgCBQEySRVAu/ulhdWPiMGGPjUIkgOrBlzZwFK3NxbiMMOFZEEiTPqmjWOH25I/Dj4/6ajUST4WRomztmFyzGwKgFePHAc6xaJQ28mnMipZSyqf1MpCki3E8MRxoqg8kmSOCRY0GnkYZXJtYC5GHxqaaSCAiepiWIbKcuOFvjwtWRBkYdRDEEGHvs2S2YiwuPLGsWqkoVLOUVE9oiNDYzkk3uRgL8qimkmpjZZAruM3tlmtYYC18QbfGsiB2FWYvdyHawa5wy+JJtfGgJSC9kKgstgDcggAgYHE38xUMHjRhNVlEpdFT9KTiwNr3bDlzonVAjyvNIghQKQLmRRhYk3vY/sokDGhSJEaVw1/zxEcx+HwwrIgymmjdCP1CEZTe3pBJNuNr4ViyRE5Le6qgKVjDMo9RJ+IsBUog652l7bbR13pN91u7bjNo/wCW6iCKGGJkBZZEZmZi2I4WHzqhzrNrmClBQintJ8xY4HBxxCk5OlDrjfb90gHJ/nmuUvcxpmisrMcLYYjiACfnhVKu9GI8xc5vvKbXnM8k+33pdojHHv2sjJFs1ojjcWP4XwqV3ov/ANNc5H0i35zK/dw+m9F0V1Hqdk2/VPuUWm00EyTOAGvMmYqclxgf2V1GV4yWLsK5JbLba5CpxdlWbjinVaDo/dj24une0CKQSNApDjG6lIThfHA1U5E28RiX6XWzczBUt2uI/9ajuq2jtxuWo1B2jrPcNi1ckrN9Dv2gLxjMxtl1ehMotfm0QqpeJx1ny7KuLftyo/uzpzSN5WcNPybji/SWjljXoI83bLq14RPs8Gi6y0kWLT9P6yHXmwxxhRhOvmGS9FneGi6XXK0/Ti4/i8n8Q+nXnphSa9FqXNr5jR9ZotZodQ2n3DRT6GZPzQaiNopBbhdZACfwqztXIXY7UGpLfTTXMac4Sg6STT4dBGbMAFACkghhz8h+2szEymwEL1BsBWNcw3TQMQcf/iY+PlevHEqtqfZfQz0suk48a6Tvv3XjUt3jdpY/aI2DbfchIPFG1K3PjwNc73QbeAVdHjPoRa58v1X2V1lcAULsLnM1mGS/DhcC39VdQUwPmAAI9wRsQR4i/KgAoSwb2yEOPnYeN+NqAWjEH2ycmFzhw4kA0A3O1mGfKGdbK4xJtyt5CgEJMqlJHb0xm4JWwDXsCKAf9xS1ljZXsp94eAuTfD99AR5tSwljQK+ZCSGJ/MCAbcMBQD6l3kDjA5M0hP5QeDW5YUBtnRU66frjoxpMxCb3t7cLkW1Md7cBWjmnyl7sS9Vmzg/f2+1HpR1n7qJXm7jbTJJZlOxQqFDC7D6iexNhx51znciW1gpv/wAj9WJb95FTER7PWyuiDThSA6wyEX4YY8MbYGuxOfPUORpY3ylEAzpe2XHHx40B7HG7IXja0YJBa/5fjQD8LxhVJjMmF7fxZrY4/KgGC8QkLNGc9goj+HhQC5JI5LBPQVPDlx4WxoBQLWUWC5bWe1yT43PCgERymNpGAVsy5RY+dqA9M7SCxiGZBcWIxF78BQCGcktYGxFlL2a3yoASNc6GwRfcVTfkcwqHqBbD7u09rr3pdCAobpqInKBcX1eoxwrlO58aYWfDPqReZ+/50ez1s4FuEav0Fo5FsV+vn9XjYYfurrFrRTQeh8RrXR6ZN3gGCNmINsPTlY2/0V6MjUmObLGybP1NmJXNq48McQWOHn8KwREdZjumoc2+aCygBp0yHhf1DA1M9KM46ORmx9XlE6g3pR+dZ3BQcBdRjb9tQtZ5ssb9xcNugewDkLeTp4lbW9R+j0PMVyPdyOzisWvT/NIvc2dbNh+j1RKmgBDgo8GNuJw4GutKIWrnKoKE5QS1zgKAWNU7ZrxhQykDHG1udvG1AIjvlAupsRdbX8xegPHN2Vm9FrXUeI48RzoBbzQOuKYG4z24G3D/AE0AqFo/by+0WUABXP7L+PEUA3ZpJGEROYi7LyJON7eHOgEplV3GDSi4OPIDHxoBEYUqJJZVCsLXtfMQOQF724UAxOIgre0AMw9MoNuPjyxogXF7v63L2G7UwS8V/lntgWYWXbpMTa1jXz/u7Kub4ldv10dTmypgLP2fVKmuHaMkEm65mvgbDjbnhX0A5YhTzMkSoAwQAF+TFuY+FAShN7iiVlfITmaK9/Te2GHCgG3mQxLHl9suAUjONmAPywoBhpVuxZuH95bYnxoCbdkQXIXIBkjXH4jx50AwQXGYLmJAZWGA8+PhQAykBE9uzg8bGwFuFqAcP8TuzFb2tjwXxtQDVmaMCIgNcMrYkjG4JNqAtN3bM3/L/wDb0jwgRJpBklsfUfoyx/Ywub1yOTV+qYver+YvcwosFY/bcKrjCxRQgI+IP4/CuuKIUwGJy2/uWsOHmfCpSqDZ9o6K6u39FfaOmNfrYQbnXCFo9Ki+LTS5Ix82rQxGaYXDuly5FPerWX3VV8xs2sFfuqsYNrfpRcr0GdfofRba2bqnrnZNoHCTQ6CR941SZeIaPRBo1PheQVrfVJ3PcWLk+F0tx/H43JE9vgow95djHgXjv8OjnMXu3+F9NJ0xD0frt13G+8xHX67dIIdMspZohF7MULysouDcsxJwwFe8XiJW5u+ox0Oii26aHWrdK+BHlNWlKKtuT06W6LkSqbn3b3PS7F3t2HetwhbU6HbY9BPqdOoDkxRlzYIcOOIFU2S2ZXsslCLo5bSrwm7j5qGLUnqVDf8A/PXtxJGZTs2odXIVgdHEWte4uOeONvn5VXf47jPPXKzZ+qWPN5iT/nr29bKv8t1bZmVcp0sdgDjckkCwrH/HMYv4lysy+qWPNfIaL3R7ldJdU9NnZ9n0cq6762HUHWPAkaIkebPZr5jmzW4CrTJsoxGFv+0uSWzRqlamnjsbavW9mK01K3BvaEmVBmJuhBLEX4WrqCpGkM7aj3XJSTlY4cTjbztUAfnDF2Rm/Pisx4/P99APicoVV41kK5szczfhiRa2FRQkbRZpJNR7khHpyI18QByt86kgmxxCeIsqkOigSNxsLWGAHKorQk9gUqtioCRAgyMLE/ADlejCJUbIFKgibKliDwUKLYeP4ViSRJJGYJALxnDO2GK/HEf0xrKhB7Hp4YLSOwlzNlcrYDwOBqG6kkTXwowvC91VsviOHpxw5G9TEhhp41JwYNZfSx9Izm45nHjUsgcjkhT3I1BDEllexbH538KEkR1mm9x5XObFWcftIvQEBIGs+cZXICxtfgoNSQZNlUpJkbMLBkJOQ4YG1QBl55TmKAZZhZ2HPy8KkE3SBlR1VlNwCyXA5cahkio1Dt7jSZMmVmjANsMLm2P4VDA6JBOszw/oyk3V1JPpJ4kHyqNQIvphhgzM2awDEgWvfjc87cb1kB19ORFHKEKocYlIN2A8zxqExQ23Zuie4W87Zptw2fatZqdokZvo5I5LI2VyrFFzDDMDfCtC/mOEs3HC5JKW6bFvDXpxrFOhnI+2PdQ5wm160Krk2eYKxbxF2x48a13nGB85ch6LA4jeY+nbfupAjCHY9Y5lORlGoUsOZsS4vw5H91HnGAeua5P9CVgsR5rNV6N+rh7hdK6dlySrvMKaiF7kh1ksyt8LEGtrMWnhLjWrZfQeOGTV6K4TY+7YkTul1dNGbu2lABPqsBAlrjHlWtkHyVvw9J7Zj8xIz3cMSydke17FsS7MCDxJjfKfjbjWlllFmWI/bdR7Yr5W0b5sfe3t/p9p2rQzbPONRt2i08Ml9LFb3IogpKtjhhx4+VV+I7v4udyUlNUbb1vU2bVvMrMYpOOpbxlou+3boRLk2vWRLYsIxo41xGOABsDXi+7mMr5SfhZms0sea+Qa3XvN0Dq9l1+mi2ueWbXaKaCHT/TxWDSoyqHa9hZmvcXrOx3fxcLsZOSomnre4zG5mViUGlHWt4p/+V0YhZLKFZieJ54V3D0lAiNI80xjzXWNTdDextiQDe1ATJGkCRu7Zxaxv/D8KgkEdoYypyyggFb8hmuRhhegPXaWWeG3ohDZvbvwP5b3ogSYIvcZoDeSTOTGxPEtz53qG6aQhSRssjoqhy5zEsLBbefjxo2ESkZAxGcMS1xFwBNrYnC3CsSRqaUx+7ZMhYnIR/C3DD5+IqUiGMrpFY+7JIHZRfJwPnc/0NKk0PdSkMsJ9pirMmdlwNjwa9sOFFUhmO08QOVSwYlrOg5Kb8yazIJpaKGcM4zFha4JYAE3HOoJGJTLLIEzFo0F4xa1gDwta3GgMcYD7/ru8YbMST/FUkE3ToAkal8x9QkU8PVwx+NQBPuyRhcmLwnAg5iMb8aAd0mf3BJmVXYta+F7jhRkolMpkkMbMIjmIBHqJvyN6VA6kkLSJCRcIgUSXYODiefhhWNGCMFdRqHndncspJt5Yg+QrICo4vfieRB6QP1JCLjNbAYCw4VFaAzvTvTXV3UDa6PpfQ6jVJpRH/MDC/tqM9xGH9QvexIrVxeLsYentmlWtK8562bNy5XYTe+bTF2z7pMUybRrY2ZLESS5VC8LElrfI1qSzjAr+OPIe6wWI81kqPtp3Shf3Rs2reSMFgDqFINuH8Vh/Q8qx+sYBqm2uT/Qn4LEeazn/VG3b9serl0e/aWXQ7osSvLDM2dvbcEhgQTcEcMassLftX4KVppx4DVu2523SaozsXeNJH6c7Ps9s6bejEAmxYpBcgfDjhVBkPv8T2utljmPu7XEf//X+bk2f6iXObhZmzN/1iQBQAje3NHPGWikRiY5ENjcXsRlIt+NHpVHqC0Opuum7k9aafTrpJN5fe9CBl/l29RRbnBhewyapJSo/wCiRVXcybCTltKCjLfhWD5Y0N2GYX4qjltLel4y/FUlf4p6I3MBOoe2+m08uGfcumtbPtkp8/Ym+qgJ+CrUfBYm17q+2t64lP8AEtmXST8TZn5dpLhi9nmdUSdu2DtzuO87Rqtj671mzamLXaZ12zqbbmS+SZGyLrdA08ZJ4AtGoPO1YXsRjLcJK5ZUlR6YS4PNnR8jZNu1h5yWzccdK0SXXGvQdM+7fSue7ISRyGk2LROq5gSCZ9Scp9XEGq7ueqYGnpy6EbefOuJ+yusrIoeyhmwRgGYchyA8K6kpR8lS4NrLmNlHA24ekWHjQCXOYXC5jiCMOPLAXoAQKbKQLkfnPMjEXuOGB+NANtGrAhwoZ1BDAYtbH1eFAeDSKrHPIwPG9xxA4jjQEENrIJFHqlVmIMaNnVgDb/VfxoDJtEkjKTGDMGwC3wGJ435UA7fKpZWzIoDMBiCDicb8reFAbF0WYm616JwyvJv23rFgMP8AiYz6r4itLMvlL3Yl6rNjCe/h2l0o7z3+6fk3/vL0VsGmli0f+INJo9K+qkTMkbza2ePPlFjgMSBXK908R7DLLt2WlQlJ04FFOheZ5Z9rjYQWjaSXK2cJ646Yk6I6p3PpabVpuz7a0Sy6+FDGrmSJJlspLWsGsca6jLMcsdh431HZUq6K11NrX4ClxuFeGuytt1pTT4Kmte2hmdyoeVls4e3BbAcP2VvmqY13eFpIyqhCcCb2ItwGGNrYUApDkTA3LghyDci+HlYnGgHfYUMrxrct+Z3HD543oBrg/uWyRt+VuGPEnz40BJLqykKC4Q8CRfj5XoBpRlDXYsrEFgLAKL8L0AFMpvc3a9he5tbDhxtQCRgcly394EgX/soB1Ig7QYEfqR8vBxxqJamStZaX7uZXl7jbMXFnTp2FSGN75dXqQT6TXKdzXXBy7b6EXfeBUvrs9bOGXD9vNOb3/wCN1HtkC98DfDhXWLWUsTA9JiNt6gMzsLXKXXL6wGsMC18L4Vk0TuEzQ5G2fqL3mK21KGLC12DHL8cahGMdZjOl7HetvDlsgkS5KAW9a88xtUy1GRN6qa/U+/BrXGoJfy9IrFGDLG9/i8/bb7e8wYLBsbqpuGuTotAbjw4jjzrke70q4zGdv80i9zVfp7HZ6kVVb0k2FiAPV/S/OuuKISALXzGzWB8B53H7qAcVclgL3JJSxHCx5GgPIxY2v7lzfNwthe3CgCWRXXBiWOGUkWJthw8DQCBGxQxlAWH+8U4XvhccfCgFFVhsIgxzAgqwsMfLjhbwoBgv7TkoQc2K3N+PhYceAtQEvTIWikkkjW75jzuBicOGFAONaKONY0Lql1h4WF/hfDG9Ab7u/bzVaPthtPciPddNLDu24/Qx7MYj7kTAzrnz5ipxh4W51VWc1jcx88HstOCrWuh6tzwm9cwDjhY4ja0SdKcu74DuneKKGDsT2szrZWfazKAAWLybY5JPzNcv3fdc4xTfpL8aLnNVTAWfB6pVIEFzEmDc3UYZRhhau9OYG5I0lsXBdbgyWxygnjYGgIurklijUQIVUmwljGKgDh5GgEwQOwkM8hBuMgDhjyxIxAtegHV0yxEOzHLiRcXJ8Rx53oB5VyqcyquVfSqjmSVvex+YoBBHq9KYEWCi+Bv+61AOsylSBcWIysP7RQCXxCqos4bBcDmFv24UAz7TSMJHf0x4LiPhY4igLk9zdj2zcuxvYVd86q0nTOii0Cz+9qIdRq5Zr6OJTHBBp1Ys6ixOZlXzriMtvXbWZYtwtu43LcaSWl63J6PAmdHi7cJ4SxtSUUlvN10blP8AQr4JO020Kiw6HqTrjUQm3uayWHZNESByig+pnYfGRTXR7OPu63btLgTuS5Xsx5mVO1hYbkp8dIrmq+c8PcXWaJlPSvS/T/SSgWjm0WiGq1a+B+q1x1D3tzXLWLyeFz3853OBypH7sNlctSfj5Q93GMOJVf3pVZrO89Sb71CS2+b3r93ZbZPq53lVTh+UZsqj4Ct7DYOxhlS1CMOJJGtdv3LvlycuN1MMwGUKgCsrDKuGIt5VsHkPQySxzbK4sQN405UMCQCpW2YLyv4V5X1W3LifQZQ8pcaOwd09ij6k707TsE+oGkXdtPpIBq7BihKyNwJGNxYC9c3k2I+HyyV1Kuy26cha4+37TFqFaVobOv257JE6Qv1Pqg0qG0XsoGYgesqCb2F/7a0/8qutNq2qcb8B7/R41ptEhvt42R3y/wA/1MSp+dViQsAcF/MbcQeINR/lV2nu1yj6PGvlHNe5HafQ9BdPafdYN6l3CbUa9NM0ckarnWRXfMAGPDLVrlOdyxt1wcKJKvQaeMwCw8FLarpOMyIi+w4XKjgEi2Jy2PHG5xxroEVxE/LIHSFirG/E2vzF/ChAmYLI+djwww/KPEX8/OpBPj05KZyqBQt1A5XwuTfhWLZNBErEsH9lGQG7KCbEgAD+ylAZTSy30iRBQgUl3te4NgBe3jfGsZLTUlMb1YLvZWEOOZ/FvVewBAw4camIYpJUjAUwlhytbFh43+PKjVRU9mgEoVs2CAiQNa1/PDjaiYI0gCKFzZnTG3Ig2thxF/hUkGOlJZMjBkyYxIAMBw4+dSgOaOOGOad9QCFMZCDhjcWFsf3UddwI8WOa5kQlPYs0rXNjY8FHnelSDxkE0pVoiHRSXBGBx4jnhxw50JDVMkuT2c2SI2f02J5AjhxogxGngX3nDpcyA5SeA/6uH4UYQ8dMFzQ5XCg4NjyOGFgL0qBUKiNZEljyWF8cGOONvEY0AkBBK0QWxdvS18AP9NATmKafIzBc2UhSRg1+NrY8rVjrBDVi7jMisFkJxByZRcWIHlUgzU5eTTGXKGXKLhSfyi2I5YDyrCOhmT1G9dI96+oelNm27pzT7TotRpNuEiwzSlw7CSRnIaxtgWPCqfG5BZxV13ZSab/2N2xmNyzBQSVEbPH9w/VIziTY9uYK3G8gOXxNsL+XCtV91rHnS5j2+sXd5EhPuJ6hRFL7Lt/1BYlB+qEwuQAA1zyF71D7q2PPlzE/WLm8jlHSet1Gq7kdOayTL7+u32PUSkglBJNMS1lHK7G1XGPgoYOcVqUGuRGjh5N3ovfl1m092GCdxutMP1Dp19sjmPZj4niDWvkPyVvw9LPTMffyMz145PZbtfK6qVV5PSARZVRwMDjfDE1p5al9TxC4uo98U/0lo2/R/bzsz6DR6+fqeeIaqGGYusSCPLKilQpLcSWtf4VpXO9FxTcY21obWt7h7xymLim5mUf7d9lCrGu/alXcmzvEtycWNlBHAXtjXku9VzX7Ncp6PJ4+cYTfewe07PtG9bxF1HqJRt2hm1MEckSABoY2fKSrAHNy/rr3w3eW5duwg7a8Zpa3uuh5XcqjCDltakVnRVbTe6q+pWBLEeNhicbDHwrrnoZSjEoXApGzGMBWtfgOB/GpB5NaVFRlK5RcxqbnDmbY1AH9NpzIoyhWW9m5lvhY86N0JQ7LmyZERGIvY3OazEYG3jzqAS9BLlM6pEqtIMijHEYC4tjaokqkpkickouWwYnKsxvhieNxxx48KhawxiBlhUEgymwvJYXta3Dh8jjWTVSB9lXURFVzR5rZVwuFHwHlUaiSN7axqwLgCQ2GW1rixPGwPjemsggu59SkFY3wdgPzHgOVZAjQwqZtOzg5FcZmbDgePnRkEuVBNOy6UELI1oDcgAWIuwt41CejSSNSXcRRyAsxKqs1uNri5JwqSBcmRYDpowUmNzbLZQTyufCo3SSGsQLxyMrMo8fSb1kQT306xOWSM2kxsLhRyHDiLedYpkiIYRDKt0JRrBZHwGOF7+N+VSAkMSMrhSVII48xhQExY1WLO+UrcMWtwt6gDxOPKoYI00pld7KGVktZARck2v8AP40SoDM6Uu8IjVUHtngua2bmCPE/OsJazJajOdGdyd57fS7sm27fptWm7tD9R9QWuhhDAFSv/SPGtHMcqt47Z221s11cJsYbGTw9dndOi/8AMP1T7ikbHtzRutwCZB6vDA/t/qqr/wAWw/nS5jb+sXd5D0f3EdQgyNPsmgVFUZADJ+bG+Y38eQFQ+6tjz5cw+sXN5HIOvOrtd1nu0m+a6CLTyvp49KmngzBBFHmt+YkknMScavMvwMMHaVuDbVa6eE0MTflfnty3jrXdZ82xdoJZcpDbahJQWsSkBACsMBbyqlyJfz8RTz+tm9mHu7XZP//QpBqujNm1eomPTPcHY9zdnYR7buRl2fVZiSQAupX2SfhKaqHmdy17+xOPDGlyP4fG/Cb6wcJ+7uRfBLxHz6Ocwu89C9YbFbVbn05rodIVzJuCw/U6RlP92eAyRW881e9jNcJfezC5Ha3m9mX3ZUfMeV3BX7SrKDpvrSuVVRpwmVL3fP6jmC4/EG54irA1QtZrYgWBAYWJ86Al7QQ+97MsmRA2v0qozG9/10uSMRYeQFed7RblxPoMrflLjXSWT+7PcY9R3cRogFWPp/RqjIQQ1ptViD865rufJSwFV576EXGfqmJp6K6ysgYJlFwCBYqOGYjCwFdSUoospcEMLjiGW4F+VvO1AI9wJcu2bM9yBjhxIN6AcBGXIGZVIuAQLsDwx+XjQDZWIBUv6lvc5bAG/ib8P66AAQrsyuWDtcop4k4m3G+PDGgEDMGOcGRixZQQAyEAjyv+NAO4H2nJVSUbMQLHEWPh42oBxWNgL3yHAixIv+ygNi6IYR9Y9JsztII97225jFyP+KjOW+PG3KtLMvlbvYl6rNnB+/h2l0lle9Or0+h73dudx1Wtj0Oh0Sbfq9TrJybRRx7hKXLHHCwvXG92bbu5RiIRTbk5JLdbcFQ6DOJqGPtSbolSvgkzh3d/dtm3/uR1Hu+x62LddDN9IdPuEBOR/a0sUbKMwH5CrC9q6Xu7h7mHwFu3ci4yVap6/KZUZvdhdxU5waadNK4kc1e7HKzsA4AduIOIIHxq6K0bi9N4jjCg/TdrFvG1sOdABQJK8mbHgjgX4cOWGFAeiXPkRgFW4BOONzc28L0A2zMzWtcXsqnE3vzHlQEj21Vi98TwwHq8OZoBKqRzsL2x8r2B5Y40AMBbICowJuCeeOF8BegGWRASSpzkGzcC3HG4tQD0bBHjBJzZ1F7EcW4Y3wNQ9TCLNfdvJJN3C6eMEX08cvT0eYOoXMRq5/VcXrku5rTwtyn9R9CL3vAqX49nrZxLVuF7f6SMgXG4ahcDwNuA8jXXJ6UUsFrNc6RbNu+nd73zkD/0WxrNqg3GPbRO02z9SCRi2XWRBPL1Go0GMdZjumpSu96ANYqs6BQTx9S0noRnHSZjrP3f8Rb7LCVFtRIMcT+UcrcqxWs82WN7+zJ/l72EjMLQsmxsJLqAHvo9BjYXwNuFch3baeLxej+P80i+zdfyLHZ6olVmCkkvipHO+HAY+I+FdeUJ6qBRcDIAPyNgDw8McaAesPzKQCxuOJJPCx54mgEqg9Sk2BwDYWwFAJkQRqmUWAOGH5TyxHwoDxX9IJ/OGCgHFbEWsOdAemQy5g2AYYr+Ys1uJNAKjQRxi5DMt8iEX/E4UA0gN/eZmWc+kjiBgQAtqAkFcyqrXyAA5b4i3LDzoDt+99RdP6vsF0h01od50rb5tu7yajXbEC3vRxZ9ay3uoFrSKbg865jCYO9HOr19wahKCSluN+L+58hdX8RbeXW7SktpSq1u7v7zpXeRlHZXtZES7yMdtZsouhvtj4AHADH8Kp+7v/b4r7Xro3820YCz9n1SosZvc5/dDWwAwFvjj/prvzljx2zq5ZxdhYi4PAg/1c6A8lIDW9sOihTYcL3vxPL8aAShdVId2IZv94BlUX42wP7qA8CoEsz3sSzczc8+eGFAPDIHLxvkBtb02sbfltwoBBlRWBOYNIQb2sMvDx5+NqABirqzKQzHCxLY/wAI8KAUZFyCzZgRYE4Y8bA0B57gjzsD6GW5bC5Knn/VQFpe9esg1XYv7fL+3G+m0HtupPqx0MIzHDAXFclkk08yxkd5/mZe5kqYOw+DqRVRSxX1AIRhYG4+OJJ/E11pRCw6xBc2YGQD1WAFr4njz8aAmaHQ67dJW0m3aOfctRIcNNpIZJ5f+iFjDEGvO9et2Y7VySit9tLpM4W5XHSKbfAqm8Htt1NpIon6gfb+joJVusu/6yLSSDha2nBec/8A3Oqx53h5Olrauv0IuS+9oj+I3Pp11Ks6QXpNJ8nlcxh972zYtpl6XXZuqoupdY27xNrdTptJPBBB7bRlRG+oCNLfHggtbnetiF69dtzdy37NUdKyTb0OtVHQuVnjO3bhKOxPaddNE0ufXyG3949t3Hdu7On27Z4M25a3T6NdvKt7bCXIxFnNrWy8b1VZDdhay9zm/FTlXiNvMYSnidmOtpEY9su8PuQ6n3J5J4s+WQ64Z4y2BsXYHHnY/Gs1nGXUpoo/R0GLwOK16eUeHbXu+JJZXm1LuVUM664EtkwUrmccL4c6fV8upTR90fA4rh5TUeqejevNn0X8w6sXVnbPqREksupEye42Yhguc4kBsbVu4LHYS/PZs02qV1U0Hhfw962qzrSu+aTk95gIZvasoKOcRgeBvhywtVjqNUjezNGbLNFLKx/3bgrdmY4/Lj4VNQNmNpYivsLEI75kzYM/ja3GgHGkjSNldhcWDFeOIxtcY0oD2NVAzqFChRdlNgBxvf4caAkadwuUJHnzsQrlmC4m4wOHHwqGgmI1KO5eWVm91crK54hb8hbH50RIubVRCORYpBKqsBGMuL3OJI5WolvhjD6lQwzIEUMDzBIwsbXxFSkRUaeQtK1mugHqIOF+XG9qkE3R+yUkXUOES14bcmHLN41jKu4ER9Uw930AyMOHI8cQScalAix662YZGRSTniHIXxFTQipJhjLPcj0gYIwsLNwA43P7qhki4mUMI3UWT1BVNgtzhY2oCdJBHFKkry3lkUGHgLhvE3vhWNak0PBGHBBBFsuexJICm+B8KN0FBtolVSVT6goq5l5sTew5YDxBqagj+3GAZWILMPyg343stvjU1IoetIkkqxAAuq3W49AuOPDywtUUB5GsSHEBCpuubG5BxItzxqQSBLKYpYkjIRjlU5rkC17geGHCoppqTUsJ0Po+zUnR22anqE6Ft7EL/wA1i1EricSxu59KAi2ZbWtxwrlcynmSxMo2q7FfFolTSv3lvhVhPZJzptbpug0/YxdJFMp2qKKYxkRe4yyAy2VcwJutr+VuPKtDazbaa8bR1GxTBUroPH23sNG8M7naosoKB/ekBZcL3DPiTcWJorubvR43IidjBLeKudGvCvcPpd9KpSMb3E0INyPZ96ygY3N1wrrsem8Jcrr2Hy0KXDP+dGnndZtndYAdxuti8KlBESJOBv7UdvjxxrWyL5K3xdZ65j8xLjM71wSezPawuglKCZHJFsFUjz4WtWnlq/uWI8B7Yr5W14SFpu2HdjU7fp1T3vo3iifTaN9bZfaNmWwJyiwxt+GNess4y+M3Wlaur2TBYHEuK3uMnntv3jlaFpp9QzRktHfXA5CwykH12xHyt86wWb5aq0p93/Qy+CxT3+Ux269ve60Wm1U+uXWy7dpdM8usH1ilfaQMXVlD4jLc2F69bOaZfKSUaVb0aN1+AwnhMSk260S3zlSiPLHHG5BzgMeYJHG3D8aunrNERJp5UbM+sjwChWK+nKoJtcf1VCYGwszExvp0jeQA+4rEAIRe3DhUg9iywjK4QYtZceHlyxprAmP25DnQBrsWuePzOGGOFAPowV3YKZGUAMoZsGF+J4UBImV5vbEgIg4IgPpFxe97X58qxWgljcE8UcUcZmBcoRNmXFSL2A5G9S1pBHGpJjU+2EuDdyMuN+Rvx8qmhFREk+dYfabE29IvgOdwakD2lKiUZiBBwmt6jbz+FQ9QQ7rDCoCxOXQGyc+BNip+PIVEeEMxo1bRSAGNomUAeJPgflesqVIHkvOysoK5zY5sAXHEseQpqJH2tHJlyqElsMo4the5wqECa2nhlgSZ5MsKsABgSCMQMfHyFqxrR0JoeqAzA24+pCSTe4tiPG1AIGnQBUDEsTYKxuRlXE+Z+PyqaihGMayG7qIMh9MRNrYfmIuR8r1NSKHjyxLGqkEpIxsFGJAxxPnx+FKADGiyetVF7ZnH5bcALDlQEmKdo3vFHmAW7HMQDa2AHjhgahqpKZ1jtRpe3mpG+jro6ZdbDLC+3JrXZEaJlYSBQCAxDEG3wNUWdzxsdj4atHWtN/cN/AKw9r2uvcOu6PR9imWf2P5XF7LtC0ksjgvYXJQubMCOB/dVHOebqldp107hYRWCddQn+X9iNVp1lYbXlfJKJGmkDKTbKB6hwuLqPnUu5m8XTxuRft4RsYJqugrN3PHTI6p3FelPbfZRDphpngYtE0xjBkIJJ511eVe3+Hj7fy6vXvV0FPjPZ+0fs/JOm91i0mydoWaNZS21RB3YEYgQi/l48aq8iVL2I7f7zbzD3drsn//R+bOqjVdTPdixMjkyccLnjQE7Z9/3zYnWbYN51u0TXPuHR6mSEE8gVRgD868MRhbOIVLsIzXCk+k9bV+5adYSceJ0NvbuJuWsRV6o2LY+sMLPLuGhSHVkDw1WkOnmvbmSb1XrJbVv3E52uzJ7P3ZbUeY2vqE5+8jGfGtP3o0Y6dX2s3a/1Wy9RdG6hgA2o27UQ7vpVw/9hqhp5gB4CU1lsY+1qlC6vSTty5Y1j+FGO1hZ64yhxPaXI6PnJm19BbTr922bUdN9wun9+ji1+ldtv1jS7Nr8iTIWCw61RGz2BwSUk8BXliMynbtSV2zOPivSqTjqe7HSvDE9LWEjKcdi5F6VofivXvPRzm5fdBLHN3UZ9KjLAdj0AVT+ZT7k/LiL+eNV3cyn05U8+XUbXeGvxenzV1lemRVa+csxx9wY2FuJrqykEg5gALM1znF7/CgF5QFGYXcfw8L88L+VAOXYlWW6oo/KQB8jQDZJJyLIcp4gDEC3L+ugEq7FwAAC/Cxtw8ud6A9DYm8YCgfkJwHjbzoBfuRgEuWwX0k/3iDzPwoCOpU5bsyp/FZrgi/E2tQG39D2/wAY9IKD+md928AWA/8AiYz+3nWjmfyl7sS9Vmzgvf2+1HpR2n7ndSidwNjVWChNihAY4gk6nUHG/h51zfcf5KfbfqxLfvJ8zHs9bK4lwrt+II8eNvheuyOfEmXEZ2yZmNuVgeVAFlZJAAXwwdbkYfuoDwuHWyxhyF/M7XONrngKAX6DGrIPUx/Lhy8b0A06Hitxc2a3HgeA8MaAdFsoNiBwGUngPC9Aes3EAWAsT5/PlQCbA2AIynEg3DXv/XQATeQktcC9rnG5PLl+NAeRwsWUH0+tRjj/ABDD40eoItJ928LR9wOmIiQZF6ciZmvbH6ue1/wrku50aYa5/wCzqRe94HW9Hs9bK66zUn/B0emdMrfXTMrC5v8ApqT8LV1m6UsdTMT0ZIIt0jIF2YlMF5MrDhWbFdDFdP6j/unqgZWIk1catdfFif6qxIhrMV0/IkO8aWQ/lSVCfSThnUVM9RlBmwdRtJPu28SFPbB1MrBc2N7kAcvwpE82WZ+4KAnoLsHKrDJJ0+xRR/8AgmhJF+Fch3ajTE4uvn/mkX2butmx2eqJVPIQHDDLmwFz4ftrrihHLkoGzXZbn1HDhw5D8aA8vY4H1cWIGF7Y2BoBdwQDlK388KAZdWLAAWIsCMbEXuL0AoLlyj+EH1HAm/xJoAfIHZVRXVAcxOAoD0MJJQ2VvSpuoOYXJwwAAoBJdEB9YXG2S+NvOgFiU2Ia5FyVIHytQHjyiPTtdgpf8b+A4m1vCpWsFt+8MiSdke1cigK9trFsDY/y2QYjGvn3d1/3jFfb9dHVZsv7fZ+z6pUJ8nqJdhJc3K4Ejma+gHKnsbxZmEl/UBYXBucOXnQCzIGF7FiVv6ja3jbzoBJdghcr+XB2zWzE+YoDxWYC4IUpxtwN+JP4UA4MzKQr3Y87C+HLHlQAxDFQynDi9gBjwH7aAQwYElQLcif7eFAJJUl7Esl8FGOFx+6gFFCgGQl817IMQD8aAtr1z08Op+ynZGKHctq2dtt0SSbjuO862PSacK+lAGQtd5GuPyopbmRXCZbi44fNcX4spNvVFOT18i8NDpsXYldwNjSkkt103OfwHEP5J222kj+a9ca/qnUILNoemduaOHxsdbuJiv8AFYWrpviMbd8i0oLfnLT92FfWKb2WHh5U3LgiuuVOgS3VnSO3+2vT3bjR5kHo3DqPVS7rIMcD7K/Tae/kUIqHgMRd97flTeglBcvjS50SsTah5Fpccm5c2iPMQdw7idb62F9Km/TbZtzLYbbtSx7dpwPDJpFiBHxvWdnJsHaltezUpedKs5csqmNzMMRNU22lvLxVyRoaOzLJLK5YyMxBZrlmJwvdjibVZ8BpkpUyHZHWXJk3jTuvPLZlvYDjhXne0wlxPoMoeUuNHWu8O+6rpru9o980Bj+s2rSaWeGJ1BW5R1Ibh+YE38q53IsPHEZc7c9Um0WeYXHaxSlHWkjGj7gutpFcxw6AgkED2DdQCLi4YfCvX/GcIvO5TD6te4OQWvf/AK0wVU24G+GeE3NuItmF/Gn+M4X0uUfVr3AYLq3unvXWW2R7RuP0300M8eolSGPIxkQMAL3OADVt4HJrODuOcK1pTTvHjiMdcvx2Zajmr6IRezJmlN0LNlxAxuB5VaKRqNEmSbM0bhmuxULlGPC5uRbHCiQqDAkqxjI91WCtYC555b3sb4UBBeCwiZzcWJVQbKTc3Bw5CpBLRoQgiAziM3UL/tDhhieNQwPQzIthclGWzxgDIuU/xE24VDRKGtQzT+4zkAZgwuMDlIuVHhapSoRWoiZIX04WBVhmb1lbXBF8SD+8U3QQQ4aRxKmRFsFnsDZr+BHLwqSBaqyyOc2ZpQCLHLccPw8qEjoMuWMBAyhcoUYXte5J5UAmScLOA5KHNf3AM2VgOFhxwpQCVjhkX0sULXZluCLW4k3oBuITwSXQ2Qr6Hve9+Nsf2U1gmoI2yZXCuqnKQBZ74kYmxxqAS8ra2WOGQNFKGGQgnFRibfv44Vi/FROsVDpnimJzOofMLMBlHn4nxo3VCgJMWZrKXe+XLawJIOGBtxtUtAZ/Vb0DKDnN0AAt/wBIeNSQMR+2kjO5u0QJKk4nKOHD8KkHsksTySvhHmIIkItl5cBzqFoQHY9UohfIpMoGQtlxYA4kfjalBU7p0l2LTqjp3auoZ99bTHeNO0o06QhvauzIMb48L8vDDjXM47vH8NflaUK7Lpr1lrh8r9rbU9qlTYB9uMIv/wCKHYg+r/hgMB/1zY+Na3+WP+nz/wCh6/RvS5j2X7cBK8Yj6nWNc1iX0pNwQAL2fje9P8t0abfP/oPou9LmOC9KQHR9xumIs4vot+hhZxjfJPkaw8DXR497eEuPfg3zFZh1S9Fel1m292Mj9yet4y63XTi624foxXF/gbmtXIfkrfE+lnrmPzEjM9cNfsp2rV5AWZ5UJIxayuCMbGwtWpl2jM8R4Oo98V8pa8JG0/f/AKzjTTaaOLQONNFHDZoLl8ihQzEEYm2NZy7tYWTb8bS66zFZreSS0aBxO/8A1qosyaAMB6i8JA8m/MPDx/so+7OFfnco+q3lvBre+XVW4bdq9t1R0KHcIZNPKY4cp9uRCjFTmNjjWVru5hrc1NV0NPXuoieZ3ZRcXTScabSCWFplLrZkVY1N+AxNqvHLSV9NA/7gXT5MzWhLcQM2HD4DypugUbvGGKFxHlzM4wA5Zrk4E0BFmgz+8xYqhYXsQCAb48DUoC4faRShygzAq6g4i3O/KoekD6TIjZkzRsGDe2oJdgeeNvhUUqB2WX3Cka2WNQQxH5Rc2INuONEqEtkaBdOImV0USgCNZbDE8lI+POpdSEY/1xtFE8YltcubcB42I41JAsqCYpEkDInpQgZbEjAfHlehI8DKA+UAXIZj+ZuBsL86ATPKURfcjtgbxg3sCcT+NAefoyszGRi1sqyYXY4WFjYjCgGXieKTPCcwD2ka9wLeV7XoQTAyyBveezlhmkAxUjgSeNQSSi7e37EoJhN8sowF8bXtcYX5caim6SLfQPA6HPLeNULMOZ54m9gKhSqGhyWQrL7ZNyASuQYcLjhjhRagxqR3zsQojzr6FsMzAnAgk4+dSgRJEAkVZWsSARiAOQwwrIgdllido1yAiLMlrYHHjfmMPlUJA90+ojV7ZvetZ45LYA4gD50aqEzp3bvtke40G7a2bcztybXPFD7SxB2kMilyeItYDw/dVNm2cfAOEdmu0m+Q3sFgfiU3WlDpB+3CAM1uqHAN2jQ6YYEngfXiB8BVSu9j/p8/+huvJvS5j2T7ckaIpH1LZrH1Ppr2N/8Ap8LXou9m/b5x9G9LmOB9xekP8Gb5qenjrV15i00M41SqYwRMpYDIScQcONdHluOWMsq7TZq2qcRV4rDuxNwrU6n3UkV+n+zWeUXl2uK/pxb0QAtyOB4VUZGqX8T2+tm7mHu7XZ/cf//Sonq9D2w3SbWyaPe+oOk9U0rX0+7aWLcdIDc4DUaNopbfGI1Uu7mFnXCF1ei3CX3ZVj+I31DC3NUpQfCtpcsaPmG27a73ronXpnd9k61RjcfybXRHUoq8jo9R7M9/EZDUfWrVv38Z2u1F7P3o7UecfTpy93KM+y9P3XRmp7ns+6bFOYN62zW7TqEvmTXQSwMbcCPcC8asLGJtYhVtTjNei0+g1Ltmdp0nFxfCqGOaVbXRuKg3JufiPjXueZkNiEa7zsBuFtuejIZmtdhqIzzAryv+7n2X0Mzt+XHjXSd7+6XSw6XuvMISzpLs2hkFuK/rakWucTXM9zFTL/ty6EXHeD5r7K6yt2XMdQzl+VmwsMMeBxrqykPMwaOSLODmNibD0KLH50A8vtrlIfMQLZyeNuB8qAeWVWAVTfMob1Hjx5UAgAlixLBrWMYJC2A4487caACFNnwtgAAScQeB+JoBmV0hC4FmZhdeJA8uVqAHJKor4KSc6cTfLccfKgGUjVifbJJDZSt7gE/voDdegIlPWfRkeoUvfe9uEoJP8WqjHyrSzL5S72JeqzYwfv4dpdKOx/dFpoZO4Wzvp5GOmOxoM7XvddVqEsMOAtXNdyEvgp01e0fREuO8lfiI181dLK6SIIlsZFxT0IxNyMPxrsjnyPkjlPqLC4y573sScbj4nnQDejLaeYo7+hrqGIsoJODUBO9kS6kqbpEFDe4ODFv4fl5UA1b22YxC8VrZf9rhceJvQA+YgZUuwOIGNzw4CgDNJY3YkLb3LnKAOXxFASCljnKhi4wsb28SCcCRQDQKZkys2cKwPEnj40AGRl9JZXBHptbHiKAVGgMsGRyf1EGY8hnHH5GolqZKLQ/d5Nl7lbNlIsvT0Kx3IwA1Wp4DhXKdznXCTfpvoRd5/wC/j2etlbtVIv8AhCOMoru2vnZGufQPZXhxHq8D4V1e6U0dRjejzbddOWswEgxY2ymzeoWHEedZsjcYbC6NtHUwAVidfGVBJwxazD4VBEdZjNiYJu+ld4/fVJUJibC/6i/3RektRnEz++y5d43n1K6vqpiGJtcFjY+VQjzZZ3v7+p2y+3wkksuySK/C5A0WhIP+uuR7u/OYten+aRe5r7ix2epFVswjODXvgScLW5f211xRAWJjYu/5lxVRe3hcDyNAKX22zZRnSwBJOAwGP4+FADh0MaKPWRcKGKnzuDegGCXbKfVIuFmsR58eFvCgHCzY5V/MCFPnxvhzxoD1dOjwyEMRMo9VuJPGxHnhQAZPb0l7BJZVsIuYY34Y8rUBAggFnklcktgq8CcON6AkoVvlzBAFIJduB8PC9hQC9RpS8bEPeQp6bXsaIFvu78OkXsX2vAzPqoztiShr2XNtkjkAeB41wHd2izfFU9P10dTm1fgLP2fVKeSQuzlrt7bZcpJvY88f3135yw0mRbsjEurABz/evagHpJcjrmW6s2Dcud78eFAOZFwAuQ35Te/I4DnQCyMCgNsoAd1Y344f1YUB7GxQD+6gwdjZjj++gENIjYA8VBykkjHgR8aAaORJY5FbOFBHtE4ZThegPEyySXMhkALWKixtf+qgPdPmVYwwZsrXCmwHzoC0HdnTafTdiuwuWQM00AkYk2x+hSwA+ZxHzrj8iX90xvH+Zl9mVfgsPxdRWG6xytlNr4upNxceddgUIsvGxWJWu7LdUuSW5YAYmnCDbtu7edZ7kkev0vT2rg25Lk67ccug0mU/xGfVmJLfA1W3s4wdp7LuJy3o+PLkjVm5by+/NVUGlvvxVyyoTf8ACHTO3yr/AIj7jbYz3bPoOnopd21C2/hMi+zpwcf/AGpry+oYi57nDypvzatrk8aX4TP4S1D3l1cUU5Pl0R5zGbq3SYXp6DpSPeUji3mMa7c96fTBpMzRhDHBpxaML6iQXYm4xFq2LaxGxN39nU6KKejQ9blrrxI8bjs7UVb2telyp0LVys37ulrNp0Xe7bdRv8CSbLpht8m5I6e4rRBCWDJY5he1wap8njcnlco234z2qcZu45xji05atFTon+POx8i+6NFoGR8qFvoLYA+nDKCMcMB+zGqv6bmuraf3v2/bhNv4rB7y5Caevuy7lV9rQuSVQKNBjj/1cAOeNYfTMzW6/vGXxeE3lyHPO6/UPbfc+mzpenNPo/562sgcT6fSiJliUN7gMgUXGIwvxq1yXB461f2rzexR63XTuaDTx97Dzt0tpbVd44JDNC0bxe4c6k+wzY+gfmx4YE10zWkqqmPl08vuRskgIRg7C1rEnE/O1ZVIJVpJLGZM0QfKgvYBbY2B86gBrvbkWKUNguOAsWuPDlakQyHJE0WaxF5LFABa4NgPIY1NSByKNrH3pLSflcHC4U/1W50qSZKJdMoDxSB55AVKeRIswuKwdSVQjNCwOWTPGWIxvZL3tbA4AVlUihFm00kTWkLFlYjIDezWthfja9E6gakjksRKuRbXQq2YlbcSfLjapAlXlRTEXtZSqhl8MbYXwoQSY3CvHK2IY2CtbEnAlTbC/hQkahjWWUlr2hjzObDCxAIbh40bCJYZYVYZELAkZbqRfw8cSeVRrARe1K9wgCqP03BykC5F7AkigDTsyOheZi6Mxie/EhhgQfCjQMjqHh1CxRxF1jsxIAGDA+r4erHDjWEU0ZNkNI9RCn6TBmlxUpjmN+XPGstG6YjyyCQzF8HuRlsDfC5wtgcOZqKUJMdLEhdoxJmdh7mZgDa4/LfxrJMgimKRiyxOXjTKsjWtg3IHlUkDkSxQoql7lWylSb3t/ZQG57V/mNLt2m/kce8vs8LMNG+l90Qj12YIV4jMbG3O9aN54NTftNjaeutKmxb9ts+LtU4DNRaPvAzSMkfUEmRyWkzTAhr3IxIJxx/bWu7mXrQ9jmPRRxPpc4+sHdqBHvo+o5S5AbGZnXnewJPLlT2mXPdt8w2cStyXOat0cJP8e9KrIRE7b1phI0mBVvdF1IwPlW1mD/S3H6D6Dyw3vY9pdJt/dJ1buP1whjUSLGRGbi5HtR38rf11q5F8lb4utntmHzE+MyXXbMvZjtSQVkMn1De4ORytYfIm3yrVy3/ssT4D2xXytrwnSNl637KR7Ttelk0OiOq0ekgGoRtB6veWIBySVAYk3uSfjVTfy/M3ck1J0bf8W5U27eJwiik0qpbxmYuv+yghQJFoEjILBDoDyxwBS9z514PLM0rrf3j0WLwdNS5CLvXV/ZyfZNeF0mhkmm0U66KMaIe77jRsEIOX0tmPEm9euHy/M43Ytt0qq+NopXSY3cThHB0SrR7hUjRzRRZEmc5WX9UXuA/Bf21281XUUEWN6qB5M2SQZm9OW3EC5thxsaVApBqPbEf5o1jvIAeJH5bmjoCRIsT6V4lIQgY4flJxPDjeoVakmOERKpMrZVF1DEY5rjjasqmJ7CkhYNI5jTB4TyAJt/VhQkyEEeksC8oWSIqY1uTdr/lPj41i2yaIJUdmMjK6o35ShGCnxt+HCiYZEm0rhM3uH25EuvqNmXgb+fKpTIoMFJSoOTLE1/USMwJ4DLhapA2jPBirFULBsRexFxxHMUA8t2DZmFozixAyFb3AIIwx5mgCXLqZY0Cn9Z0CqADe4ABBpqQJSqkTcFIth+W5thiDfgb3vUATnjmZV9pCGILi+Xxy487geFAesMsrBpXMJCYA/lueRPGgMp9RGdMUDP73oV2AGK3snHjwPwrDZ0mVdBBWBonaSN7hLKCfzKLHAi34WrLWYi1lkLRrqbqVUsGIxte4wscD5VFN4mpH1SRh85e5ZjGsZAIHA5reGNZJkMgtC4dY4pM8jE2UDDD+L8KmpB5FEsedpJCrOocktcX4cKA2fYT1dIdZD0jHuMiyCM7hHoM5HMJ7hXAHja/nWrinh1R3tngrz0PW17TTsV4aGyRaXu7M0Xtx9QyMyDKhacWUE2N2Itib3rVc8vjr9nzHso4h+dzkyPTd3InEr6XqKRo1wjZpbMF8Bm+XxrH2mXNUrb5idnE+lznP+pP50NXMd+h1Ue6e0Peh1wZZstvTf3MbWFh5VY4d2nBeyps8GrmNa4pJ+NWvCdq7pOibL2dSTJMj7REzTDmbQ2sMTf8AZVDkem/ie3+8scw93a7J/9P5tz+vVT+gq3uuHQAC65jy50BGMMGcKBbH0qLEgg8c3HDD50qDa9s6/wCttkhTSaLqTWvoR6W2rVN9bpWBHAwaoSR2v4Cq+/lOEvvanbjtb68WX3o0fObVrHX7apGbpvPSuR1RmG666e17rH1R222XXuLe7uOzNPsmqJ4k207Ppz84a8fp1217m/NLenS4uekvxHp8Xbn7y3F8MfEfNo5iftu39rN13PbZdo6l3zpXWHV6bJtu96JNfpmcSoQg1ehKOCxFgWhrG7dx1uEtqELio9MXsvV5stH4iYQw05KkpRdV5SquWP7jpX3bRr/mvCqSEN/h/QtJGpBYM0+qupIBBNV3c9UwOjz30I28/dcT9ldZWb8xAy+2ymxAtivH511JSiTHCGyAFQxsYwbnjzJ8KAZYFAo4Wa2UX4HjxtQE3IGCNJ+YDG1gR5ftoBOX1McQALnxtztbhhQHrEA/mW7cWsSR/TlQDTIFsXUst8HOPwAwFAe5GkKMcTc5Ta9h4W528aAkxlQVZbLmuC3C4PkB4UBs3QuZutujiCbnftux8WGqjPOtLMvlbvYl6rNjB+/h2l0o7V9y+h1k/c3p/a9F/wARqdbtsGn0cBZRd59bOqJdiALs3P8AGuX7mTjay+5OTpGM23wJRTLrvDFzxUIxWlxS5Wyu2/8AT+79N7rqNl37TfRbrowj6jSMyPkWRBIlmjZlxUg8a6zCYy1i7Su2ZbUHWj0rVoeso8Rh52JuFxUktz/YxyR4liQzC59tRgSBzBHnifGtk8T0OQ98gAAHuoOBOHAUA8Jzcqo/huFOFr8/hiflQDDyNmQITmbhbHG/A3oD1HGcs9zyw5+HDwoBTelRiQo4sfUQRwxoAU5gVQjD1Bsbj58B50AFQlgw9YBKs2BJx54UA0/qu1zcH1sBw4/10BKsQyKr5AHjbxODDyFQ9TCLKfdvozF3B6cjaQsG6fjYsbcDrNTYj51yXcyOzhJr030Ive8Lrfi/R62cG1MCr0NDIqYy7jPZxa5AQAX/AArrd1FLDUzD9GADdYRIDYk5SOObK1vwrNobjF7CqLtHVBYsxOrjyDlfMeNYkQ1mL6dRjvmiupsZ0Fhb+8MKma0GUDL9VaVU33ekUBCmrlyqLZQG9VQjzZZbv3p2g7f9g3EzAS7G0gVvLRaDw+Nch3bi1jMY9+fXIvs3l+nw63o9SKtSrcx2uSb3AxuL8sBXXlCeAqRYkGNeFzbHD4XoBwIw9drKQGyMLqSLY2AxoBsMCwyt6ibgWJueV6AW2VQblgWwB4gWHIcvCgGC7qmGZVBtYcicBQEhZSoNgCCt7XtY8fnQHjyll9GLsLiXlbEUAkfqLbJkULf3BYm4PM40Aw0Zta6FQSQSMTyueFz8qA2HV9MdRaDpzbuqdRoymwb1MYdr3FpIiZXHuXXKGLixjbiBw41qWswsXMRLDxlW5BVkqPQtG7Sm6t02J4W7C1G614ktT0f77haPu/E69iu18pkLmWTbDe45bW6qPjXF93VTN8U+366OhzZ/obP2fVKlK3pkXNYYCxv8/Gu/OWGJEVrhVy2IuoHieJbCgENxyOuYg/prbh5f6aAWB7eJw5ZGubDy4cKAWVH5QwtY4DgBz/bQCVRWUBr+NiRY+RoBnUXBjS5ykgZrAAY48KA8yLjK+B5Py54kEUA4I4wLoCATaRgRiOfHgaA8tnIIBiCmwZRYEC3l5YUBcnuVtnTmu7K9hJN/6nPT+ii2pGDwaKXXT6h20UKtFDHG0aqVAuTI6j41xGW3LtvMcX7KG23LzlFLS9et8iZ0eMhCeEsbctlJb1a6Nz/Uru+8dqtnUJtfSe89YamMj/jd/wBcNFp2I5/SbcM5HkZ66J2cdd8q5G2t6Edp/eno/CVPtMNDVCU36TouSP7xEvc/qKCNB01otp6JgkGUfyLb4oJlANiPqpRLqDhzz3qPotibrecrr9OTa+6qR5ifqF2Oi3SHZST5dMuc0zcNx3HeJ21u97lq901F7/U6yaSdhxF/1S37KsrNm3Zjs24qK3kkug1LlyVx1m23wupFWJFS6Ag4B3BAuML+QNehgSASU2opGg9vdtP7RYABmBWwv8awu+RKu8+gyj5S4zr/AHP6cbqjvNtmwvqU0sm9afRxTTopb2WETs+DWzflw+Nc1lGJWGyyV2ldly8OktMba9ri1DVWnQbIftt0ixgDqeaMj819OCrXOB/MtrDCtRd7HX3fOezyb0uYcH25aMZinUspuP08+nBwvzs4vbxFP8sf9PnH0ZecaB3C7SL0JsY3z+d/zASayPTDTGExsBIGZTmzG9stjhVnlWefHXXb2NnRWtd41MZl/wAPDa2q6aHGozA4BksrGxjAU3A8AeHCr51K8ZE0MEpWxjYHEm5xHha9SB1p2mWVA7K7Mb5bg+NrmlBUUl1jaRlDMFxUkkm4tYY40A0j+7C4jYpItlKsOGN7knhxoB+V1j9lGXN7j2nc2AKkDyviT8KgClz+6BFioYstrCwFri/l4GgMjMdS+nWQyqCCAMcRmsLZRgD/AFVgqJmWkxrITlAIIvkzsTmYAEYXJ8azMRDaZSbSZgwH6ikWKjmfA3NqVFBnTgGSVHvGgbi12spvc351JBknhRoneIAgm4LCzYCorpJIEMrIf07p7i5YxfNfNx54jDwqWqgEjWGYZY0JjuxsCcB5Cj1AiqTHK7IqgKSGIBtlY+I5i9CCXpZZ40N4QfdYtGzXykY+oY4WAwqGSPs0SoZAhZcWlIBGNvDE3qNII8W5xPHIih1dFCoVBvZOB4YcccanZFRZ1BnZJVZzEBbE2x5+BokAllESL6bDHKQMVHmfAnxqaASHyyxte8TqA0Y44fEXthxNAO6k6V0Z0AUl2ERwJCcDe1hj5VCTDOz9Fd85elentp6abp4apNsSRPrBPkD55GfFcuH5sTeudx/d1Yq9K7t02qaKcFCzw2ZuzbUNmtDbU+5E2Pu9MFirZSy6i2HiARh8L/OtN901uXOY9/rL83nJUf3GxLGJJOm2EqtdYROQAASR6spx+VYvun/5OYn6z6POcF6e1M+u7h7FuSRRrqtb1BFqkiY2USSzl8oOJAF+NdHjIKGEnF6lBrkVCrsybvRe65dZtXdSONe4/WoDI5kjLCw4XgjzKQfDGtfIn+it8T6WeuYe/lxmT60Vz2X7XySe2PZk1AhjS5LxZWs17WFjxHmK1cvp9SxCW8uU9cT8rafGbpoPtx00uj0s8nUsyS6mCGUmPTqQpdQxW2bHja96r7nepxk0reptazZjk9UntEhPtx0Xo/8AE8rW/OfpxxJ5evw5Gofet/0+cn6MvPMdvHYBNt23ct0TqQONu0k2pELacqGaFGfLfObXAtzr2w/ef2tyMPZ+U0te+YXcp2IuW1qVStkUkL/7wARc7qWJJGHCurZToTM0EDqxVibAq54Hl/qqFUDo1YJXLIbBLRtY8ueIFKCp5CjliHNzmJBkY/t/1VIPEmV5nQ5o2b1DAm9sP23oBYLRadnf9SWx9sjLYG4ty5XvhUMHpYFUaKwzKC6ix9RIxvx48DQGVgGpeFoi6oFUAqxA8MTbiB5/OsJUTMlUxrB2UlmzsRnLPcKtxbxte3KszES0FwC+a7m6Dk5PIEcMedKihFyCPUIiBijAgtxDHE8BgOPhUkGViiicehldgpzlh6bnE2+FRUkxxb2pD/B7bj3HvhhYjAEWqQEyZ2950VpJjfEerE8/GiA1qPVOuVFD2AwXEMmF/GxogLhmmMrT+1mQKA7C9gSCSCL3x8aME3MJMzNGBPa2ReCrzs1zcViCNHuUEcxiKMFDZuBvmtltiOFqlxqKnp1RnRoleQtGxMgY29PK96UFRZcKjOEzXtmGLFjysb/10Ax7meMSRvYo97kYm3hfn5CpBMZtI6WaOwWL9QG2L3wtb+usaMG89ue58vbsb1FHtI3Rd4eBzJ7ntGP2g48DcHPVVmuUrH7NZbOzXnNzB414atFWp1cfci2chumM6FQygajnzHDj5/2Xqn/xNf1OY3vrT83nJEP3GxPnaTppo48oKgT3LNje+FgPxqH3T/8AJzErOfROFdxurf8AHW+y74dENBH9HHpY4C3ueiLN62JAuSW8MK6LLMD8FZVutdLdeMq8XiPbz26U0UOj9zlY9P8AZ+XUe2sg2lUMSXNlAhyODgOHKqvJKe3xKWrb/ebePr7O1XzT/9SjWq6Y6S1+o1H8g7h6P3XlbLtnUOln2ubNmwU6hRqNO3gPWtVLx+Jte9w8mt+21Nfd8WXMzeWFsz93dXFNOPPpiQtx7d9bbfAdY2wzbjt4uf5ptTR7jpcvj72jaUD52rO3nOEnLZ9ooy3p1g+SVDGeX34quztLfj4y5qmgHNISigCSBvWjDKw4heOI+FWa0qq1GnwCGlyWXKHZQQ7pc4+eHjQGT2FC2+bEFBLNueiXlb1aiO1+VeOIdLU+y+hnpa8uPGuksJ91RI7uSFbuRsO3uxbE5nfUG4rm+5qpl/HOXQi37wP9V9ldZW4OVJRlY5h+XzwsC3heuqKQdaRSR6wDfAcrY4XGOFAR8ZgPbsTGwJJ4EDhYnhjQD8BNvbFndBdytz6uJv8ACgJBFhcLZWXBgbnHAcaASRiQpym9mzDiB8PCgEMv5cv5VtfjbC9sPjQAbqrWbLm8Tc4AXwuOFAeoVzKCQQoAPPzx4YUBtHRjJD1n0fqZiESHfNuJIFzjq48xVR4CtLMflbvYl6rNjCe/h2l0otD3g02n13f3tb9OBP8AVvs7g8CwO6vf0nyrke7Gz9Jv73j+oi/zmvx1r7PrM5L9y2mi0veTqZMIS+m22VICDZQ2kjvYnjY35Vdd1Ull1tLfl6zK7PHXFy4l0I4N79zZjndgLWNib8fhXQlSIWYyCwQs0f5SLgcDf8OdALcOSbn1EC55YY0A3nLtlOFzYubAgm3Pjw/CgJITNcBSUAIWQfly/tsT50A9JEysqkHn6l52F/ny50A3GgHpJuCLhbYY/DxoBDh3nN+fAi/DxHhQHkylPUCLKMwQefz5g0B5HOc6DJgxFiTfifPn50YLSfdrI+r666Wd7RyS9ORqUIuyqNVORiDiDc1yHcyTlhrlf6nUi+7wJK9Ds9bOHSJm7d6XMozLr9SSx4DDh87V161lJHdMB0kAm8wLGA65iTlBNhlYZjxrNsU0ErbYRDs/Uftn3M+rjLWBOWzG5PwqDGOsxfTESNve3kBXYyqXQXx9S8PxpJ1RnHQZHrFT/iTqGQWCpqWsCCQboONQtZ5Msd9wupcdC9iYcoaODp4rDILAMDpdCBYXuOHGuO7sybxOLr5/XI6DOElZsU83qiVSMhkbLYpf1XvfG18Ry/GuwKAfkjIjvcE2xIxB8z+FAOJmMQz4Fb2JuTiP66AaEeDPcm9iSAAbE2x/oaAfkhawYrckECIA35XAFr8aAiSYDN/H+XITiQRhflxoBAdpPUMACSVtbE4GwHD4UAv12QEF4xzBsRY8aAQuoDFnYFV4NxFvIg8SaAcWRXy55AqrZsbm3ny8qAtb1ltiL9rPanUmLMp3aR31LAr6XG4hV/YCLGuUy5JZ3iXuuK/KXuLr9Ns71X+YzPeltGvZHtRoFkAlk/lkjxEEqAdre5L8OOFVvd6n1bFU9P10bebV+Bs19H1Sopuq+sDNhY2BN7WOOGHlXenLjStiGEgHpsfDDDibUB6Va4AvmzX4k434A8sKAVbgQ2UgAPcEmw4n5UAoADAK3NQhFhhjjzoAYFQfTayhmsSbC2Bw4UBCKvK+dMmW4JHGzDjdTzoBSyobkNlAIFj+YDlgeNAOPKFGYXYqDlZeIuMBbHl+ygEKXIta6kYE3AFvAeVAWg7vAt2G+35lzFX0ozLgTmbSAEj/ANCuPyTRmuMXDX8RfZjpwVji6iqub281lLXGHy54V2BQjtmlIZPbCAg5eQZTfEEeFAZnZtn3nqCZoNh2jW7vKpA9vR6eScgeeRSAPiQK18Ri7OGVbs4wXC0j1tWLl50hFy4lU3KTt5ue3FG6o3rZOj1xtHuGtSXVrhw+j0Q1E17cmUGtD6zbue4hcu8MYtR+9PZj0m19PnH3kow43p+7GrMRvOl6Y2xOn22LqLUdQyR7zCdfrJNvfRaaM5kKewskjSuPzE5lXlYVsW7l+7CftbagqOi2tp6nWuii8FTxnG1CUdiTlp06KLwbpsne465u66HaTO+6/S6EaCPTZjN7xU5cirjmN8KrO72ysB49Nmsq11UNrM6vEeLrojVjtfdq8gfS9QRt6XksZ8ccLhThjW8r+A34cxru3iN6XOSf5P3b4SaLqBUNiAryBcBYXsw+FhWKxGX78OYn2eJ3pGJ6k0nXEGiX/E2h3XT7fFIscUus9wwmTHm1wGIv51sYW7hZS/kuLfBStP3HndheS8dOnCavGIpVR5ASWXLGy+kDwBwtjcY1uPQeAmSELctlzrfKTcgi4wDDw4UqCCr3mtihvchfV8vhjUg8mKvO9jkjCKVth6rcL+N/GhAy4A1DZXLO5F/C4F+NAZCRBmjja4IAIYNe1rXveoqSTmzhWQwqUBsXjOWw4AAKcLXxqCSTMrCIGMIgAChh6QAbk+JYHkTWMSWY/UTEtEzqzZSUXKbAG2BCgi1vC9ZJGJ7qXZovcdV9xiPcUcRyHkQfKiJYzogFM+ZlkBW4JwtlxN/PG1SyEKOpjMX6eYs0ZxDXtc/D/TSmkDMSZXRWjMcbkG173Df3vwNANsyiURxMsZa6ZzgFCngPjwqQMOAEds1la9gL3JsMCONSQZLRSWaMPIBJJYNc3sSBf0+dqxaJRKKj3D7Ke3KgvIWYWIHDKPE2tjUV3ySEyxIZMlgL3ABy2xxx58bWNTpII8UsaZmcZiwKxi11WwNv3VIEr+tHnBNwpLi/I87Y8aA9gIdf0wAoGUSNhgLfP+qgJaRB0Z1B5KAccfEVFQWR6G2Ps9N0hsOr6im0H851UDjc11E7K3u52BUrf0+kAC1sOGONclmOIzKOJnG0nsJ6KLcoXOFtYV2oubW1um1Dp/sPcqsu1jK5Acat7XGFsxY4eV7c60/is33pciPf2WC31ynp6a7Eahwx1e3lIzdvb1sgABsD/Fwqfi83S1S+6h7HBPdXKVs6YeCDuB0zJCxXTx7/ABJpZGBa0fvWUkDG5B/rrq8cnLCTrr2HXjoU2H0Xo9rrNi7oCN+53XFzciFjkve2WCO+HL51r5F8lb4utnrmHzE+PqMt11LHN2Y7UHOLBpxbFcFDKVscTbnWplypmWJ8B7Yl1wtrwmo6bQd1p4dFNp9Lv/08sSLoJU94D2ioyZAOWUenlwtW/K7gU2m4V3dWvdNZQxDSopU3NZKi2ju4Y0KaPqAx2IurShiDgRiwPK2NYu/l9dLhzEq3iN6XOK1W3dzodDMut27fm28xu+rlcysoiUENnxPpte5OFZQv4FzWy4bW5q1/vEreI2dKlTwnPoPbdCrguiMGIXA3PO4+PCrJmqh54EJBwMTWMZPqtjgTa1r1CYoY2ZrELa3IMpv87eONSBeoYEQKDZi59xiLGxFwT4UII0yoBE3uMcmbKAb4fEUBNVcmnUuCQ5sQrY+Aw4DGoJJ0IdI0WONZbqQDgD4Enx8BUaCSZCoMJKRi5Jcg3JuAbDOxwIvwGFqxeskgzSP7Doxzges5TlBx58zWVNJjU9WRpYT6FRVB+nVvzWONrgnEedCSDBb6iFywyg3MRGOOAx8Mal6iETWniV5UNyySAWRsL25DH+yooCD6mZphG3rYhpL+o/xekfCsgK1DRRZWADNZHItxJ5m1EBllbMS0odlX9SUHlgbqcBQgXpZAuZnayqxyKxy3Fwb2OJxo0SZebIWS6Z5XsY5bhUvb+IeFYokiyoglUyFTJ+WQ4+q2AN+QNSiCDnVZMzXKoMzKDmLHnc/KpB7nWeSVFsozWiAOUeIHnQCIyolaMAs6vme+ABvbmP6r0IJkcedspxZRmYi5Ui3DGoqSdj7UbT2912n6hl63k0sep0s+n/l66mQxj2WRixUD83qABw8PGqHO72MtygsOnRp1ot0scBCxJS9q96h1k7B2FzHLLtRMi5mK6pza5xa2ay4g4gYDyNUqxWb70uRG+7WC31ynrdOdiZgIBqtuBYWyprHzYkEcGOP7ahYvN1ppLkDs4J7q5SuncvR9M6LqHX6XpVll2OPSQuhjkMqmUp+oAzXJsT8jXV5VO/Ownf0Tq+DRXQU+Mjbjcat+TRG9915o59j7Nu0mbPtEeIuua4gA9BF7A1V5HGl/E9v95t5g627XZ/cf/9X5t6hFGvnDEAmR8qk3HP48KAe024a/aGOp2zcNTt2uzZl1eilfTuBfhmjZTjXndtQurZmlJbzSfSZQnKDrFtPg0G1Q90OqJ4RF1ANt6z059GTftFDqpLX4fUKEnB/+iVW/RMNHTa2rT9CTj+HTH8Ju/Ubz0XKTXpJPn8rnJsXUHbPdRk3Xovc+mJhcHW9O7gNRDjxJ0m4Kx+QnFT7DG2vIuxuLenGj+9DriR7XDT8qDi/RdVyS/eZDa+lOldfvG0ajpnuVtmpZNw0s0e079pp9n1XplQlVc+/pnY2wAlFzwrzv42/C3JXbEtMXpg1NavBJchnaw9uU4uF1a1oknF6/Cuc3n7qQB3Xka2UNsWgymx5POLWIPhVd3N/6+npy6EbXeD5r7K6yuZVRMAxAvwUm44fPhXVFIKlwjlDN7jt+VgLBVuDb50BCjdlQ45gbrYnz5/GgG2lZJRKi39BjeO/5hYDH4UBk4ZUeFvQBbBuZGHhY/jQDwAsSBf0+kDG1sDegPAuYMBgqngMLD9l7UA37ceALARMuAGJJHKgGpXiiYquEjCwHhbhxoDY+hkfW9ZdJws5jhk33bVkC8SBqY8PlWnmLphbr9CXqs2MIq3odpdJ1/wC5P2NN3A2LU6LUFV0+yxgBXKtmGqnOJGK3sDhXM9yPGwU21ruP1Ylx3j0YmPBFdLOCSCPWzyztI02qa3uamR2c4DAXY42FdikloRQN11kOXRE+q4sMLWNweWJ4WFSQex6YIym9ixAGH7aAmaiJQlvcKknMXAIvcWt8vGgIaQrgGIZs4tY/H50A6uoAIGYOkpBI4gcedASpGVlDFVwIysDxIt5YUAjH0ksucsSZMMAbWtf8KAjyYucoysl80gPjblQA2cgMzgZGyZQLk38bWoAUKXRRb/eoChsDxH4Y1D1MIs592mkmh7idPRTKc46egLR4HBtVqBYAEgXrku5kHHCTruzfQi+7wyTvxp5vWzix/T7eaYgWD6/UgkcQQDbjhzrr1rKOKMD0nI6b1AEYtmupLDllYki1vCpZL1Erb5/+5+o/ZfPfUxrJccAzEXFRpMY6zG9MOy71txDMzGVAFIAF868bVL1GZK6whH+I+oFVfy6ogta4tkFxfjyqEebLF9/NPLF297AzSf7ubYmMUpIN/wDhNDfmf21x3duDjjMYn5/5pF/m8lKxY7PVEq5YMcqtkzvlzgXF7+X9ddgUAPne4ONrrkXg1qAeUhkuuVQThGSDfzF8TbjxoBZy5wpsUzFohzHgOB8KA9mnEeUhVDKbBRiRc8b0BE9EgVWbPlZST/0vLgKA8iiAkB93KL4Bcb2seVASp4FyrZrK5xW1rX88aAx/0Nyqi1/4cPHnbGgJiaNctnKsoFmXHH+hoBOo1GfQLt8WplXS3JSAysVTjce2cMbnGoUVWtNJLbpQtX3Z00H+S3bLUabUH6rTna1ldWJUk7ZJfH4iuC7uy/u+Kjwyf40dPmy/QWH2fVKmrqLEiQWVSVNvG/ga745clhIcodTlIH6bWuDwFv30AtIxmFm/UFi1sB8TwoD1LG91JGOYgcgeHDxoABCuLgM1rHw8fDD40BjNTqCTLHEoXOChlHIX5ePzoD2OTKFCrlsMlr48zQHsBtMxe8gF7rxvh+NASpFAjbPIGXN+mf4gL4fuoBIAAjvaxB+flhe1AW9692KLeeyHYtNTv+0dN6XRaJZdTrN2meIENphZYo4kkklYE4qi8ONcNl2JdnNMW1CU23SkVXd3W2kuU6XF2lPBWE5KKS3Xwbm6zhA03anaFI1nUO+9b6oXMke0aOPadIbnh9RrTLMw8xCK6X2mPu+TCFtek3N8kaL8RT7GFhrlKfEtlcr08xFbr/aNFJn6Y7d7FtMg9Ka3cjLvGqvbAg6oiEH4Q1i8suXffX5y4I0tx/D434ifjIQ93biuF+O+fRzGG3Dr3rLemOm3TqXX6jQLh/LIJPptJlt+UafT+3HbytXvh8qwuHdbduKe/SsvvSq+c87uNv3VSU21valyKiNddECSEuuRjdMLEXtx86361NUn6RUCbKWKhv5xpmjZxmsQ62vxtbA15X/dy4n0Gdvylxo6b3j3d+mu8m17/DCNVLtcOh1a6VjlDe3nAUkDC/GudyOysRlsrT0KTkq8ZZ5hP2eKUluUZml+5PXPF7q9LRBwQTH9Q1gDxs2X58PLzrw/xOH9R8h6fWZeaPf8yGquoPS0aXIux1DWC87C17/Oo/xOP9R8g+sy801HuB3hfrbYX2GLaE0UX1MWok1JlLuTDeyhcoAuTjW/lmRLBXfa7dXRqlN818XmLxENilNJxjTyosl2UZT+VcbXv51fsrhWoJMyeyhjLglwbAWA5Xt8eNQgQzDIrMxYpJlzBlFjm8Cb1kQRpyzyJa6EDCUeIwwBoBcQaQsssmAIC38fEHxoDIZ40ib2nYTsCbjEeFr+fhWNCai9NKU00XvsJcxOWJyRa2PIHG9GtIMysxljYJZb2b3HxB9Rwve+BrClCSBNmCKystyQjTleNjxtiMedZIEVHmMRUhZCbkkYqAMPiPxrIg9jiQiYEfqHMYieB8LW51DCIEk3tpGsiEsgzWB9IIF7njxrIgyemKSTZ3CqSgucMVN/TfnfDlWLJQoqnu+iNSUBLXX+9yU40AM8KsrXJuMrtgcQONhbiBTSBMbRSKpCoroSHkt+a+AwHjxpqBJjaLI65SzyDKWUWtfAfMcahghrDNKJTkBUuVNyBYKLm/zqaoUPJ4DDHDlIe4NwOF7cMDxxqUwYkNIkpZWMZynNHfjbC/zqSCRkFo5S5YYZwOHG+N6gD8mpKsiQvJYMGykWA4kYY8KUJOqdMdmeqOq9i0fUWh1+hh0u4ZzpopXb3MschjJay2GKki3lVLi8/sYW67UlKq104qm9Yy65egpqlGbJH9u3VgL33bbowD6BndrgcD+UWrUfenD+bI9vpF3fRIH2+9ZBcsW8bWruwDKTKFI+Sm2NH3pw3my5h9Iu76Oa9I6Z9H3C6b0eoKLqtD1BDA9hdRJHNkext4g2q2x81PB3JLU4N8qNPDRpeit6XWbL3SSJe5/WVyPVpgTfH80EeFudrCtfIXXA2/D0s9MxVMRL9twyvcGNW7J9rSGFg0iIFFsCjgWw/hAsa08tlTMsR4Oo98Uv0toymz/cRrdJt+h25umoj/L9JDpklE7Wf2owoYrYW4cL/hXje7rwuTctt6W3q3z0t5vKMVHZ1Khkl+5LWZAZOk0z8wNU1r8gTl/dXn/icP6j5DL6zLzecb1/3Cy63bdVok6fiXU67SywNI07ZU91ChIW1za5OJrK13WjCal7R0TT1bxE83lKLWzrRWqNwhQHAIQGbG9vEkeVdY3UpkTNVIhhDxx5GW2RhgDfxwthWKJIMkMjMGltg1uFyBzsRUkEfUFvb9s5pCGIzk4hTgL444VIER+5nRWmJQi5ZvDwNuFAZGAQRj1sSwACZceOOAw/GoZKPdLLKH1UkspyCxynDN4cBeoaCMzptQpCpGgW3pFvUqcbH1EWv+FYuJKGnDWfFZGUBlspAXDh+ypQMfHJMHa7LICBlCDHEcx4+dZEAqKZlaVbAizWuFBvzxvTcBHmYwGcOpKFrKFOJFEBcEiyrEpRQqOVQ8SCt7HlRgn6hYWYBVDNIQA2W4J43PnxtWKqBDtHlJYWdDmyggADC45YYXqUgIDwyNJGVViwHtuwylfG4GOFqUYJEbRKwLAPbFABj8aPSBh0kfUN7SXAVpFUkX9RwA8bE2FK6BQ8OkKQzNdQ4axRTfmAbm4wpUUMRP7mcEXiYEWcE435fCsiB4KZg7PI2dTy44fsqAPe+sUI9t5Fcrl9IGJsbkngaUJqbz0T2833uE25Ntmr0ulXaRCNS2pLA3lDZAqqpvYIb38qrcxzW1gdnbTe1WlOD/c2cNg54iuzTQb6n279XlkL7pt0eHrcO7WN7WtlF8POq196cN5sjb+kXd9EpPt86ujuU3jbVZQfbcGTjyBw8f2VH+U4fzZcw+kXd9HKesuldx6O3SXY96m0+o1H0iTmXTlmR0kvlPqCm/pIOFXWAxsMZbVyFUq008BoYixKxPYlrodV7tIv8g7Ouzgt/LI1BFgMEgIPDAcqpchf8/E9vrZv5iv5drs/uP/WpBqe3Ou1M+rl6a6i2Dq5JJGIh0OvSDV5SfynSa0QS38lBqolnFu17+E7XC41j96G0uWhvrASn7qUZ8To+SVGaZvOwb509J7O/bLrtjnbC2t08sIPmGdQDfkQa38PjLGIVbU4y4mnzazVu2Lll0nFx40a4IpM3pYuhJIy8MPCtg8hw3dVUygkA4cLXGOPCgJmyK67ntDROzyDX6Upcc/eS2Hka8r6rblxPoM7flLjXSWP+6vTy6Xuqqag3kOwaFswuQQs+q/bXM9zIuOX0fnvoiXPeFp4qq81dZW4DK0jXvnt6r8ARiOdq6soxJZMcQrElSceXjQET2pVcWYsM3BeFAON6o0Qtdjcqo448beNAOaeTIrBjZBxVRmYk88PhQC31AQxE5sqk+5ZfzAEYg28qAZG5J7pQAiM2yng3z8eNqAkpNHIAzAKq3DM2FrDAWoCJLp4wTNDISkjhXQAkqCcaA3Xt0hXrjomJ3YZ9924gEWGOqjGJGNq0sy+Vu9iXQzYwfv4dpdKOtfdTpVi7m7ZAqxaZG2LTZQotGpM8+a3NvVfE1zvcpUwclvT/LEt+8TriIv0etlfYwqKyhjZVLEgWvxx4k/PnXXlAOJITETcA5h6rYAHmPPGgEB3WIRr62FgQceR52PPlQEdlQkssrLIBmYGwABt44mgEKcrKTdgykktY3v8sKAS0blbBCqAhntx/wBGFAOxJ7kdjcxj/dgD8t8Dj+ygFzKIh60IUCyi1uPjzoBv6h4wgRlygHA8Qfh8qAdD+6QCCpst2vmN8cRy40AkXTURZnJyzRk252kFz86iWp8RKLQfdbLH/mPsxjY5W6fhxIwuNVqePhxrku5bTwc6ee+hF53hVMRHs9bOC6mU/wCAtOAbhNx1C3J43UG2FdbWjRTQ1MwvRvr3WGxCBSXJPkrG1ZyZG4xWw+vaOqMsgumrjYjmbOeFYtkQ8oxnTkn/AH5orAKTOmbE/wB4YXqbj0GUEbD1NNff+oHJN/q3GX8xuothaiPNlg+/Tx/5b9gkVyGXZnMh8xotFz+Ncd3baeMxlPP/ADSL7NlTD4fs9SKxIpyK5a+OCW4nA5j4V2BQjbal1ChLKCuGY/tHMYUB4XV5PX6ncZbjkeP4UA+Yb5WZTcjkvHny8KAhssjykglplILMBy8xQC/yB7rlZhcGwN/G16AAt/SZGQFczLcDlyOA5UBIibIymIl4z6izDkT8+VAPIx93NmurWurDwueGFrUAkPmdwWIsMw8cLC5oCBq41MbS51B5xEWZieakHHDGiBcfuxp1h+3ztRqCiRPL/LDJIgKyMRt81gwGFgtvVxrg+76f1bEvt8fl6Dp81f6Cyuz6pTeSJzKPU5MrDErb0sMSbfjXeHMEmKOCBDErrJKDe5vicBYX8KA8k10ceYgH0mwF8ML4X52oBka5ZIQFusxxYgXUDEEgUBMMyktYshYWS64DDieHG9AQB6nMjGwvdyLBcTxwoBUokckqS2IJIw40AqJPbBMj3zG3O5+NASVKm4UArfKQDxHPD40AlAECgkki7gDE2vyPjQFnO8mm1MPZL7fs5tp5tvBW1yRbRQm5+IJrj8ii1meMb3/zMvszaeDw6W91IqqqDPIfcNuYbkCfxNdgUI5J7kl2V85FjcCwBoBcCMGyFmklkNliUFpGvyCi5PGj0Kr1BaXQ6Boe3PWerij1LbBJtO3yj0blu7x7Zp2XmQ+saPN/1b1V3c6wcJbKuKUt6Cc3+Gpuwy6/JV2dlb8vFXPQxu+bBothbpiD/E20dQy6jeYzrNPtU0s0WnAePKsmoaNEbNc/kJAtjyr1t4qV+3N+znBJOm0km9D/AIU21Thoec7KtyituMnXTSujw0pyHQu6Oj2nXd7tn0nUE40+yayLRxa+Zn9vKrI4uWOCjMFF6pMmnchlkpWlWacqcxvY6MZYtKeiLpU38dvOysWp0+lOp07zahWEcY3C6sYx62LK1gT8beAqu+p5o4uVHRejvm18JhE0q85JfoDs487RyajSl48paJNcFB9y+T8jX4A8PjWKzPM6Vo/u7xPwmErr5zlPdbpXt50701ppuldQku5tuCxtEmq95vaZZGfOLk4MALmrjJsbjL95q8qR2d6mnQaOOsWLcE7b0139wrzHrVxZ1zZFy4GxNhhXSFWLl1XufqcFFjGwN7W/0USARQvqFLZszE4AkjA4kCpFBU8L3CXCFV9Qaw4ccaAXBG5jQgl3JwUWOGN7ePCoA+IZBFKVa4FhlW3DjahI4hhiQvIMoFisfjfxI+F6AfXUL6WVsgYgAG2N7ZsedRQVHMzRWfN9RmFm4EKSDxvSgGp53dGiRQEAN7D8x4ek42okBCsGRBmyMvD0ggH9pw5UA1qIZUDGTFGABuFJZcMQbcKJgZMhVx7UhUIcVHCxBBxqSCZpQryn25QrAktIzG4y8bk/G1QyURA6iZ0C+4kbFlYi98ed7YCpBLMyxxsY0BWYtbx4WthxBqAe/VOqrGsSlnHpdmF/LyvbCooKnjTqckYUw+4Bmte5IHHyItzrJIHkumlDIWuQQbCM4ggUqKCDpmc+76bIAAnAnHwPnSooIk0xyl2LZBgr2sAcD5ilSKDM+klR4ncNZsEJA8L8BwomDdNh7jdddP6PSbTtm7yafa9Jm+m0/tI2TMxZsSt+Lczaq/EZVhr83Ocaye6bNvF3bcdmL0Iz8PdbubZzHvkskYbA+wrDHELcrxtzJvXi8kwXmLlPRY+/5wuPvH3GW0H86kfUsWb3PajLWxxtlIABPhUPIsFr2Odj6hf841To+f6vuJ0rNqZPffUb5p5ZXLWzyPLmLMfEsb/GtrMFs4S4lopB9B5YZ1vRb85G192lt3L6ydm4wegAkEXgjuT4Y3rWyH5K3xPpZ65j8xIzfXSj/JLtW0AAVTKSLlgfS5w8SWGIrTy3TmeIrwdR74r5S14To2i6E7KLs237jqdwgkE0EEs031/rLSKoKsim4sxNxa4xvVZczHNHdlCMXob/AId7/Q2o4bCbCbe9umcm7fdnY/ahfUaWITFlS2uW5IGdrtmJ4ePjWvHNMzdWk9Hono8JhN9cpr/UfQfaLb9j33X6LUxJrY9uml0cY1xdjKkbGPIrEnFuIFbOEzLMZ3YRktG0q+LuV0nlewuFjCTT000aSoK6rKRGy8DmxNrHDn+NdqyiHm1iyrlVbRqWDrmx+d6hIDcWbUsQX9IBABJAuBz+BqQPvp5IowpGVibgnEfj40qBuCNgZQ0mC/3SCL4njhQEyOCQuMfba12XgcBxx4YcKipJ7CqhiZbpYkPIePjQD6aiJhdLRqnE8RhwsTwxqKAduzr7ok9xgL+0OJwve2POgPX1TY5EVWkPqbKCFUm2P+jCo2RUiRthKrgqWJvgDgcef4cOFZAW8MxVXRsyAnK5Ay35KARhUVBCJAQLGxR3DXtxvxx8MRWRA+jLI6ZnLSsL+om2JsCOXGoArWfpzhc3vs6qsjC7DDwv48ONQiWOJIigyIgDxplccBj4WPHn50B6mrKB5TEHDMTZjl54/Ig40oKnp1JVC8keSUNjIMRY24AcjaiQPGgleEupugN+JDEXFTUUGzpWltGPTlN7ubHyF+dKg8+mZgAA2UYsqjCw5+n40qKEeTSSHTl1zNElyeHLDwxtSukGf6e6t6q6SOr/AMO7g+hTXmP6xRGrh/buFwYHhmPCtXFYKziae1jWmo9bV+dquw6VN0Tux3LklDQ77Kbp6kEKNawxJGU4fs5nG9af0TBU0wXKe/x9/wA4UO8PcbTMx1G8uxYKkamKMWbgLLlxJvzqPoWCf8HOx9Qv+caB1Z1Bu3UWtl3LfdW+p3Bolid2AV1jQHIoCgAAA+FWOFw1vDwULapE1rt2VyW1J1Z2fu2if4d7PZMqQrtUfoDE4BIMoU8+dUORP+fia+f1sscw93a7P7j/1/m5qjm1E4jTOhlcMGF/4ib35VKdAZvaetesdgU6Xa+p9w0mhvZtvklOo07A39J003uREEf7NaGJyzC4h1uW4t79KS+8qPnNm1jb9rRCbS3ta5HoMsevds1ot1T0Jse6CQj3dw29X2bVnC9w2kPtE/GKtb6XO17i/cjwSftI8k/G/Ee3xsZ+8txlwrxH+HRzEgaXtNu5iOn3zqDozVy2H0+46SLdtICcB+tpDDMB5+0xrL2mPteVCF1ei3CXJKsfxGOzhZ6pShxraXKqPmMltva3ctRum2ajpvfNg600SazTSvHte4omqVBMhZjo9Z9PPgAcAprzvZtbjbkrsJ220/Ki6Vo/4o7UTO3gZSknCUZqq1PTr3nRnRfuxkWTu4xSTMibBoAHbHD3dSRhy41odz/kPtvoibWffM/ZXWVqLki0KllJyuDfHzPhXUFKRGiGdlJyhjd2OLY+Q44UAGb20yklYzb1G3A3tQDgZW9trgEqLceAuKAejXOzk2uygYi1sw43+FAMzIsbOojZoZeGPpB43HH8KAci0unKsrp+pjlfEAYYG3l5igPDowUF8HYkWvh+PHGgFQe3pApjDSyP+drG11JAyknHhegNk6K3EJ1l0jPEgkMO97c7NYixXVR4WrSzL5W72JeqzYwnvodpdJ2r7m59Vv8A3E6Zi02lM+s1OzQabTaeFWd5XfWahUUC3Fi1gP3muZ7k3q4CcpUSU3xeTHSXXeO21ioxWluK6WV93XZd22bcH2/e9Bqdp3PTRp72j1KNFNHGyhkzK4BsVxF66+1ehejtwalF7q0ooJ25W3syTT3mQ2VoQUja0QLHE3Jx44cMa9DAgtnZyUYNEwLBsSAcOFyPOgPVWIrlWNmIXiMWIIHhwxNAeRrJcF4zkA+PE4m9AZKSPIiNdsrWuQcRe3D8fCgHVIMRRfyZmBW1j6b/AMJ+NAR9SJHjEViHRmK3INl+WJvegGpNOPbKrIDMl2Nr4jwAoBcZEKM1w8htYnhz+eFAIKvGwNr2ZWDMPAgnjUPUCz33VIk3XnTZEgIPT0eYkEeoaqc2vXIdyn+kuf8AsfQi/wC8Xv49nrZX3WrIOkhJGSYl10wnGBAPtDKRfx8q6/dKOGpmK6PZn3SBVN7OCxW2C2a5xrNjcYbCJf5T1MczNl10eYenAAtcn4VCIjrMZsJmk3jSLAc0rSJkAt/fXxtSeoyibBv8StuW72e+TUTWLXJY5jj86iJ5ssX39Yf4H7FRoRJl2Fy6lbC40mhFsa43uw64vGP0/wA0i/zjRYw/Z6olZIyYyA/CX81+I8xy5+FdkUAwIM0i+u0QGZ78gORI8qAW8VnSRCHh/MV52Fja5vQE8F85lPHN6HNvyi3hwoCPLYyEC+bPlOBANgOJ4GgG9VFksqgu5BsONrfPyoCCim7GWNj6cTiR4kkcsBzoAYfnaEWfKTlvcXuQDfCgJETMoIWQe6Ls174X5W+FAPSQZgxJIeQn3UzXVhYC/iPhQE7cOn9+0uzaHftXtGrh2PXH2dt3d4XGnmIznJE9gpIyNwvwPhXlDEW5XHbUk5LWq6Vxo9JWpqCm09l6nuFqO8e8yT9lO1mi9hMmmXayoXNiE2txzHO9cL3duOWb4pPc2vXOlzaCWAsPf2fVKmJrVKlUXOosCALZSeXj4gV35ywwNHFnJiYmP0jKbhhfHAE2tjQDy6SEPIZVzRqPRibnzw/cKAjMiQyFo4iSSREo4jlc8QbeFAS4oFWPFfWwIkzHG54H5WoBi4CqCfSMeBF8cbCgGzOI3jUNZwqhLeB+NAeMM5zk2fCyEEAjwuOGIoB6IPGoMSn1n1Na9r8SLf2UA7mVjZDlYE5wbnhxt/XQFw+4fS279Xdj+wcezQRTNt225tdqdVqoNJp9LG2kjVWkm1Ekai5Ww51xGXYy1hsyxftG9L0JJybe09SimdHi8PO9hLGxTQtNWktXCV8k6L6O2ZAepu5W3tMbe9oOm9PNvEtzjYzn6fTA4cRI1dE8diLnurEuObUFyeNLmKn4a1Hy7q4opyfUucZk37tns7ouy9Ibj1HOgHta3qLX+zC2OJ+k0Cph5GU1Dw+Ou+XejbW9bjV/enX1SfbYaHk23J78n+WNOkabuZ1VEjQ7FJoOjoTgIdi0UOicg3Fm1IDz4nmZKhZJhpOt1Suv/wAknP8AD5P4SXmV5KkKQXopR59fOadqdZuO4Strdw1ep3PWSteTVauV9RJ5nNIWOFWlu3G0tmCUVvJUXMaU5ym6ybb4dI7GsUr7FGyMzHetMCLFgTmTlccaxvuluXE+gm35S40dd7u7JP1P3k2/pvTSRwajdtHpY4dQ4YrGMsjEsBxACnhXN5HiY4bLZXXpUW30FpmFp3cUoLdSJH/LlvCqpj6l0qtYhwYnxueRB5AVj/ldrzHyon6NPzkOr9u27qXI6i0jXFluki5h/tWvap/yu15j5h9Hn5yNB697R7p0Nsj79q9y0utgfVLpUSEOJAZAzITmFv4cbGrDLs8t4257OMWnSuk1cVl8sPHabTVaHCckjHOcLsDxv42q6NElWESBgb2xY+PiKAk+4+VSsntgi6k39N+NAe5nkJzJdhwxJ/ZQEiNiGjsxR4+YNrHywqASY3zZyJGBkHqHgbc/9dCSHJK8JCs4lHAkcLXuLY2qSCSjsJTLEmdkcLGWAGPE3GOFqgkymoNoyfcCiVrlbG4txNxbE2rFEshS+pfS+UByFjtYgDkRy8ayIE6Zik8qiIsgX27kghbYgWPC9GBZzyjMoLAmzAcAeQvypqB60ITKLMwYAyLgxw4kEeYtUVA3A0URklUmMKbAXAOa3qtgeN7Xo1UHnvpMI0ijWNhYtx/hN+d6mgIR1MjXiVCtyQSLZbHC4tfwqSBxIpA9nOQKFJF+GGGNud6ioJkc3tmNbXkZc0eF7HxAHGlCRz3JWJKMCEvaAk3JwuxNRQDZXKzSFDZLXbNe39L1IHI3UBoldkDrZkvdCcbE/uqAe6lG9rT+rK8bDOgOYED/AFUTDLFdC90u3+x9G7Zte6bWZN30MLxav/hUkXUMkjvGxka975+YwrlMxyfF38TKcJeK3o0vRoSeguMLjrNu0oyjpXBrNy/zn7bNpYXk29xM+T3tL9IhCZyA9yMGygn+hrR/x/G7TpLRv15DY+pYenk8x7L3k7Xr7by7az+1hGg0SGy4em4HA34Dz+cLIMf534iXmWH83mKvdE5NT3H6YmaMj6jfoZYogMFUy5gtgRaw424V1uY+Lg7i3oPoKXDab0e11m492pEPcvrWKRMxGlU5xe9jBER+HOtbIPkbfh6We2ZfMS/bcM710V0/ZHtV6P0yz+kgg4pI17C4/t5VpZbpzPEeDpR74rRhLRkNJ9uu8TaWDUP1DpYZdRFFME9pyqZwHKnG9xe1ec+9VqMmthuja1mUcnm1XaRKX7dd4uhbqTSkg3ZvbkuDflxuP66j/K7XmPmJ+jT85GN3fsBvWh0Wv3M7zoZ4tu0suqkhtJmb2VZyFJFsQOfOvWx3ns3JxhsSW00tzdPO5lM4RcqrQqlY5c80jsv5RfKSfL+yulKscijspYm7WAHkPnQEmOUlGsbWNnFjjagF+5I1lciUH+O54+GPhQDiYKysCuYiy8BYeOFATFkLOjGVyyC174kWFQSMzvJEzOJA4ZrquNwR42NEQeI6yiIZbjKWdSAMFPIigMzG8jQLNIVjdIyGFrg+Awt86xMiJf0lQ+X0Xc2xJuRcX4gcKyIIqlo5YLIZDf3GUHA2sLledhjQgmSM8juqizAXCqPxNhhTUSJ9kqpkxD39Kkg3uMBbiLkVFRQZCQ+6oymMopMhb03FuGPnytUgck1kTGRcueQsMsrYlsLeQqEhUhyzvAxjClmCgBl/HH8PCpIECOZsrHASMTfxJGP4VIJausILMcyXCnmD5XqCSS0sjHKH9skY3BF1BFltUUAhkeQrnj9RJuoa/DCpAJKqMsis6Pfipx4WykW4G1Q0B9lJg1A9wLmu0UgP71J8saVB1ftH1x0n0hHvUHU2jaabUvBLoNUunWcp7aNG6er8tw18OONUWd5fiMVsOzKlK1VaFhgMTas7W2q11HYdL3m7auk6yba2kRJGTTqukjPuRjENZRdbm+FUc+7+OVKSrv6XrLCOZYfdjTwAvePtm+nHu7aUWQK8sZ0aH9TC97A4r4/G3meQY5PRLnYWZYemmPMVi7m79tHVHVWu3jZtM2l2h9NDHBF7YiJaOMB2KiwGNdXlWGuYaxGFx1lV8OtlPjLsbtxyiqI6t3bZYNg7NxtHdDtqKqEEEER6fiLn8PGqjIXW/ie31s3cx0W7XZ/cf//QovunbfrbTJqtbBsZ3vRK7n+abFPDucBUHiTpHkZb/wC0BVXDOcI3synsS3ppwf4qLkZuyy++lVR2lvxpJc1TRZdO0U0um1CNHqIkOaCUFJVP/QYAjzvVnFqSqtKNNqjo9Zi3H6QAjBbNgMTa2OI8zzqSB2CNY3RZcJDifHHEEkHDjQGf2NEbqHpySSztFuWhvnHH/iYzcX+FeOI91PsvoZ6WvLjxrpO5/deZk7wakOQ5TaNBcr+W+fUcM1zauc7nfIfbl1Ftn/zX2V1lc0mDKcy2ltcW4kAeHK9dSUpI9oF8j+o5MwDcRe+IGHKgMYw/TI9sMc1gMT5m453oBt/cjKe4LyNZrE3wNrC1APxyuAbHAqQvHEEWINAOjUSK2UZGvZbG1sOBA87UBM9+yWYWjABubWbjz+PK3CgI31E7yKNOS8YUG9rWNr2oCK2VpEWU5QT6gTgAcbX5X5+FAbh0RCX6y6QiUEqOodtUAn0lhqoxjzNgbG1aWZfK3exL1WbGD9/DtLpRZ3vnoE03fXtgkQMHtHaMpVc1gd4lYWx5Xt+Fcl3b0ZTfrubfqIvs304619n1mca7/wCsl1XdzqKRpBlGm20Kz8TbSRg3uBzJq27oyrllp9r1maOfKmNn4OhHH5MzJ7uCOxuCBgL8bc66QpxhVkkQj1BwRmseJN/ljQGQ08UlmdiodTkyAYZTyPiKA8khnzxZGXIt8AAlifLlztjQDqlmRY3XK0JCkEhrY4c+NqAU7oVclhE3ukPcWxGN/wCnjQERJo2AUnO2Y5bkXsTjf4UBLYKzAtlCAFVwGF8PnhQDM8apFkGNzfM3E25UBjgTLKI84HqW3I/mt+yjBaH7q9PJp+tumVR/djHTkarNf/77nvga47uTGmEn/wCx9CL/ALxSrfj2etnANZA7dIQyBh7Ka6cLzuxiW+PK1dhqZSQ1GM6QjZ9zgK+so+cXF7WVrnA1mzHcZ5sEMjbV1MDlYLrYnYgHCzHHj4msRHWY3ZIWl3fTRhrFpUANr2OdeVTPUZQM71Eko3jdlNjK2omEqA/xXPC9RE82WJ+4DTNF0R2Mmaa0jbBZoyfykaTQ2x4Enwrje7MdnF4zt9cjoM4dbGH7PVErFp2DlGaxCm/ljyFdkc+ZFooxmJ4yCwQ8L8cL0AmZkCqZQDjZ2FhYW/dQDcUqPIxMoWziw4ixww+AxoCR6XNlX0rKwItzsLkXoCNMNRqAzxi17IrXBuR5XOIPlQEgQuwILL+oLMyriR4ZgcaAxzRSlxc+hWyo6YXA5fIY0A2mZpACbRk4rxubYm/9tAPyO6jICqZTmFxi3O1vDCgLEdWTS637bO1sEkpH026yDIFuvDcbEYDljXIZbKue4pehH8hf4tUyyw/SfWb53s0CRdkO0epSMRmRtpvIDZxk2lgo424i5860u76/u+Jfa9dGxmj/AENldn1SmsqIELNhIHyZDxw/MCPne9d4cwLR9QsbGG7g45jxPLl/S9ASYtSGyXa81gWvYEYkWHI0AmXUSCzBACQAwa3PgfLzoBgTPa+YYrlJHEi4PEfvoCJJI2GYXOF+QHzoBYR1eMvHmjbFPIG9xccPGgJkEat7zMqkKMCcFvwuaAdP6YRnLFHTNc8DyoCM0rOwVVstxkIt4+NAWo7sIZvt+7BiXIQ8TFAfzKRowD4i2ItauQySv1XGPh/MX2Y/JYfi6ir0uT2/USUAXKLcPE2vjhXXlCY8xskiPkDQuQy28jY28L0BMhRC05cLlRfzE2XjxJw4UoDYdn6a6j394hsex7jvIdTdtJBJKmHjIFyj5nCtXEY7D4b3tyMeNpPk1ntaw1295EXLiRM37pXeOnJum4d5XRabVard4hFotPrdPq54MjxerUJp5H9snN6QxubGvG3jreJtzdvaaSelxcU9D8naSqek8NOzKO1SreqqbXHTUbR3x1us2vu1BuG0zSwblp9DpJdPJFcusnrClbXvccv6qrO7sI3MBszScW5V4tBtZnJxxNY66I1Zut+65El903mNiFkcMrgWv6bXGAJH7K3lgMB5sDWeJxG+ySvV3doAB9ZvsQNmW0UlsPPLgKxWCy9/ww5ifb4nfkYTqrqPrLdtvGh6gm3J9PEyuiaxHCGUAjMCw42JtY1sYXDYa3Juyop8G8ed27dkqTbpwnPUiCxs2U+5lxBxGNb5riXJiVVKZixAuPPzoB2WNRGp968hF7AYAeGFQAgZcY2jBDWZmbjjbh4CpBNWNYkdrG4UgG1wDw86gDgAYQieQM0RxCkWOHG4vQkYOlDAzMxsy4CwPD58qVIoIlY5CyMWLWMqtwPH9nhQHqxyqTPJchgSwGFyeAtxwNAKR/dd1DFiWAlN7MSpwtbA0ACMMGDs0jGxscASeC8fCgJ+niPtq8ZK42ltZiF+F6hsyRAm076MqzyiQzAuijgDfg5P5bUUqkUoNFmF5HXJk/Kg/u8zmGB42FSQICq7h2Z7YMbk/Ii3AeNALRZmmLXzo6Egk2IF+JPPhQGSmhVRGLrlKZs/ne4GJx41CZLEwSxo7IiCMqBmkPH1Y8vHlRgjSSKsiyLmZXxyC+JvhYj+ypQJ8UcGvUysER8QTe1r+HmKxb2SdYuSNkMaRhYrDOwuAvpFrWJH76VBEls7llmYtI2L+AtjxthWS1EFlOhe2fbndekti3bedwB3LcdO7a1DrEiCvndSqqSCpAH9dcjmObY2ziJwtx8WL0aK7hc4XBWJ24yk9L4Tah2i7UglBuJzBrG+vjJJGGU+OPzvWm88zDXs/hZ7/T8N53OD9oO1c7x33h41Vjgmvh4GwI4Hhx+dPruYJeR+Fj6dhn/FzlaOlIYo+5PTMMD544t+hSCU43RJ7A/9YAV1mPk3g7jevYfQU2HX86Pa6zZO7CovdDrdVBIbSoZF8zDETYnDwtWtkL/Q2/D0s9cx+Yl+24Zzr1EHZLtQWJz+64W17WZZCR44Yf0tWnlrf1PE+DqPfFL9Ja8JqWl647pGHSfTbnvCwIiw6N1V8hVVstjl9VgL3qwnl+BbdYwrrZrLE4hJUbJEPWHdoxhl1u9tGAV95I3cHlyU3ItWDwWX1o4w5iVfxG45Ctb1f3HbQT6TctXvL6XUo8epklSTIYipVlbCwBHHhWdvB4FTThGFVqpTWRK/fcaNuhyWOHM5Lgg5rrbhVoagG6B5CoIubC3hQC0VXhMjye3/AHYx4nG+H7KgDcTe24LKJSSUzN+XDy8akE+KGMnMFNjjlXH4/tqAOKc6TK8irHKSYwtgQPDyoSJfTrM11YqkVsOPIX/GlSKDdggyo7q8ZIiHAAY4fGgGkinmAYenIbLlwticcaAd94GVApsRcxqxsADe+IoBWSzKHdwLAZccBa5N70JJGmhBzhBkdReMZhifHj51DYQnVaWQFtY85CKVR0y+vHiQt+F+dQpbgoQwzygDKFSxswNyxHAYcD8ayA2xEtsWwuLXOXz/ANFCBTK5MftMWSNgMrX44nibkVIMmsNoMxtnMmVhcm3jiTbC9Y10kjSNFE6D2xIXPpc2AsovhUsBqZFYlw5LJbMwGBviT5eVQgx3TtFq7QSIq5FGXOcfHE+HhR6NI1kl9OsETCMLdjZZFP8AftzvwFQnUlojT2ODyZniVlyqQVx+F8fhUohnYO0/RHSHVOm3/U9U6/259vngXTRtqFgBSRGZ2YHjci2BqhzvMMThpQVmNVJOuipY4DDWrqltulKbp1tu0fajOT/MSpkBYAbhGQCxIzL4Yg4HCqRZ5mFPJ/CzfeX4bzuc9k7RdrHj9obq0eYDFdfFfEggi/4fOiz3MPM/Cx9Pw3nc5WzuhsOx9OdR6nath1Da3bYdNBKkjyLKc8iZmXOAAbGuqyrE3cRYU7qpJt8GplPjLULVxxg6qiOjd3ECbD2WbMTL/LY1uAbEBNOfO2J51V5C638T2+tm5mK/l2uz+4//0fnKranQ7jqZ9BPLo9T7hZZ4XaKQFbkEMuU/trG5CNxbM0pLeaqucyjJwdYtp8Gg2r/NDrAxJHvWs0vVukHpj0u/aSHcWy+AmkUTjytIKq5ZJha7VtO29+3Jw5l4vKjcWY3qUm1NeklLnennHdPvvQW6l/5x0RqunpzYPrundcxjzX4nSa4Sr8hKKhYXG2vd3lNb1yP5obL5UyfbYafl23Hhg/yyr0ks9H9GbiGfYe4+i0ksmP8AL+o9JNtjAnhbURfU6f5llFZfG4m376w3w22pr7r2ZczI+Gsz93dXFJbPPpQ9B20632/XbTuLbBLu+0Ra7SvLu2zTQ7ppcizISxl0TyhQLXuwFqiWbYWcJRc9mTT0SrB6t6VOYLA34yTUaqq0x8Za+Cp0D7qU0/8AmshjYOr7BomDXuT+tqRicMbCqruZT6fo899CN3vB819ldZXMRFZGyg3dRa/HAXFuHh411ZSEZz7Z94+PoUG5IvjcYHnQDkLzPIzlFisPUbcTfn4UAqbT3nuvoV1OIFyTaxsBhjQDOQquVlYEiwblZbm+GN8aAUPbYgviAMAb4luONALYyyLkLCONmAfDjha3OgFmCICwJUKCwcNY2sLm/nb/AEUBEZAzZkQFbfmsRfH9/wAKA2XoX3IetOkXRzePfdtdE44rqYyTY1pZk6YS6/Ql6rNnB+/t9pdJ377m9XND3D6S3WPUTaPXaXY4J49ZASrrImsndZFNxZgQLEYiuZ7lxVzATUlVOTrw+LHWXHeJuGKi06Ujo5WVu3DXbjvWsl3Pdtfqdx1s4VJdVqpGkkKquUXZiTgotXXWLFuxBQtxUYrcSoiiuXZ3ZbU22996SJbI7KrFgpAUjwtYEf6q9TzHViYC4clSQSAMRyI/CgEQMiPLd3dWuABjjbEcjwoCQZ3DKqoZVN+H90eZ540B5f8ATk9JQE5rWv8AlubCgIM0wQZnDRh3LZ7DibY8bcBY0AKdOCWYmyDBjiBbgeV7jwoCVpyWUZrjElFbiAeGONAeyy2Yq9siv+YnGwFhbHy8aAYZFTUaaRFBRpYiGI5Z15HjeolqfEStZYn7q9XPqe4WzSSKwH8khAVjgqDVaiy8OXDGuO7jycsFNv8AqP1Yl/3jio4iKXmrpZyGeMP2+0koUgPuOoJF/IAD9ldklVoooamYPo0Fd2gC+hixBH+zkas5EbjF7GHXZ+p/VYHVxBvMFzWIjrMd03FffNDlU4zplIPEZh41M1VGUOoyXWX6fUm+Ropuurck35MoJtWKPNnfu+Wpm1HbjsVDIhb2dpcRlrflOj0dlwAsBx+NcX3Zk3jsanuT/NI6HOI0w2He/HqRXH9OERqLe6SGynAccOf4V2hzxJDe5GWfAXPPlx4fPw/GgITMheVJgWJ9UYPMDhb4GgGDLFGUCsxLGwW3G3C4NiMaAnws3uD0spVmltbAljj44njQCjI0SsUhJIOLeC24WoBZlWxzls1rCwxGIsD5mgIsCEqQrs7BjmB4fAnDmKA9ZChsXMhY3LcBf9lAIEQdFOcktdSOeW/Hw4mgMjqN43bVbLD09q931020aJxLotreVm06NZ7sqE2VvW3DxPjXhDC2YXXdjBKctcqaXxvwI9ZX7koKDk3FalXQvAWt73TSnst2q0q3SBI9okAtz/ljgsb8ya4fu7J/WMVHcpL1zpM1X6Cy93xfVKbrExBveRje7Hn/AK6785YlRxxuCrekqt2jFwCMBjzJuaAW8eV0lhcRyk8PzA3N/P8Ap4UAlirgiUWGIBxuOdsKARmGYMbkqLuovxOBIoDwwNlkOK2UKobEG1rXIvY4UBL9to4VRLK5UlgRclrXwt/XQEH3mKiF09tSeK8Dh43+FASo1cK6mxy4NjcY4D9nhQB7SIi5r/lNif6uFAW37i9Pbtv/AGb7CaDpvZ9bvWvGgWWTT6CF5zEjaOMZmCr6QSbXYiuIyrE2cPmWMlcmopvddP4mdHjbNy7hMPGEW3TcXAcSbtpuGhZf8WdR9P8ARlhjo9duCarWAc/+D0H1Mot4Nlrovq0J+5hO5xRpH709lFV8DKPvJRhxur5I1YhtH2v2YZW3LfuspsTk0eni2jTO1if97OdROR4fprUbWYXdSt2lwt3Jci2Y87FMJDW5TfBSC5XV8yMcvX+n24qnTXQ2xbAOCa7Uwtu+qHn7uuLxg/CIVH0qVz3965PgT9nHkhR8sifjlD3duMeGm2+WVegx+7dY9YdRKY986j125Qwj0aRpyumVThZIIwkajyVa2sPluGw+m3bjF79NP3np5zwu4u9d8uba3q6OTUa/HF7CbIYj7Ug3aFoyMMQwNwLVs3tMJV3n0HjDRJcZ1fuzvUfTnevQb7JCdVHtA2/VtpkNiyop9IY3FycfwrnMlse3yx2602tpVLPH3PZ4va3qM3Qfchsjxe8vTetxYBkMkd7E/gfHE8POtD/FLn9Rc5s/WY+aO/8AMbsV0H+HNaCzDFpYwADxNwCcPhUf4pd/qLkZP1mPms0Xud3e2vrTpp9h2/bJ4JDq4dS2smdCo9m9wFFyC17ceFWWUZFPB3vayknoaouE1cbmEb8NhRppK+xwPMrFypVzkbE2A8yK6RsqxnULlkjQjBQFJAvhfj+FSQOxGMqilWbMSMB+W+GA5jCgFNJGi5VXIb+u4BJHLGoA8sgZHVD+nb8rAZgTjQkVpYVAV5bARlrn+KxFsBe9sKMCEkEJLxpaJQUlRja4YjlR6SCKZFzZcvt2NySL2A4Cx8xQE9tQhDRwxllePK0jDEX4E/C9KEkNUf3WQHJlLFQRYkgWJJHA40IMxC+RB+mJHYBbEYeJsbeHzrFkoAjaYqQwySYAAEY8r3JprGojzxtqJDZzGG9bFSDY+DA2tjjUrQBcUahCXb3hYMA4tgLYC+Fr40A82mkVEaJiACZDxve1+YtUVJoRY4zlb1KxAOZycpwNrWsakglzadQv6jLn06hcMSwYXNlPLjUKRNDA4+5doWUBrK2THE+WNZmJPbLI0YWM/pLcAWytcY3v51BI7HqACSynKgGRMoAFhgcKigCdzOY3wBVBcIv5r2scMOBxotAGpzAsYU8S5JVRh8TxxqQb/wBPdreuuo9n0m97Vo4ZNt1ZY6Nn1CKzZHKM2UnCzA8fCqvE5zhcPcducqSWvR4TatYG7dipRWhmwRdjO4n6n6GmiUHBX1K3bzGUt41rPvHg1uvkPX6Xf3ucfXsl3IiQpp9JomMhCvGNUoBHHAm3Pxp/keD33yE/S7+8uU0LpGDUaPuH03FLeDV6bfIIpkvirJMEkF/Igi96sMe1PCXGtTg3zGth01eit3aXSbX3S9s9yOvA74iLAjAAe1FYXx4fvrXyL5K1xdbPXMPmJ8Zlevc7dme1QkkuxOqj8ThmCnjwUeVaeW0WZYnwHtivlbXhN02T7htn0u2bdtz9Pav3tt0UGmMnuJkYwRqtxYXAw4VX3+7FydyUlNaW3ymzbzaMYpbOpGSX7j9jMYZumteuH5fci4+BtgK833Uu/wBRcjM/rMfNYzuf3BbHrNp12ji2LVHUa/RzQLG0iZEMqFBmwuQL3wFZ2e69yFyMnNUTT3a6GYXM3jKLSjrRUmOOR2C5gwjGYAcTb4c67Nso0e6iH2Y8q2bM2a644niMahARCUVWuCxyj02sCePH5VIJBaKO5VGDMAUZlGBOPD4VAFQzC65D6z+e4GU2ucKAEhMkkobKVYYFsBxuefHChI7KVEx9gESXU5z6QcvH91NwESacOxcRBWkGAF7ZjxPnwoQSYtRHHHH7amaUNgCLcPADyONCSNMrF81igluWOXgGbBRzNCDJaY+3cyDPlbMBxHzw/wBVQ9JKH2jck6lcsTC2dQOHieNuVRXcJGtQzSquU5WPpBU2axxuAfCpWggbgg9tsplLqrWCt+W5tY38RSoJC6fMkjxAJ6cmXG1h/wBEWx8KNihH9txMVd87ghQrnLblckYG1qAlLpg8QSR0CTMzB78Cn4XPGob0k0MLqQfdIEJZf4mCjjzt/bWRiPgo0AjCNeQ4sBYi1iAQT8aAfWTIwjylFDHMAq43A5ihI7LN78RiACjOApAuwAtcG2POoSAzeNYmaTBjHbh6uJw5+PGpBsnSPRHU3Wja/wDw3p45Itu9sa15JRGFMubILEgtfKa0sbmNjB7PtXTarTRvHvYwty/XYWo3aPsd3FdkJ0mngLLZmfUplAGGU5STh8K0Jd4sGv4m/AbCyu/vc5KTsh3EhYyR6fRGVQSjfUjEjhmwH7Kj/I8G1rfIT9Lv7y5TmPV3Te89M7kdq6ghTTa9IElKo4kVklvkYMtwb2NWuExdvFQ9pbdVWnIad6zK1LZlrOw90mL7P2ZM8hZm2iPNzOa0F2OPyHzqlyNUvYmnn/vN/MPd2uyf/9L599SdPb909rdQnUPT+4bSWlcRyavTyRKRfijkZW8cDWvh8XZxCranGXE0+bWet2xcteXFx40a1EqMfeiBKhiY1Y4G3G1bB5DgDq7e4qi7CwtgCpvj8KA9knOYxhVGa3DG3MUBM6bmn0G/bLLoNbPt2qk1+lRptLM8EhV50BBaMqcQTzxrxxUI3LUlNJqj1qu5wnpZlKM1sujqtRYj7soYou7qxRErFDsOhshvlN5tU1/gMMBXOdz4pYHR576EW2fOuJ+yullbZSFJ9xCeAU88RytjXUlKMRxo7GSIGwb0qxwJFALs4ds6KAbejwIN8fgBQCptQVzqAoLrb4c70BDVrgl7EMPUzNb4hR+ygJIKIFUNlBexbkBzP4cqA9kSRYlCi4zfqYeP+igPEijkVfSUJHpC4YeHnQCwskYIyIYm4Mcb/D40BtHRECt1l0aCFGffdv4D1G+qj8a0czX6S92JeqzZwfv7faXSjt33RwGLr/ZY3zM/8giIDNmvbU6gXB5CwvXPdyo0wUl6b9WJbd43XErs9bKzSEXw9GHqAN8fLhhXXlAM+4ZGWwzN+W4JuMbC340ApVBNvXmTEmPiV8PAUB7II4nT21usl/cJAuDawNh8KAku4TKzH3QoFn5W/wBNALJDLmDApxzAYW44YUAxMMwC5Rc2CyNjhbmLUAyEQOFYjLhfwJXh/roCUrCy3X0C91HD+nGgI5WJ0dGBW+JvhicQPxwoBcYypp/djyN7i35m2blUPUEWQ+66MwdwthLIFv09E4XC7X1WoOBFch3KVMJcX/kfqov+8Trfi/R62cduH7d6bNgE12oyg3sbg42GOFdgtZRRMF0miPvUJaRUIBbAEXIVhb1AeNZMmugmaBVk2fqO7rHk1KMoAtmIY2GP9VKGMdZjOl1U71ty5lsJEswDAg51xxAFHqM0x/rCTN1J1AGGUmdjmfgCFHGoWs82WI76RCLt/wBhc8eUy7IWANsR9Job3t41xndlfq8Y9+f5pHQZw/5GHXo9USshjH1DO6e2FH6JvxJHL5YiuyOfHIyln9tGucUvbA/0F6ATKVbMTZXWxRrY3t/YeNANBACjgKVGBQjHj440BMGJUYKbYJa4sDhbCgEvIgIjIDs3FOdvOgGtS7BAQRI5WyIRwxGNAeNFEABHnAN2fKLqRe+NvGgGTfKXVbryFza3HGgFCTObBsEFlxw/1XoCQQpjYhbKq3LXub/CiBbzvPpSOx3aiVi1mG1hM5zjHbJGNgeAxwHlXA9340zjEvt+ujqM0l+gs/Z9UqHlaNyERMx4Dlj5mu+OXE+xhmlBB5hTx+PxoBuzCVRClmuozWtdTwvQDklkYtmtnb8trXBvfzwNsKAZfIGLixZs1gxthz/1UAmKZonNsRYjKxuQThx8KAll86IQqYXKniccL0A2IpGjCOqgXv7gNsfDDzoBEfsqShR2bMVbMfPA3/ZQDzoXjTMfbONm4FRe17cMPCgLUd4Zp9P2F7BHTa3U6RNx29Y9whjmkjWYJoosokVWAYAgkA3AvXH5Nag8zxbaTaeiq1eM9W8X2YXJfB2KPRTqRU2LJpyzQqoQkWtiDcEXvYV2LdShJfuZ0Q5UwNwRieY/fUAbEchjKOqhb3MgNjccvxNAeQqjSfTpFJPqGbL7IBZjfAWC4nywo3RVeoLS6Gza/pvqHbF6Ufd9m1uzR7tu6rt0mt07wCQIYwxRXAJC5xjatP4yzdhcVuak4p1o06aHvcR7uxctuO3Fqr0VVKnRe6cGyarvVsWm39lg2LVQaRN11BOQCMiSxL8gDlx8Kocmldjlkna0zTlTmLDHqDxaU/J0VN7HSXYqHVafSiTQvLOrKlta7R/pj1FnV7At43sarvjc2cXKj0ejv8BtewwSaVVyklul+yLzvG0u3O8eRjEurYKfcvlwRhcWH9L1j8ZmtK0lybxPsMFXWuU5R3X2LtptPTemHR82nk3Z9wVGSDUmZxCVkL5gWJwYAXPwq4ybEY67eft01HZ3qadBo463h4QXs3prv7hwPTxHKqD057hjfDD9mNdIVgrU6YgB2cXDKcCSbcOA8LC9ExQVHE8aI7m2a+F7g+TWvb4UBBdzKR6coz2GYY2GIJqSBwP7YZjnuR6TxF/20A+iqVTO5VHYEE8iONwOF/jUAdYRrfMCrSg+k8Mf4m+NAQnT3vztmy4NIoxwOF/9dSBcDxRO0RzuHbCTEWscOHKoYJMsmVRZQoQ2yKSed/zHj8KAl6eeIj9VCQF/RCMVseH425VDRKZI1I02oyrLJnVFLB743H8JN8ahVRJiZGYsIo8xVR6hf08LsBzrIgzGkKxgtKAVWMe2hsDwPEeHhhWMtJKIsutb22IWQiTMMpAUDmTytRRIqKeI+4gVjYKAFuRc+JwpUUJTacy3DCzRKUUNxx42ta974VG0TQxrxP7oVbBXC5GJwFrnjytzrJMgdkmEKgLGZHcAhBxUm98OYpSoARj3JJFzZfyhVxzLa548bHlQCJXR3VB7iDKcpIABJOF7f1UAw+lLCRxmZ4gBKrcb+ONr41NQdH6X7s9b9NbXotj276d9r0Af2DJp87AO5Y3YcRdjxqoxeSYbEXHcnXafCblnH3bUVGOpGzxd7e5RV2EGmkjVyCx0h+NicPVbjw+Faz7u4Lh5T1+p3/2QtO+3cFQsfs6R9U2Zw30oIyg4WUEYA88fjR928Hw04x9Vv8HIc66Mmn3LuN09qJZAZtXvUWo1EtsC7S+65wGFzc4VZZglDCTS1KDXNQ1cM3K9Fvdkbd3ca3cjq+NEsG0oYnLiT7UeP43+Nq1sg+St+HpPbMffyM518jQ9k+2gsJJld3VgOGdZGHK3MC3OtPLXXM8RvaOo9sV8paN80XS/YqLZtv1+o1OkmaSCCWc/Vs0ueRVVlaNWuMrXuLXGN6rrmLzV3ZRSa0vc0cptRs4NQTb3t0zs3SvZKMwwtNtyCUsqZNYb3Aztdsxa5A544251rxxuaurpL7vgPSVjBrdXKYDqTpjsxotj33V6GXRR7h/L5pNDCmsdnMyxsYsiM97luIHGtnCYvM53YRmns7Sro3K6TyvWcJGEnF6aaNO6VEgRlLPlOcWIN+F/IV2bKJE2TSsyYuLY5fVa5Pw8bVFSaEeCB8hbMciBcrfxedl4/OpqQNzyksyhfypfPyJ4YXt40AlBkyk58q8cv9n9lSB2Ns4eS7ekENaww5WFuHyqASMsSAPclUACyDAsfAUBGkGdmjVlYE5kQXut+NuPzqQMp7WleNvXIMtsnC1/nQGRLrk9AChgGzElifLHhaoJDTToQFkT9O/6oBOYj4/AcaNBGTkkhkhMZc5HbGNmuVBv6gawSZJiZxHp7xadmIzELYi1haxPEcedZohkvRqwy58EzkyX5m38PC9RIIkz6wCaQxq6rGRZUClTY8L8+NYqOglsigGWFXuUaSQlzfEWNrA2IrLdIJiws8aROPTJZrm5U2JtjxFY1JoQtTC0ZuoBs5Mg+IONvA3wNZJ1IZ6LQRhnxZbqUBwItfA4i48KawJt7/tPlaJhmZuN1IPpv5250B7LIqplKyqSwDkAA+f9DRAZ+n91lXMxLXaE8io4Wva1TUGz9I9ddUdDtuEfTwiy7k0X1kUsXuf7rMFy2sQfUa0cdltnGU9r/Dq001nvh8VcsV2N06Gne/uRJLeGLSyLkzFfpC1sv5jhb0/18xVa+7uC3a8ptfU7/wCyFjvp3BhLnUQaQ/lSNPprAOfHG5J8L0/xvBvf5R9Uvre5DlfWfU+8dV7w27b1kGv9lIMkcYjCRxXyjJ/1iTVvgsJbwttW7fk1rv6zSv3pXZbUtZ2fu0p03TvaJLB5E0EcbSAcPTCLYj44eVUeROt/EP0utlhmCpbtdk//06AaLrnq/Zp5tNs/Um46bRSyMraH3zJpyQTYexLniIt/s1o4nLMLidNy3FvfpR/eVHzmzZxl6z5E2lvbnI9Bmf8AG2g3J/8AxN0LsO7u177joI32bU8cSX0ZWJj5mI1rfS52/cX7kOBtXI8k6v8AEe3xsZ+8txlwrxHyx0cwr2e2O6rbT7tvvSOolwy67Tx7ppQx/wDntL7MoHmYjRTzG15Ubd1ei3blyS2o/iRGzhJ6nKD4UprlVHzCU7Y7tuGU9J77sHWSlbJptu3GKPWkf/gmt+nlv/0VNZfV7cPfwna7Uax+9Hajzj4CUvdyjPienklRmG0/Tm/dP9T9PaXqHYdx2CT+baG41uml09ydRGMDIoDC3ga2HirV+zN2pxl4r1NPce8eKsztXIqcXHStapunbPu2n/8AlfJKFr7Bt+VGwy+vUnAn9tUvdH5Bdp9RYZ78z4F1lZTJnkTKM6t6ScLgi9svKunKcdWP9UnxJItgo4CgH/dQiy3u5ys2PnbhQENQMwVDdY1tdrEkY440B5KoF2iUXuQoBuBhYX8LY0Asf7sq0hJB9KkYg34DhgaA9MzlLDKhwyquIJXhfyoBMkrOI3W6cSQDe5GGHl8aAfgJI/UF7sxyg8D4ECgNp6EkA6y6NeS4C75ttzm4KNVHcXNjfCtLMvlLvYl6rNjB+/h2l0o7h91My6jrvZDGF9WwxBSW9TEavUEWA41zvcqW1gpP036sS37xKmIXZ62VheR898joY7IYmBW/C+YcQa68oAY3c2IA4ljgAOIFuflQHsLFGBBBLENe3hxDYHxoD2TTYqR6wmN2sAQBh40ApXBIhC2VwS9yR+F8KAejjkVWH5kBzENYgeq/7fjQEebO1sj5C1wXFiMLnA+N6AZRWL53fO6m5B9IYeLcACOVASXVFDEEKcSyYYX5XHOgPGAuQuYgKMCPiceVAOe4sWQEe6xK2YG4FyMDaj1As392/wCt1702VZfT09Gc18TfVT2uD865Hubpw1x79x9CL7vBovQXo9bOH6pjH0Box/GdfqfUuGBHCuvWtFJHdNc6Tb3N40zvcWc2uOeVrVkyNwe2uc6jZ+oxJxTWRe3hzDmsSI6zH9NysN60Cm+VZkBHC/rXCploRlHSZfrKNn6i3whgF+ocoMBjlFQtZgyx3f8AnQdB9hRlzKdhf0oSbA6TQWx51x/dr5nFr0/zSL/OPc2H6PVEq04JYMDe4uApBy42t5V15QCbKQmJGZbEnhYW4DDGgPJI1K5VNlY5jMpGYcL2AtiL0BHX3RiJfQDhGALEG17Ei97UBkIwxsFUMyY5TYtgCOB4XwoBkhos8pOd+NyeXP8Ad4UA0yCexVRf85ve/mBegHiDChIJsbEqQL2Um3jxPGgIwBW6hgSMcgwwxBsT5UAot6FRf47gsoxA8By/ZQDgZ3USFCqxhl9x7hGOP8RwJscaJ6QXG706iKTsh2phAIdP5WCgYYj+VyA4Xxxrgu78q5viV2vXR0+ar9BZ+z6pT0NdpLgnKBkIJw544WrvTmCJI0uZwDb1FswII5YEjjQDpmIkAAyCLEm9ySf6uNAeZ87rnyrkwBGIPhexwHOgGXzs98xkDm2a2IOFrYUA8UXIQmUWJucDYXuL38KAVAyqRIM2ZsqshOHkf6GgHJMkiMFvlXlf1Y+RoCO4McZIUOxbAHxJBxvj8KAPfUBVC+7lsCGsLcOXxoC2HeK83YD7eYx7kk30qCJQDme+jwFsThblXJZO6Zpi97/+Re49fo7H7bhwnQdsevdx03146an2jbJBf+bb00e16SzcT7utaIEf9G9Xl3N8LbeztqUt6NZvkjUrYYC/NV2aLffirldCYvSfSe0vn3/uJt80wULJt/TkM27P5D3iINOD5+4RXk8dibnubDpv3GoL7vjS5kZ/DWYe8uriinJ8uiPOeneO3m3hhtfR2t6hkQYajf8AXmOMnx+k0Ij/AAMpqPhsdd95eUFvW46fvTr6qJ9thoeTbcuGb/LGnSMT9zOrNPEU2OTQ9IwD0rp+n9HDt5s1rB51Uzt8TIalZJhW9q6nde/OTnzPxeYPMryVINQXopR59fOau25a3cNVsuo1+sn3HUvvGmE+o1cjzSXLIcWdmY48ia3p2427UowSSo9CSW4aim5TTk6uq1nVe6/T79Ud5du6f02oXTTbto9JE8xUssfpkfMRfGyry8q57JMSsNlsrrVVFvqLPH2va4tQW6kZH/lv1IUEdTxo+OfNp2Ia5GIIZbWH4+VeS72Q/pvlM/o0vOFr9uWqXOR1LE1xZA0DAEf7VicfG1P8sj/TfKR9Gl5yND667P6vofZjvc+8afXRS6tNKkKRtG49wMyEk4fw2NqsstzyGOu+zUWnSus1sVl8sPDabT00OMpKovmjVpEJysMLY4g3J8Ku6FeSFlZxlKxp7hyqbYfDgLcKUJPJXMRzNaRQCc7Hmfw4UBDBPpaORXwPuZfLAA3txPhUkDRMhZmYqthlPgSLE48KAkQg5cDlzKLWsQPMX8qAVMiEsTLkzWJ5cMBfDCoBDj95nQAZkt+YcW/qqQLbMkth+lY4AjDxxNAOGdJY1VhkzEnPw/AfOgPUaQJdAzRMCpS+II4sPwqAN/UmJy0hIIspT8wYHj41IJ3t2YOA5MI9bcfzcAFw41AH5JwoK5PbLWUWFyGOPG/lUEj0oMIUBjkYqfcP5fUMRww86J1AksUs8cqyWwu7XCkgEZuH+io1gSJmzXRFZZSMfO/Ii9sTxqaCp64eVjGbL7K45MDjjj401AgPK0coUuoYkhnK2/ZUkD66uVIJFRlZQx8DZeAy2PEm9RTSTUaAZkjDujOikLxvhxsKkglZwUszFgY8rE+N+Nx8aEliuh+73RvTfRu1bJr9mlk3Xb4XinKQRNHOVd3jcuTf+LG4w5VymY5HiMRiZXIzpFvfejQky3wuYWrVpRcdK5zcT326GOmgaTadQdQRGJ4FgjZUzEe5ZiRcKL/GtL/GsVtOk1TTuvwGx9Vs08nSLl77dApkMm0aqQp+RRp4yAMMOWB528D5Xhd28X565WS80s+bzFZ+iJzL3D6ZlyKF1G+wyZT/AAZ5swBt4XtXV5gqYS4t6D6Cmwzrei/S6zcO6q5e5fW7xEHJpoy6f7RgiJ/fia1shf6K34elntmPzEv23DN9dlD2V7VyYK+dsiqOI9uQkY1pZbX6niFxdR7Yr5S0ZrSfbnrJ9Lp9RL1JHFLqIYpRbTswQsA5W2YX424+flXhPvVCMmlbbo2tZ6xyeTVdokL9uWqBUnqiI2/MRA1wb8vUcP66h97I/wBN8o+jS85GN3f7fdft+i3DdBv+lkj27SS6poTC4LGFWcgG/MDiedetjvRC5OMNh+M0ta3TC5lEoRctpaFUriZEWTKyrJGwDKOJI5G966hoqUPJqCLn20CoONrnDgeFRQkW4YJcMHva4BwF8fhQghu4kaRo3QPm/TiHEcsL+FSBp2kZgMAoOZW8sBc250AuG+a91waxy29X40BIdQVTNJZlB9VrYt8PDnUAx7e4CywsJFuP1Djbywt41IHZQyZCVKXFy1rk/hwoBa6gBXVwHKgLntYeV/xoAjLKSYSSU9TXODDjl5/KgEvKysM+aNQSwN78PHnjQElf+KjVgrM07XUCyi68agEtZhGqsUvluSzLiyrxwvh/XUEjiBvpxOhZy+YEW4AYi45ilQjwEMmZZg78faDWzWsbgADjzoBJ1DkiQCN3TAlRdbHhcY+PClBUWzOyxpZUExBGONh4NyoCFqC0GBN8v5QwxGPC+FSiByHVOjkxyK5dOBtYsT/EMDgBUNVJqNB3lEpkdQkjBrNceWHH5WqSCTGxVcpJJWS+W2AAuLfDGhJ1/tP3A6a6IXf4992+TUvuEsM+i1UMSSshRXR0OcgrcNfD4GqLO8svYzYduVKVqqtbxYYDF27G1tqtTrml77dDOk6z7RPp0WVhpo0gjbPGAMrMBaxJvgL1ST7t4qqpNPf0vWb8c1s6axFJ316EbTIZdo1Kh1VpYhBGbP8AxcLjA8DfG34w+7eLT0TXKws0s00xK19yOptB1V1Trt82nSNpdBPp4I4dPIgjf9KMK7EKSBc3511eVYSeFsRtzdWm+dlPi7yvXHKKojqvdhVfZOzWVgsh21LADAqI9P4+ZqoyJ/z8T2+tm7mHu7XZ/cf/1Pmnq454Nfq4tREdNMskg9iVWRhZrfkcA4nyqItSVVpXAS006MXmIZCqsASf1OV7H+gqSBxx+i0kjEqG54jAY4k8eQ8qAhsS+TMoJtc+nBQcbD8aVBv3SncLrbZ9btOj23qbcYtsfWaaPUbbLMdRpijSxqVOnn9yMX4A5R5VW47LcNehKU7cXKj00o9T3VRm5hsZetySjN0qtGta95nTPuqZZe7A1CuXXUbFoVyG9rLJqFt+y1U3cyW1l9fTl0I3+8CpiqeiusrgodmzgKoIPtn+E4YkXGNdWUhNzWZGCkDNjIOF8bfLwoBwj9Fnkc5QwxPDAeZww4UBE9xgY7KCx4LlwCmxAFAeuWEkihr24LcWtbAi9sefjQHnqV7MrcbKOFiONyPGgEve6eliXxzC5a2Nzx4HhQCGDqVFsxuCLX4fKgJUUdggVnBspOPPHl+6gNg6IZl606TEUZdBve3nhcknUpZT+FaOZ/KXuxL1WbOD9/b7UelFie8E0w769spsrRWO2NGp4gjcZbWwHGuI7uV+iYn7fqI6TN6fUrP2fWZyLviXfup1TI+YmT6P1i9ifpISwGPnXRd0v+rtfa9ZlTnvztzwdCOWo4CnD08VDEgY10ZUDCzFW9SWsb5Ty8bc6Ak/URqlm9xC2CE8L4HhQC4xG3tOC3u5mAia5BF7A+PjegJErhf0cwLjKr5r4k8DQDDw4IElDCN2MtrXHHGx5YG9AeNE97jGQWLcR6eGFAKeSON5LLYK9hl58rMTegPA/uxllAkBwcjDKDxoB2It7kMTA+3LKiu4N8vrAxB5eNQ9TJWssz93LZe5GyRqfcSPp6JVPiRq9Tcm3O1cn3M+Un230IvO8Hv49ldLK/arVJ/gqDTvhIuuldcx4gxg3Wus3UU0N0xfRsqJukRazm5A4mxKsAa9GRuM96f1EZ2nqhSAQ2rjANjgcxN+HlWCIhrMX0/Mke86N3ZcizITcnk441M9RlDQZrqWf3t73iUKwWTUSFb8RiQDUI82WY78m3bX7f8AUAl5hsjx+0LDH6LQ3JPEedch3c+cxnb/ADSL7Nn+nw/Z6kVZAcuDl9wk+q54A4k115QiPfTNkvex4rxB8DzPCgPSvuxoUVVszZ8pNgoscfA40AloXZVEZ8GQEWwuOJJ4C9APemNy6Sq4d7FvA2GIoBU2WSJXzZY5MA1j6SL/ACsedARmmhikcXkMY9Mdzi11wN+A40A3JMMRkb/r+RoBMMt75l44hzgb+VvCgPCQS1w1zi3HEHlQHfuppJl+3DoTTklQN8lb22vg4k1wscfwrjMDX/IcR/61+Q6HE/8AU2u0/wAxu/dySc9lO2SeyxZf5WVkI/NfbXsLWGB+NaHdyv1jFfa9dG1m/wD19j7PqlUYQGUsCyszAsqm1r8LHyPKvoRyg1KuUqVDEEKWJxAPkaASwIsWUsCQcqg2tfnQDxuosVYjA2BJuSMCMcQeNAefqAAm443c24i3AX8KAC7CFGsGDkgk4m39L0A/EQ0yqxsbgxkD1EXtbHmKA9kLrdDmY5gAik3vflQDMwuMoAUAG6nxw4eVARrsBldQjjBmxDEN4jzHOgLh9fdXdR9Kdkex0PTO8aja9XqNuEep1OmCrOU+kSQKkpUunG5KEVwuWYWzis0xauxUlF1SerTJ7mp+E6XGX7ljBWHB7La3OIqfue67jvGok1e6a/U7tq8c+p1kz6lze5weRnv+NdvatwtLZglFbyVOg5yc5TdZNt8OkZiIaZEY2vYxsF9VgbEC55WwrMxFyl1zKSzHNYIDjfNy/pxoBiY+k8IwAcwbDHyvwoCboopR/ImnilSKbeoFgkCMPeIKXysQAbAi9jhXjfktiaqqpPwaDOEXtLjOm98tXrdJ3T0eq2h5Y9yi0WkOkbTA+77oLBSoXEtY2GFUPd2MZYFqfktutdVCxzNtYisddEag2993CJL6nf4ycrtf3gBj6T5XI/ZW+rGA3ocxrO5iN+XOS/5n3gCj3G6jjXAjKJrWUWBJHAVirWXb1vmJ28T6XOYbqfc+ttToPp+pF3VdJEymL65ZBE0oDAEM+GaxI4+NbGFt4WMm7OzXgpWh53ZXWqTrThOcKkbEMxKMDg3zv4/urfNcfAdZFVsCRmDDAW5ccaA8aVoyygEDgt7ELegIT5R7YEZDcCRw8jQElDkvnGf3LKt+Qtx/ZQEgF2sBYWuQVNgLY+FAMBjJMEa2QC5IBuPK2NAJysJfTcxtw5W4Y/KgMg8AlCl7h7C5BBBFqgkhTRJly5j7amwa3DyqSBz3VhR1UjMcBIDcDEWtQDEgZCrSgyF7HM2JAFudAZcOCq+tWkKhiMQBbmbW8agkiyyxorRI+cKMwfAeeFxRBkN9ZNbISrrzBxtbC1KEHqNfKhIVQQzEC5I5A242qQS44ljsIHBYmxjNxawvhyvjzqAEUgkYyWYODlHI5Rhe/wAKAa1UxkkVApbI2I54+PnRAixxlhIFzI2LAcjfh8MKkGShK+2M62EJC+41iceJvaoJGJ2NzZiLG17/AD4VJBaPoPobtZuHSGwbpvus0/8ANdx0zncFl1gitJnZSoUkFbKLft41yGZZjj7eInC1F7KejRXRQusLhcNK1GU3pevSbYvbjszcous0+YOQT/MQcRhluWIOPzrTea5nr2X909/g8Jv856e2nZrUSITuUQVTiI9xXAGwIw5Cn1fM0vJ/CPgsI/4ucrR0immj7k9PxRO7QR77EunAGLokuDHyKi966vHtvBzb17HPQpsMl7aPa6zZu7cgXud1ioYKkmjUykD/AOZQH54VrZB8lb8PSe2Y/MSM9197a9k+14F7iQkZwAxDK97+ANwbCtLLa/U8Q/23D3xXyto0nS793VeHRtpdTvw0wjSPRugmCFAvptYYgKLg8/OrKWHwNXVQru6jVV3EUVHKnhJcG6d3zEGSTqF48VEkYma/8NhbiQBWMrWX10qHMSp4nc2j3V7v3MGgng3H+fPopkcauWVZmT28pVlcm4AIve/nWVu1gdtOOxXcpTWYyniNnTtU8JyNwjyMHGF+XIC/DG1WhqjhVkVWU+4lwqNje/nf+qgFuzRlSAWB4i4Oa1AQ5WDrI7JmLG6sPDww8qAVESuWQ3KLc5DbjQEoObHKqgHHKMD8/hQDUzSKRHcEkhSDjh8fKgCVCpQxE3X8wIt4UBMSP3IQHuEF8liLqbc71BIxJCsYZQbki8i2/H8KECYDHAFa4ktw+N+YqQIcvJH7zEyRg+lTiOXAUBP0siGBbsq4lVTG+PEXHzvUEnskiRY5gzv6Wj4gcgLm+NqAgHVyx3VGBGIC+IOF7DA0oQNpIxu1lBfC4AuDzI+NSCVHFCLSCS0mW+IIzEYY2xqALLlpRFKpJQZsOBJwsD4WoD3VTkRe3iWdedifx8KJEkALeUXVkzADN+/9lSQTdMpUtDImcuSWZrWGXgMeF6gkXKwsMjXBFxYgcOXnapIOz9nul+h+otFv+p6w1UUc+36jTpokl1HsD23VizEEjNci3+uufzvGYqxKCsKqaddFdJZYCxZuKTuOlKbp2Ru3XZfOWGs015AWGXcRYZibsPVYcD5CqRZrmlPJf3TfeDwm/wA4P237OSKIf5jAmYDBNwUHEgg8eNFm2ZrTsv7oeCwm/wA5W3uhtHTuw9T6jbundSZdoi0sLibP73rdM0ih+dj+FdVlN+9ew6neVJVe5TRXRoKfGW4W7jUHVaDpPd5hF092dZAVePQotmAzW9uHA/MVVZD8xiO11s3Mx93a4j//1aLT9zes5ZJdJvOvg6q0CuyiDfdJBuNh4LLMhmX/AKr1UzyTCt1tp23v25OHMtHMb0cxvapNTW9JKXTp5xTbz0JuxZ926H1GwSjA6/p3XuiHxb6TXCdLDwWRfKo+Extr3d9TW9cjX8UNl8zHt8PPy7ezwwf5ZVXONDpnpLcY3PT/AHD0emkkFl0XUmkl25wTyGoi+ogJ+LLT47F2ve4dtb9uSn+F7Mukn4axPyLqXBNOPOqoY1fbDr/SRNrYunpt/wBvC5ju2yyRbrALDH1aN5WH/WAr1t5vhZvZc9iW9NOD/FQwngL8VXZ2lvx8Zc1TTdtOTetrhYGPUDX6ZTC6ZZFPvJYZWxBBONb13Tbk1q2X0GtDRNV310lhfuqKN3TgRGH6Ww6USxjCzDUaq+GGPlXLdyv+v+3LoRdd4vmvsrrK35bSK1rqthmHAYXxHnXWlESPaldmIYqin0sRy/bwFAIzMEcoyhWXEn+q3OgGMxzMD+oSlizXsptbxBw5UAlWuLmTM1soBHqNrnj4Y0A6iZyXtZlXC2A9XCw8vKgEsp9QJLHMAQ3zsB+NAOwt6HX1E2uFABw8/gBQEhMskgBUtkW1uFgRbgQKA2zoof8AjLpMF7Ab7tuVVwBI1MdaWZP9Jd7EvVZs4P39vtLpO3fcnrdVs/cvpDdNPMI9botng1ekmdFcRzJrZ5FwOYEAi9iK5XudYjdy65bnpjOTT4nGNUXfeC7K3i4TjocUmvA2V16m3/cOrd41W/b5Kmo3PVrEkssUMcIKxqI0ukYUCyqLV1uCwVrB2lZtKkVWiq3r0vWUWJxM8RcdybrJ/wCxhzCGbG+XAcRgR5edbR4DDaQKWkLEAgi48fH5UA08Ei2tIMpILqRY5RjY4c6AcaOSF7peNQynA+AvyF7WoD0h5JXe2LWvKx9VgOWPyxoB3UyCRQY7K7N+qbYEkDiDQDolAyZPWrCzkcbjje3C/GgMcLy4FCWAJ4Y3v8caAyEbShAGU2veRrC3wwHPjwoCVAo96CQG7LLH68DazC9Q9TJToyz33iew/crp54kCt/IIhKtrDN9XqBmPD4EiuV7oU+FnTz30Iu8+9/Hs9bK37gYx0hp0IPutrZzCA1rD2lzEg4kHlXVbpTR1MxHR/wD9NdOWJI9wZcpy2bK1ibk3FZsjcZ7sRU7R1N+Y318eWzAWOZrE+IHOsRHWYrYyi7tpWnu8Syp7oQ5T/vF5kmplqJibH1MoO77pfKS2qk9Q54sQwxtaoRgy033A+w/bP7fY4Usi7I5fD8zfRaC5xGJub3rk+7tHi8W/T/NIvc10WLHZ6kVNN0ssfqZTgnHDgRa3MV1hREGdWdizKSouwJAGNuZH4UAqCZl90hDYWsAMOFrW86AVM36kXtuLrhIAATfibH9mFAOTMHAESrkjJJQ3ym5xxwvwoCOGlEUcSs6hW/JfC3Dlcc+NAIeCRVjK2WRiSxJHqAwNvKgFjTcVMhJYHKyjDjxxF8POgHU0gjW3EggBedAetEn6YkueK5hY4+WPyoDZ9d1jveu6S27o7U6qF9h2hzLt2kTTxqwkb3Df3EUO2MrcTzrRtZZYt4qWKiv5k1Rur1aNzVuI2rmMuzsqy34kXVKi4d3wstB3kRk7L9q88psy7TIrXtZjtbgqApNhYeFcb3dTWb4pdr10dBmzrgLP2fVKitHeN84DnEEiwPGvoByo0HDZWu1gpu4FyByNyPEigId8zhvMFeQAJwH76AWkRdSuZipuoJwsR4csKARcC3BFtzHnbHyoBKuRn4ShUyhfAi2KgkeHOgHoncEZXBBQjK9zY3xA5UA4sbSXVXsRi4/HwoBLq5jyuGMha2SwFrYW+F8aAaK+gYgMqnHwseN8DegLPd5ZE/yX7CSqwMY0CrJIQCM40MF8xI4gcq47If8AtMb2vzMv80+Tw/F1Ir3sfTnUfUrPF0309uO/Mn5vodLJMi8vVIBkHzYV1OIxdnDqt2cY8bSKW1YuXX4kXLiRtv8Alzuu1On+Kuo9g6SGUh9Hrtemq1a3xIGk0P1DgjwNq0Xm8Z+4t3LvCo7MfvT2V0mz8A4+8nGHG6vkjU8TTdstvYpJuG/dYahcXj0sUW0aUnhi8v1E5HwjU1G1mN3UrdpcLdyXItmPOyaYSGtym+CkFz1fQev13Ft2T/DPRGxdPSwkrHqp9Od21fEYmXXtIgPO6xqOdHlLue/vXJ8Cfs48kKc7Hxyh7u3CPDTafLKvQYTd+rOpuptX0vJ1DvOq3mbT7zCmiXUNePT53TN7caBUjU2F8qjgPAVsRwVjC2pq1BRqnWmt6Hret+E8ZYi7enFzk3p3dzi3jeu8O9f4b71bHv66b6ldqg0Wqk06tYyNG0npDWw5VTZHY9vlsrVabTkuWhvZhc9nilLeozaV+5XTPF7qdL6jNmF0+oW+U8bG1vM3/fjWp/ib/qLkPb6z6I7/AMyOhul+mNQt2FydQtgObflJ/ZUf4nL+ouQfWV5vOaX3K7waTrXpt9g0m0yaW+qh1MmsklDW9m+AQDAkta9+FWOVZE8Fe9q510NUpvmtjMx9vDY2aaSuA1GXOxYEqxwtbCujKscg1BnnQ29xQQFjbhc8vhQElnHuOVjOZTcJ4ePHnQC5I9K7IZLoWviL2JFQSMSMxLoFAMaixv8AIkGpIFetlFiWHAC1ze39dAEZzEAreVsCF4f04YUBJQIsYUnKeGYG5Y+PzqARZNTgFHqcnLcm37b1IGUjkJvKxQP+UMLeQoB5Y3BswvwvY8SDc0A+EMrPntlW1uJJ4cjQDCDIXBY5jf0cRlHKx+dAR2dpSQqCI5fTe9x/QUBDUyHOygWsAB8+JFAZJJZoEawCLxPpuCD8KAkrrUiwF2zAlWGFiefxqKARBIXDMQWZhdz/AFWFqkHgYM5IXOptcnjhYW8aAVImnGeSC7MuBW5thhhUA9HuZYiPRmXMVB5/h86kCWj9oKGGFwXPI4edAdS6d7RdZ9T7No9+2saQbdrS50okmCuwjcxlivKxU28hVRis8w2Guu3NvaWvRwVN2zl927BTjSjNjj7AdeXcGXQxKD6Vae+bwIKg/trVfebCelyHqspvcBIXsP3ARCkD7YTIwDp9QVVhxwJXx8R/pf5NhN3a5CfpN/g5TnPR8E+k7m9L6KWILqoN9ihmvwR45Mri4vzBtVjmE1LB3JLU4N8qNXDJq/Fbu0bF3gYJ3R6vIQGNtEhtiST7CX/bWvkHyVvw9J65l8xI2LuGGbsb2tOVRKWwtf0q0cmFvHgK0ssf9zxH7bqPfFL9JaNm2b7i9NpNt2/bn6amz7do4NMJffGVjDGqhgALgYXt+2tW/wB13cnKSua23q3z1t5vsxS2dSMkv3JaRkzSdK6kMRiv1CHHkCcoFeb7py3Li5DP6yvN5xvcfuF0Gt2rW6OLp+U6jX6SXTgNOMiGVDHj6bsBe/KsrPdaULik7iomnq3mYzzdSi1s60VFeTJJkZ7hVwuuJIrsm6lINnVmUrGpIF/WORtztUAyErL+kGiyXQYC+Phf40B6wikivMpQjC4vcA3HwqANvkjyRxANG5OVjjgRwIoBKZyhF8bksvEYVIAEqxEgNh/u7Cx+PlyoCTGqozswsT6gxPAYYWqANSTrHmGbMFF0zfDjUgiWlkbOSUTx+NAPe2ykMDmW+YFTyPK3xoB4KxMUdgFAN7k8rYfOgG2QRyj1FVA9NsLnxt8KAallxyGMYH1OefjQEFhJ7wXAlWuTwv5CgJemaZAsiqAW/iC4jieHwoCWmsCgSOQ7Xs4AI540ADUNNOXxYg2jXgcfOgPXYFwFW5U4gjAA88aA9KaeQKDdJwuawva/n8bVBIlDIUkYL7ZVwoN+XHC9SQemNgGkIuSCo5kAeP4UBu3RnQHUXXI1/wDh/wCnVNsEQ1sk0gQAzZsoAxzXyEmq/HZnZwWz7SvjVpTgNnD4Wd+uxuG9x9guvmMd20MGZfU51AYLbDKQovw8Kr33mwi334DZWVXuDlJcfYbryEl45dtEig5H99uPK5y/u5VH+TYSn8XIT9JvcHKcm646a3fpDcG2nfIYjrl06zZYG9xGSW+VgfHA3q4wWMt4u2rlvVWmngNG/YlZlsy1nYe8uYdN9nGIUyDQR+6wuRYxQEAVQ5D7/E9rrZY5j7u1xH//1vm3qnz6vVMCECyOAQcOJF2NAeMy4f8ArFYWUeF8LUAwwA/TC5UYj5/uoCToNTqts1KazbtTPt2oh9UWq00rwyA8iGjZT+2sLluNxbM0pLear0mUJODrFtPg0HSdl7n9b7jumybdv+p0vV+lk3DSQqnUGig18seedFzR6mRBOrLe4IkwqpxGUYaMJStp23R+RJx3PNXivkN61j7zlFSpNVXlJPd39fOb191OnOm7xTwF/cU7JtzrKfzv7jagk3w/fVf3Ohs4DjnJ80Tb7wSrivsrpZXZyWka/wCmUFlPyNix8K6kpBxmWyn/AHisLADlyoBhxYFFXKjWB8/3cKAdjijyXZbDggJ4G9AJkVVawGUFbkoMLn99AIjVz7akBnLWy+AviT++9APZL4ObBrZmIw+XnhQC7RQyAxy/726erEYDEXHA0A4rRiVkK+pSQFvcEYY0BsnRWnh1HW/R4dC3u75t4chzgPqY+JBwrRzP5S92JeqzZwfv7faXSjr33VqsPcDY9PfMsWwxFLG5y/UT5beeGNc53Ijs4Ka9N+rEtu8briI9nrZW5XJMhKFQbElv6GuxKAdSR/afIoDKQRH5f6aASsmdAXkKlsJMfTbibDxoByBbuWdQ6N6bgY4AW/HhQCZmLTFERgQATjjblf8ACgHJDkCF09RIAuceBBoBsxZoo+JIwzk2Unj+zlQDkCkloyB6VuzEeH48aA9khUGMZLKfzOD6rcCAf9NARXSQ5gjhlxI528Dc0B7FK6ZQqlPUoueAxA4VD1EotL92sDN1907PMGDv07F7gL3BH1U+Jrke5rfw1yv9TqRe94Ke2h2etnANZpUj6Jhly3eXXzWbiMIwMPgb1126ilhqZhejY1O6RLL6Rc5SVH5grWFekqkbjFbBDEu09UFrAjVxmMBbXOY2FYkQ1mM6djzb3ogynK0yD8v+0DS5qMoGe6m0aR73vEK3Ue/LaxOYA48fgaLWebLIfcAZtN0F2FiA/S/kD5FLXuTpdASR4Vx3dmvxOLr5/wCaRf5x7mx2eqJVK0juWRcuXm3j/orsCgHwl0uW9x7jA/lI8x52oCX7QUOwQAqtypxv5Wt58KAhCP3CrWwNgoBAN/LHHzoBxyqS2IurFB7bG1rHh8DQBMsgAIVrKDiDh+3yNAPKVkgDiIliv6Y/hsfiMPGgIygoSjPlZTlsuByk42870AqOVzNkU3iGJY4n58L0Aj3LuxygniDxzUBFlce3ZkIy3K5sF4/P5UQLl95NNFL2M7V6xwZHZdrCANiEO3SYkA+NcB3djTOMS9/b9dHUZq/0Fn7PqlSx7Ucbpb0DnmuQD/TGu/OXEGRREz5hGrkrm4kgnjbxoBJhijChHu6nKVvc/AYcfjQDbqwjDZfRcZgeIBBN/wAefhQDVmzPckg4IVtj/qoCSscZCllAzi45HMeFxxoCOy+3JmW4YG2a+GI+NALXKoB9ohmFjQCpMTYyZmtjbje9x8aAQSXiRiAliFB/hIv4UBbzrjedf0x2H7C7nodBtet1uv0YEcm5aGHXDSn6W/uadJ1aNXbLa5Q4CuGy7BRvZni1KUktpukZONfG3WtPgqdLi8S7eDsOKT0U0pOmjcqVs3jrzrbqeJtNv/U+46/Sj/daBpjDpltyTTw5IlHwWussZdhrDrC3FPfpV8rq+coruLvXVSUm1vbnItBqKosZDqvttztgMfGt2prjy5V9Risz4UAqSxAX3Ltb1AcccRagHY5bv0/ZFZ49705RRiCyuhGGHGvO+v5cuJ9BlB+MuNHYu6G16DeO+e07XvOp+m2ncodHFPqcypkVlkGDEWBLgC58a5nJ707WVynbVZR2mlydRa46EZ4tRk6J0N8/yb7WQaiHRybnMNRqVZY9P9bGGcxj9Q/l4+X4VXfXcfKLkoqi9F7uo2nl+GTS2tPGSX7QdsXmKSa11MeUtEurRf8AeXCC5uccp4GoWe4+nk828T9Ow9dfOco7rdvejekOmNPrOndfLPuM24rAUedJSY2WRmLBQPylQKt8mzPE4q843Y0js11U06DRx2EtWYJwdXUrcYjcMxLBrccB4mulKschV0dc+ABBuBy5YXoCTLn9wEG4xubXOPnQHojLAOVbNzI534UB66gOArNZhZ7r4DAfA0A9AgTTsuW8rX434eAxtUARIWjOWMEl7EkYHjjcnwqQKCJa+c3fjf8AaKAbkjKOsiC2YYuDiL0B7JG7IBbmLgHh/qoBtVky5SWYlvV4EWxONAOB5BYqAMLX44GgI5Ll1cpmvbMcQcDxw4UB77bBv0gQHxyWtb8caAU8aoVAXOLG+I/eBQCEDMW9RRLWKgWN/C/DhQHiwNY2ADJYY43tQD+nuqvdiJMAo4YDw+FAJiV1BzcCTew435fKgHxGsSkqWQOpuvEqbeVQDwfqEZsygNYYC4t/dqQS9S8bWIFlQFRYG2JHG558ahEm89Od1+uOmtu0WybdrIY9s0QYaaJ4FZlzuWPqPHFudVmJybDYibuTj4z16TatY67aioxehGwxd7+4q5/+8NM6hrgHTqcL8CcCT51rvu7g3/C+U9Pqd/f5h5O+3X6R5DrNO+pZmIl+mQ25iy2sAD5VD7uYOvkvlZP1O/v8xo/Rupm1HcjpbWTfranUb7DqJZD/ABPJLd2wsBixNb2YQSwdyK0JQa5Ea+Gbd6L9JGz92EK9zOt2kOZVgX2/+i0EeFgL1r5D8lb4n0s9cx+YkZ3r73T2T7Tsq2WPOpS1rgI+Qm9zyvWllqX1PELi6j3xXylrwnRdJ2j7WJtG37pqt5kyajTwTvqfrI1U+6igKABgMxPn+FVs87x7uyhGGptanuf6G1HAYbYUnLcW6ZqXs92zjEcLa2SL3SwVjq4yzEAuxuRbgDywFeMc+xzq9mvgfEejy7D7/Oa/1F2k7bbZsm/bto9xmGo023TajSodXHJZ442ZMoy3sx/0VsYTO8bcuwhKKo5JPQ9Veo8r2Aw8YSknub5Td45G9blrjFh4C1doUR4scgIsBkOHztjjQE6W7Rrla+AwIJ4UB4EaQEMCfBhy8RQCnXKgYF1cG4Frj438hQDmmjVZXd/V/cwPE8zY8b1DB6909YHrucByvfh5GpB4gDAPIzB14gnhfh8KATLDeMMAHZTxufjegPQrshON25njQDCJIhOLD0+kAnDnagHRnUWCi4N7nx440A1K0jnFcxU3AItx5YUB4UuFZVyMLAjkfmaAU0ZCZmF5GtdcD8PhQDdjnAT9PG5uL4c8aA99klyCSc3qznjwty86AXCrJKBI2ULwsML2w8KA9Ky+8735Cx42t5/uoB8RLjKAyuDjm/iHM2oDwsWZluxGJuwwvfgfhUAmXjGnSIXJuGZrHNxw52wpTSSZ/pbrvqfow6//AA5qY4IdzaM6sPEJA3t3ykXxB9R4Vp4zLrOLp7VV2dXhPaxiblmuw6VN6HfDuIZVZdx01mUDKdMhsf7PL/TWh/juD818psfU7+/zDqd9evo2dptXp3BULGg06hQ3j4kn41D7uYPefKT9Tv75zPrHqXderdfJu+9yifWSQLp7qioFjS+RQiADC5q1weEt4WCt21RVqad69K7LalrOzd3RJLsfZtmAWNtqQPHgAGVNP8eAqiyHRfxK9PrZY5j7u12f3H//16PavuCdy1EydS9IdO79eU5twj0x23WkliDebQNCCfNkaql5U7fuL1y3wV24/dnXmaN/45S95bjLwbL5Y06BloO2G6FU0+o6h6K1Za0cUyRbzpQT/tx/TTgf9Vj8aiuY2ty3dXhty/NHoIphLm7KD8E11PpAdutXrmL9M9TbF1UxFxpNNrF0urYk8Dpdd7D3/wCjen1eNv39q5b4XHaj96G1z0J+Ac/dzjPw0fJKhq++dL9SdOFF6g6f3LZ1/gn1mmkijN8Lh2XKfka3sPjLGIVbU4y4mnzazWu4e7Z8uLjxohbHKg6g2AZyR/MtCRIDcYaiPncW8q9MQv5U16L6GYWnScXwrpLA/djDFB3eeRpTMP5FoFEtjmOWXUpiPkK5vud/1+/48uhFvn/zX2V1lcldgbggK1ixvezHkRhyrqSlBozfKnobPeJRe+PL+hoBTJlYszEtiWAF7nzuedAJS4bMFzpawPiTfxOFr0A3OSpuqMyAWbNwNzhl8SaAjrNkvYJmU2KkWFja9z8OYoCUkxkYqNQCAB+ieJK+FxQDOoXUe8oJf2+K2GC4Y2twxxvQEtIiSjOwIVMqKLgkrwxNuN6A2bo55k636MMQW/8AOtvyswFgRqowLi9aOZ/KXuxL1WbOD9/b7S6Udb+58PJ3F2wqJFlTZoQ2Yi4/4ie5AH8P9Vc53Ii1gpN7s2/wxLfvI64lcEetlex7gQq0SSqBbNmsT4kH512Jz4lY3SeVY0YlFUqyHA87XFxgKAECMjM6n3FOMfjwNuXCgPYJmyErIVMaepwL4LwwoBn35c5VMb4CW3D/AE0A48xa6SISb+kjDibX50A5HZ0OBEjCy5h+XicAbYcKAXGjIjs5AdvTlQ8uRXn8b0BBLSxtZ5mstzkBxtc8j+2gHHlDFnJBBABNuJuTgKAcDBXiZ1LP7iDL4hmGNQ9T4glVlr/u+KL3D6aijOdoumoRJbEG+r1BPCuV7oU+Fm15/Ui7z5/z49nrZwXVET9AaN7HP9dqOeAAFdWtaKeO6a10moi3jTKbMC5sb3xKP+ys2w9Q/tkH02z9R5ire7rIstjwOc1ijGOsx/TUP/fWgY8GmQsA3AZlxFTLSjNGb6vkzdRb5Go9KahrtxwKjCoWs82WO+4poW7efb3Ipus/T7KThdSNHocT/prku71Fi8WvS/NIvM102LD4OpFTGazL/CDf27iusKMQ8xyKiye2VHI8OAJJPKgJGmzkkySE+56UckhRhxNAKRCrHOFMPBebFScCTe2FAMmQK4ujOFsAT8OR8rUB62omy57XW5uluII4486AVBO7KwDkNlJaO3IWvj8DQCUKTSMHJCqAM1vyjHDjzvagPVzn3Qiv7S3uw8RcC+FAeQqViidYVLOCMrN+QDxHHlegG50mdGuLDhJGDYC18TyAogW27uyzDsT2uWNSYs23A57XLLt0limPAVwHd6LjnGJT9J8s0dTmrTwFn7PNEqsyBks1lKrgeAzAXscbmu/OWIOqSUZQCWaMKoCgn8vO3j50BIX3kjV5Jcjj1GWTkQcAefCgI7ai4VfcEv8AC7njwxIvYfGgG1csT7aKzPcKQLfHjzoCf/BgrXYDF7XFsb8edqAbAuMrXRiouoF7Ecrk86AU0ZCr6/0c2PG1z8L0B7igzADPIxPhmww58qAYYocschJzi5ykkX4sL0BaXvAiabsF9vv6xdhpQPZAwW2hVvTiOJfjXI5Kl9Uxjru/mZe5i/0VhftqKtxq2peKGFH1M8uEeljBeQ88FAJ/ZXXNpKr0IokquiN/0/bLrfUQrqtXskvT+hlW43He5ItshtbiG1bRk3/2Qaq7mc4SMtmM9uW9BOb/AAprlZuxy++1Vx2Vvyaiueg4el+j9tVTvvcGHVKpHuaHpzRy69rnkdTMdPAPiC1YfG4u77rDuK37klH8MdqXQZfD2IeXdrwQTlzui6RTb90JtZV9j6Gk3abNb63qXXPMrkcD9Lovp0HwZ2p8JjbvvL+yt63FL8U9p8iQ9vh4eRa2uGbr+GNEYfeuqdx6j1PSCazS7ZoNNod7g+k27adFBooo/deHPb2lDMfQMXZj517xwUMPauOLk3KLq5Scm6J7+rwJHlLESuyjVJJPQkkt3gN27vbHq+pO8mg2HSZF1O5abSQwvLcRkAO5JygkABTVRkWIjh8ud2WqLb6DczC07uKUFraRP1nYTqaT230W4bfp3AYSKHkW97AZSA3Ic6LvRht2MuYPKLu40Mx9guq4zIzbtoZWIy5hJIpcDDE5Tb4VP+UYbzZcxH0i7vok9Pdldx2fqjZdR1Smg3jZtVqpNPLpRI7Fj7UkkZZSBhdeF688T3gt3bE1Z2ozSrWnCk+kytZZKFyPtKOLdOY0rvHsmybF1RPoNj0EG2xjTQuukiW0YLi5IxJF6schxF2/hlK49p1elmtmFuFu61FUR1XrHovpTR9p9PuOl2TQaXdU0eikG6xxhZmdspkvJxJfG4NUmX5hiJ5g4SnJxrLRucGjgN/E4a1HDKSik6LSa72R6O6Z6m2ffp+oNg0+5Pp9SkUOonzG10LejKRa18a2e8OPv4a5BWpuNVucZ5ZZhrd2MnONaGi9D7DoNX3Oj2XW6KHV7Qmv1UbaKRrxlEDlEvclrYfxcqs8xxM7eBdyLalsrTyGphbUZYhRaqqvQZbvVsexdP8AUEOk2PboNrWTRJKdNCtoyzFgWsSSDhyry7v4m7iLDlck5OtKszzK1C3cpBU0HSdX0X0rH2ci3MbLoU3gbXFMd5WO03v5hmYyGx9VitiLY8Kp7WYYh5nsOb2NprZropxG7PDWlhNrZVaa905f2V6f2fqbqbcdJvmzw7totPoXlRZr+2DnRRcKRjjhVv3gxV3D2FK3JxblTQaeW2YXblJKqoY3rjp7bdq7ly7Ptehh020nUaUJolYiNVcqHuSWIBx8K98txNy7glcm6yo9J5Yq1GF9xS0VR0vvZ0p0p07t2yz7Rs2m2efUzyI7adbZwiggMCxva/G1VXdzHYjETmrk3JJLWbuaYe3aUdlJVMj2j6P6X3boHWbhvex6Hctc8+qDauePPJGiIMgUmxXLxuPxrwzvH4i1jIwtzcVRaE9B6YDDW52HKUU3pOP9t9k27c+4O37VuOkh3HbTNMs2nkN0cIjlRhYtiL8av83xE7WElOD2ZUWkrcFbjO8oyVUZjvRsex9PdRJo9i2+Da430SSnSwraPMxa7WuSOFa/d/E3cRh9q5JydWqs9MytQt3aRVNB03dei+lIuz0O5psmhi3f+V6aY7wseWczErmYyEXBbEWI58Kp7GYYh5k4ObcdpqldFOI3rmGtLCbSitqi0nM+yPT2zdSdRbppd92aDddLp9EZUE1/bBzqowUjE3wq17w4u7h7MXbk4tumg08sswu3GpKqoYnq/p3bdr7my7Ltuih0+0nV6VV0QYhFRyocXJYgHHnWxgMTO5gVck6yo9J5Yi1GGI2UtFUdI73dK9K9O6PZZdm2bTbRNqpZUkMC2zhALBgWN7X42qr7uY2/iJTVybklTWbmaYe3aUdiNKmU7U9H9L7r261W47xsWg3DcGfWX100eeSNUX0AE2K5bXFq1s5x+ItY1QhNqOjQnoPXA4a1Ow5Sim9Jy/s/0/tO+9aajbd52qHdtFFo55DHKbxgoVFzltc3OFXOfYq5Yw23blsuq1Gjl1mNy7syVVQjdy+ndt2PuBJtey6GHQ7a66Zl0aMQi5/zn1Fio/DD8azyjFXL2EU5ustOkxxtmNu9sxVFoOod5ekuk9g2DaNXtWyaXadTPqPaeWBfU4EeYK2ZscfKqnu/jsRiL043JuSS3eM3cyw9u3CLjFJsc7K9JdM7z0jumu3zY9Du2q+tlRZp4vcdIljWyrcC2Nzhz51594MdiLOIjG3NxVFqe7Uyy3D27lpuUU3U4d0xtmj1vXm0bNqNIm5aCfclglhzellz/wARFrrYY+VdHjb0oYWVxOjUalXYgpXVFqqqdN739O7P01N09D07tem2uHUxyjUwQA2cqQVwYtwxxtjeqnu5jLuJjP2snJprWbuaWIWnHYVDadw6S6Xh7P6bfH2XSxbwNvgml3RATKZHcKWzFgDcHhb5VqWcwxEsydrbextPRuHtPDW1hFPZW1TWan2M2LZt+3jqH+c7dpN1h0uli+ih1MYcIWf1MFItfgK2+8mKu2LcPZycat1oeOVWYXJS2knRbpr2q23b9q747Xottgj0ugi6ggEGjhwWJSw9IHIKeV62Fdndytym6ycHV755bEYYtKOhbRju7gI7m9Z5rofpwbECxAgjFx8RYCvbIfkrfE+lmGY/MSNl69JHZTtQxVstiSeNj7TYfMcB4fhWjlmnMsR+26bGL+VtGU0vYfqKfadIV1e3wamWCKVWLSYZwHOYgXuBhw40n3nw8ZNbMnRtbm4RHKbrVaoTH2B6vzo8286FypLX9yUlCfD0jyN/7Kj/ACjDebLmJ+kXd9GP3PsV1ZpYp9wk1mhn0uihbUTQmdyxEd2dRdcbr8K9bPeTDTkopSTbpq3zGeVXYpvRo0my95Okekuntj2HUbTsum2rUamUpJNAvqkyxhvXmY3xxvatXIMdiMReuK5NyS39zSeuZYe3ahFxVGyf2e6P6X3foXX67e9i0G561tTqV+pnj9x0jVBlCk2K2xNx+Na+e4/EWcXGFubiqLQnwnpl+GtzsuUopvScs7U9P7VvPXZ2nd9ti3fQRwalikjXj/TFszZbE8cKus7xNyzhduEtl1XOaOAtRuXtmSqtJ73X6c2zYOtxt+w6CHb9vl08L/RxE5FZicx9RbKMfL+umSYq5fwu3cdZVekY+zG3e2YqiOn93Okek9i6T2nX7bsel2vWTTRRyamBfU94i1mLN6gSPCqnIcfiL+InGc3JJPQ+M3Mxw9q3ai4xSbG+x3SfTe99Pb1rN92PQ7xqF12SJp4vcZIgn5Vva1yCbio7xY6/YvQjbm4qm492pOWYe3ctycopupxHadt0k/Xu3bM+lTcNBLuy6doA3pZDLYXIsctuPlXRYi9KOFc06PZrXhoVduCd1R1qp03vj0f07023T8nTuz6bavqmmXVpp81pLAZcGY+BxtVP3cx17EqauycqUpU380w8LTjsKlTZ16N6UXs5Hvuo2PSLvC7d78m6qC0ucyZc2bMBexta3latT6hiPqfslN7G1Sm5qPX4a18Jt7K2qazTeyGwbLv3UO9rvO3aXddJptEp0mn1KB1DlwC2UixIGFb/AHjxV2xZi7cnFt7hr5XZhcm1JJ6N01TuVs23bX15uOg2jSwaTRe6nt6KL0xxXADAA3y2Nzb8K3spvzu4SM5tuVHpe6a+MtxhecY6EdY7v9IdJbB0xtGt2rZNLtWrnnSOTUadfU/6eazZm9WPlVLkGPxGIvzjcm5JLd4zfzHDW7duLjFJnvZHpLpne+mN21u+7Hod31Q1zxpLqIvcZIhGLKt7WxubisO8OOv2L8Y25uKpuPdqTlmHt3LcnKKbqcO2Da9Jqevdr2ebSpuGgl3RYHhzelkMlhcixK24+VdHi70o4WU06NRrzFZZgndUXpVTpXfHpDp7pufYJOndo021fV+6NXHBmtIRbLdWY+BxtVR3cx17EqftZOVKUqbuaYeFpx2FSptc3RvSkXZ2DfJdj0ibwu3pNJuqgtL7jSZS2bMAcDwt8q1IZhiHmbtbb2NqlNzUe0sNaWE29lbVNZqHY7p7ZN/33f13ra9Ju2m02jjOjg1SB1V2cXcKRYm2FbveTFXbFqHs5OLb004jwyuzC5OW2k6LdNY6s2Ta9J3UfZ9Ht0Q2uTdIIl2yH0qqOyAxgfwi5OF/2VuYPETngFclLxtl6eXSeF+1FYjZS0V1G898ujOm+nNJsOp6e2bTbTLqNRJHq/p8wEgC4AqzG+PO3hw51vdzH38TKauycqJUqbWaYa3aUXBUqZ3Z+jul5ezzb5rdi0jbwmh1GobdPzSh1kYA5swAIGFv314X8fiFmfsozexVKm5qPS3hrbwm24raprNC7K7Fs2+9Xa+Dd9v026aHT7e76fS6lMy+5nUZstrEgXqx7xYm7Yw6duTi3LWjVyy1C5dakqqm6YHu3te2bJ1puOj2jRw6TRWiYbfAAqJdFzgL/Dc42HjWzkt+5ewsZTbb06WeWPtxt3moqiOu9Z9G9N7N2sh3jbdh0227y2m0UsmsFzLmdVz5iWsSQSLW4m9qpMuzG/dx7tym3GstG4b+JwtuGGUlGj0ETst0p0/1B07veo3/AGXSblqI9V7enllBLIntXNgpXLjjWfeDH38PehG1NxVNNOMjLMPbuW5OcUzlXR2g2/cu4mybbPDFqdql17jUaSYDI6rchGte4vbnV3mN6dvBynF0ko60V+FhGd9Reqptf3A9PbFsmt2htl27S7T9RpJPqYdPGEDsGOVygwOGF/Kq/u1i7t+3P2knKjVKm1mtmFuS2Elo3B7vEP8AuLs+bMqnbI8p/NiUgupxNzwuaxyF/wA7EdvrZOY+Ra7J/9D5uyIBqJbcUlYrGTwxPGgE+ouEX1Mb3GFh5CgEsomXKxBsWAHI8b2AHhSoNm2TrnrLp1fb2Lqfctt0+B+hTUM+nI/2oJM0ZB81rTxGX4bEOty3Fvfpp5Vp5zYtYu9a0Qk0t6ujk1Gz6HuBp903bav8T9B9O73qJNbp8m7aPSts+tze8mV/d0DRROQTchojfnWndyyVuEvY3pxVHob246t6dXyM97eMUpL2luMtK002X+Gi5jqn3b6RE7txJY2k2DRO7Na5Pvam728Taq/ujGmB+2+hG1nrrifsrrKtoiiwXAo11jPK3j4V1BTD12Mlh6mucMLC/LwvQCbFxlzZSCVwwvyIAGNAKTBQx/3ZBGUmxsRyB8+NAM3UKvoJVxYlhgCMMLnCxoB1TCrsqW9JIswsbi/40BjW0gMiGCRgFkN3wcqb5gbgg8P3UBk+BCG4U3f3CAT6VJwPnQC75lzCyuQCpwwI5lvM+NAbF0S7N1p0VcoU/nu3GdicSPqYwAOfHlWlmXyt3sS9Vmxg/fw7S6UWP707Ztu699+2el3OBdXtmqXb9LrtKxKrJG+4TZkYgg2YG3wrju7N2VrJ784OkoubXGoo6HOIRnmFqMtKeyvxM4d3g2jbdg7kb/s+w6Jdq2vSNpRpNHEGaNFl0scjC5LY5mJxOBrpe72JuYnAW7lyTlJ1q3r8p7xT5tZhZxU4QVEqaPAjn7SRqWuwsFvmW1yCQALeXOrkrjHNE0haaAl4pDfLmIyn/ax8r0B6uJWIYFAMxJBGNuPIWAFAS3S6qz8FGKrhfHC/KxoBlUOcOrBpGWxF8LfHnwNAZyOBMkQGRs0KsyC11JZhj8ayS0riMa1qPBNPH6vZWwvmNhcjmKloHmbTsM8MMTKxwsOB4HiL1C0kvQRtSiomYKkZZ8uYAXN1bCklQGORAZYwQABImFhbBhh5E2wrB6mZLWWd+7jMO4ez+4Tl/wAPRBC+UGy6vU2sByxArk+5vyk1vTfQi87we/j2etnD2Jj7eafOts+v1AIPqAIBsLfOuuWspImB6Sl9veoQiq5e6Gwy4FWN8OPCsmS9RM2+VY9n6j9vJJ7moRHy4WDMRfzrFGMdZi+l3Vd725gFJMqBVC2P5158qlvQZondVjJ1Pv2a1hqHKsSMbKL3+FQtZ5ssd37Rz237ACTNnTZHCBgpw+i0GC24m5JF64/u464zGP0/zSL7NtGHsL0epFYIAM6XK2Z1U3AIb1A2NdeUDMqqJGLexHYk4WGFelCKig2kJaJY484xksvI42OFqxVG6E0aPPZhvmSJQRxUCwqXqCMXrYspUI6OskMZeVTYHMo+XlwrFqgi6ohLGtxGGJsLoVwIHGxHmKgkXOreK2UcVFibj8w4GgI2R5iHiUnOOTYg38rc74UBIgMcQaBpCZQCzPf04gnEn8DQDkxzIpR8gYgMii5APw4c6A7bv/S/TS/b90p1Km0Rw9T7lvJg1O7AsJpIg+tTIy5rYCNcLchXNYXHX5Zzdw7k3bjBNLRRaI+HdZc38NbWXW7qS2nJqv3jpXeW6dju1iRFDNG21J6ueXbHDC2Aql7vU+r4r7XrosM2+QsfZ9VlTA2aQ3IMS4+3xxPlhhau/OWPHYLfgTCA1rAh/UBw5cqAh6yCSVEysQc9zFa4JOAPEWoBzTxwwrLZ82ZrFmZTbLYcBgLm9AKzRAZ0AZiSpBUAXwxHCgFpYM6gFWKhSXNrXJJBJ8qA8KkubsVIsHOOIOI+PhQCiWKyNa6g2Y2F/HiONADDOuJuubNm5j8LHCgERxIc72DMDxwsb4XB8qAuX3R3DaNh7IdgZ9w6U0vU76jbQ2jh3CedNNDINHCxkePTSRGXMDbKWAw51xWXYa5czDFbFx2/G00Sq/Ge7JOnIdFi7sYYWztRUtGitdGjgpUrvJ3U60jhbSbLqtH0boT/APA9OaGHa/TbANLEvvth/ekNdCsnwzdbidx7825cz8XmKp5heWiLUF6KUefXzmh6nU6vctQ2r3DWT63VNjJrNVK8ztmPN3LHl41ZQhGC2YpJby0LmNOUnJ1bq+EbJciRgLhTZsBccOdZEARmQ3N1JDZsLi39lAEeaPV9PTRgOw3mDFhmBxXCwOPwFeV/3cuJ9Bnb8pcaOp96d21eyd2tFuu2ytp9dodHpJodQOTesDDnhgfGqDu/ZjdwDhNVi20yxzKbhidqOhpIxWv7odxEhjaDeNWHlIaRHhXAYWAzLwJ/ZW4smwK/gXKeDx2I85nsHczuW8FzuetjIN1vphewHiycDx441H0fAV8lcv8AqT8biN98hsvQ3XvVnUHXPTG171r9Q+nj1LM0MsWTO/syLfgMLNatPMctw1jCXZ24pOnWj2wuKu3L0IybpU1vv7JfrmVVALNoYEZb2uCDxOPj/Tn7921TCLjZhmmm8+I7X3FkgbsrHKGDxNotvMcjfFAG8jfCueytNZm1wyLLGU+EXEjFfbvGD0/vphcKX1aI1wSFYIcpKnA4GtjvU/5tuu8eeTrxJcZzXt37kfeIwvKGZNVrAXtkBAD2CrdrG3AXtbnVxmrrltVvR6jRwejFeFj33DyAdWaKxGcbciFeZBdvj/V+415911TDPtGebP8Am+A6zvTwf5Dl8waIbLCMzcihVSccRlI+NUmHT+rfaZv3KfBeA5l9vCoeo90ZD600DZuIupdb+RAIFXHel/p49o0so96+IxvcJJou8Mayzq2fW6MxsU9tFDZONs3xJH4V75W08t0L+GXWeWLTWK8KOhfcbIo2np25sw1UzqTx/Iv9tVPdRePc4kbucPxYmc7KNE3bLUKCGKy6wSobGxdcwUg4G4atbvBX45eA9ct+XfhOG9mXU9yNvCSrkb6kgjgRkbBeONv2V0mfL9FLwdJV5d79eEyn3Cyf+MdMFtnG3RoV8QWbnj/T8Tr92FTCvtM9M2f87wHXOo3hPYUPnV4/5Npsrtw9LKL+IIIqjwqf1b7TN+9T4LwI5z9uyod+3d1P6kehswxF1Z1ufAgED8atu9L/AJEe0aeTr+Y+IxHXKywd5UV9QrFtfpGRyvtqoYpxsW58SOfKtnLmpZboX8LPLFJrFeFG/wD3HSAbd04AbONROyk8fyqP6YfPjVV3UXjXOJG5nOqJn+zbxHtVqRgSra8TJg2LIWy2PG4atXPa/Hr7J7ZdT4Z+E5L9vwjfrPUujAsuimZbXsVJUGx5i1uNXneb5VdpFflPvvAJ7trLD3SgzzqwlOjaM5Mirmyg5rZviSPwrLI2ngNC84xzBUxGngOm/cLIB0vslyA312YE8biM/wBOH+mn7rL+fPi6zfzd/wAuPGP9gpI26D3KxBddbqDKmBtnS4GPHNXn3lT+LjxLpMsq9zLjK+dvBDL3E2gIwU/zQ+xluBmWQlVBHC5AFdTmbpg59nqKfC6b8eM619xqyLqOm5vd/TdJ1EaoAbqwIJa+PE2ww5VSd1Gti4uFG/nKe1E3LqF1/wAi4s5Vw+06UZuK4shw4fCtHCr+7PtM2Lr/AES4kaF9uEiNufU6s/6jaaAqPFUYgnytm/bVh3rr7O3vVZr5N5cuI03dZAnf2Joght1DCroFvixW/pHM3uLfGt20v7Vp8xmvP5z7RA7wC/cvrVEBBGkUsxt6v0ozfH8P2175B8lb8PSeeY/MSNk69kL9lO1rSL+oXZRkBUD0Pc4nnYfvrSy3RmWIobGK+VtGN03dDr4bZC2n3nVA6eFIdNaJWRsihQSSpuQBc1uyybBNtuCq3XWa6x1+ipJjOh7n9y5FIO56zKF/3v0wYHlh6CCR/TGksnwL1xXL/qFjcRvvkEa7ub18+nl2/XbpqzFqwYpZGhCgowKstwosTfxrK3lGCjNSjFVXCRLG33Fpt6Tq33AS36V6VYm7tMsgcixJMA5edzyqi7tRpiLv7bpY5q/5cP23DN9i3R+2+tHF11Os96PA2LpcDHA5ga1e8SfxseJHtlnuH4TkXYkRP187xsLrBqWQAmxXEEA8wB41e943TB6d9Fdlfv8AlH+9ayw9xdKXmVlli0rIMmRVuccxBN8BibXtyqO7zTwWhbrGZJq/yHUO/jgdEbUrML/WRMrHxEbDD/V+HOm7sr9VN8D6TezV/wAmPGNfbw6N0lvIzfqDcGeRTjbPGAD53y070V+IhxdZOUe7lxlf+kfZl7j6BUIF96IiC3ADCY2AI4G4A/0V1GN0YKXY6insab67R2b7jUmEfTk3vARMZ1MaoL3GUg5r4+Qt86oe6bX8xcRZZynWPhNp1jr/AJDrmZWV9njBYG4F3BtyOF/x8RWnBf3f7XUe8n+i8Bzn7cpEbfeoQW/UfRRhB4qj4n5ZhVn3qr7GHGamT+8lxGmdznRe6W6lHRf+LgzcgCVU3a1+WJPhVjk6fwMOJmrjfmJcZ2v7gXC9HbMpYZvrUYOfERNw/wBX4c+e7sL9RN8HWWebP+VHjD7eXRujt4uwLjcHaVONs8Yt8b2qO9FfiYcXWTlHupcZX3oUQydxdsVSBfdz7GW9syykqqkcMQAMf2V1GYNrBy7PUVGGVb64zsf3GpKrdNze8Paf3l9oIL3BBBLXx4mwt8DVF3TapcVN4sc5TrFm27rID2JQuyuH2iEZr+nFx8Dh+/kRWlZX93fafQe03+iXEc7+3GRTvXUgdv1X0UWTHiqPiflmFWXeuvsocZrZO/HlxGs9T+xJ3t1SZgubeNMMLj1H2yPy8CTa1vjW7gqrLF2H1mvf04t9pHTvuMSYbZ0/MZQE+plSSIIL3yqb5r8L8rfOqjuo1t3FwI3c5TpFmd2x/wD5CXLsrBtnnBa9wLu3HhiOfn489a8v7t9pHrB/ovAcq+3iRD1duys3rbbisS/3srgn8KuO9Nfh49o0so96+I1rvE0J7mbwPTgumLhRxJQYkDxH41uZAn8FDw9J4Zj7+R37uPDIOz8IinATT6TQkHLnLpZQLMSCLqeOOHEVzWUyX1J1WtyLTGp/CriRjvt/k/8AB28EtnC65vTzFoxx4DG+GNevedfqYcXWY5S/5UuM4V26liHdPZszAR/zCbKRgMzh1A/6xNvnXR5sn8DOnmoq8H8xHjN2+5cr/N+nACol+imIPBiBJw+R8fGqvunX2U+0ug2858uPEM93nzdP9nXKWkk0CYqMoWyw4AE874eHzr0yL3+I7X7zHMfd2uI//9Gjer6p6H3TUTJu/b9Nsm9xlO5dOa6XSjibt9LqhqYib8gVqpeDxlr3V/a4LkVL8UdmXSbyxFifl2qcMHTmdV0CW2DobdWB2PrxdvkYWGg6l0MmkIbwGq0p1MJ+JCj4VHxmMte8sbS37ck/wz2Xzsn4fDz8i7s8E1T8UaroIuo7b9bRQHV7ZtCdQ6FTnOv2OeHdIwORI07O63/2lFqmGd4RvZnJ25b1xOD/ABaORkSy6+lWK21vxal0aeY0nUQyaXUNBqom0+oQDPDKhidT4FGsf2VaxkpKsXVb60mk04uj0Mf2g5N72VirSrLr9JnF8AvvpYchjXnf0W5dl9DMremceNdJYX7qtZPq+7HuyFlI2HRrkY3KD3tQRy865nuZJyy+r8+XQi47wKmKp6K6yt/ugFUXFUGUNytby/ZXVlIKMmZjdAwGFuZP9ooBBZl/3YAu2Y3xxHPHxNAP3PpBy3cC2ABDHiLc6ASXwxEaIgIJ58b4kjnQCcxzGwETG2JPLhjbj5340AjIQTkupa5ksuJ8Cyn48aAdNgIgRnyKQTc2H40AlZ4wL5rXN1Bxvb4AUBs/RDMOr+k3hVY2G97bluL4/VJYnhblwrSzP5S72JeqzZwfv7faXSiw/f7cxs/dronfW0Y1su1bfo9culZzEsrQa6aQLmCm3DjauT7pWfb5Zet1ptykq71YpF5nt32WMtzpXZSfJJnAuuOq5ut+qt26ll0C7T/MjCF0MchmVGgiSG+dlW5bICfTaupyvAfA4aNja2tmumlNbb1ad8pcdivib0rtKVpo17lDUmFmUmxy4FTyPE8B48jVgagypCM8pxwGZLekcgbDzoBbAXaREDhrkgXYcjfyoBCrIpQm5CkZQT5nhj50AzJc+4TcvmGIwAHjax8KAy2k1cMcd5c5zJaNhiLAk/LjapqRQU256dTdRJh+UWGPwxsay2yHESNzjJzZXKm2NhYfHGo2iaC59VBNGo9Sur5iCByBHjxxqG6hGODsJFFhYOpIsRxIJ41i9RJZr7tUMvcHpmTUSe4X6ejCkLlwOrnsBbjx5iuS7mN/C3K/1H0Ivu8Hvo9nrZw/WSW6C00YvlTcdQDjyKgj99ddXSikhpTNf6MLPu0IQ3KlmYk8gjYX+FZtkLUxzYs7bP1Ra3p1cZbHkHNY1EFpMX03J/35oSpYn30tjawzDhUzegyh1Gb6yWObfd8ka4ZtVIqnG2AA4fEVC1nmyxvf5pk6A7DRNIHC7C3tgrlyr9JoRbC9+Fcd3abeKxfb/NIvs4X8mx2eqJWOCRAyNJgA6vgOOUjxIrsChJsm4wrgquRf02tf99ZbRFBr+aQgBGDgWxa3Dnib1O0RQfj3HSHNmWS4BBFvlwvUOVSaGHmbPMinMQuVSl8ctgAeFYhIEzGNVwKlwQT++9waEgBJc5kLkra5BYgAW4UA7dUHsgDM1ze9yLcTf5UA2gGTJgw5MeJvfjYY8aAkcAGzE2wvhiw8cONv20B0HcevZd07Z7N2/n2WOJdg1z6xd7GoYvI7mdrGIpYG89rhjw86qLGVezx88Xt1247OzTVq3a8G8b93HbeFjh9nyXWtePc8O+d27yNIOy/aqJbJDbazkIubnbH8cOF+Nct3df8Ad8Uu366LrNvkLP2fVKhLKiYMBFwJYAkG3MGvoByx4XVw6hcxHIm/w5CgFS5ixZGIsoxFyQB4k8PjQCFAjHosiXuVAIB/63PzoBSsLABVU2OQEj1Yf0xoBecG7sqeBtgpPz4cOAoBEjSKUtlPBmsB+YcRfyoDwFVv6Rcm4c8AfGgAykpiBf8AKVF7+fzBoDwyZ7uh9ZUgr8OB4GgLO949dLN2O7BRsjymHRZIpM2BU6OIEDwtlrkMjk3mmMjvP8zL7Ml+iw74Ooq+Msa5Wa62uuY2w8MbV15Qmw7R0t1Vv4jHT/T2v3dCAzSafTMYxY/xSkZBbxJrUxOPw+G97cjHjarya+Y97OFu3vIi3xLRy6jY/wDADbeWPU3VPT/TTLi2mk1f8w1YPj9NoBMQfJmFaazf2nuLNy5w02I/ens8yZsfAbHvLkIcFdp8ka9J68vbDawmUb/1pMgtIp9rZdIxwvb/AN6nI/8ARNP7jd/p2l4bkvyx6R+kh5834IL8zMRvm+bfvA6en2vprbelNHs26pLKNE88s0iko2aebUySNIVCemwHPDGtm1hZ24TUrkrjkt2iWp6lFJI8bl+M5R2YKCT3K87bdTMdZ9cdO6vu7s/Wu3NNuG0aOTRtqUdPbd/prqyqknhhbkTVfgcuvW8vlh50UntbtdfEbGIxUJYlXFpSpzHX5e/vRawCd9j1bLIwUoYoSxBN+FyD48bfPCqRd2cT565Wb/1a15pmtB3n6Z3XSzavS7LrG0+ldU1LyCBFTN6rkswwwrxl3dxEHRzVXxmazS01XZfMRdD3T6Y6v6h6d2ba9M0Ooi3AayTX6oRRxKkMUgfK2bNmbPYVnPJb+Ds3Lk3VbNKKreloiOPt37kIxVNNas4h391ER66lkjmhlKaLTqGidWK5RiGKk2NzwNX3duLWEVU1pZXZq0774kdX683ran7K6OOHddFrNSdFoFTTrPE0payi3tgmxAOIthVLl1i4szk3FpVluOnKb2KuReESTTdFumN+3fW6I7H1RBq9ZHpS2pjZ0klWELGYypYPmBB8fCvbvRCftbcoqujerumGUyjsTTdDnXbLUaGHu1G41MbaUanWR6PVPN6CtmVTmY+q68CTjxq2zeM5Ze9GmiqqGlgmliVp0VZkfuIkR+rdC8M0MxTb41HtsrMpDMfUVJIvfnXh3Yi1hnVNeMeubNO7o3jo+57ztX+Q8SLumj1GpG1RBdL78Xu5w/5fbBJBHhbhjVVasXPqzey0tp6aOmrfNudyPwSVVWhzj7d9ZCnVe4DUTpp/d25lhViqqSHUkEk4W5Vad54SlhlRVpI08pklddd4xXXE+2xd4C8GrTU6JNx0jySrqPcVXJR3HuEkYMcRew4Vs5cpvLtKo9l7lN/cPPEuKxOh6KrdOn/cZqNPPs3TntarTTMNTM5SORHY3RbMtmvbzqm7qwlG5cqmtC3DeziScY6UTOzG6bcnbTc4NVuekjnE2sEmlmnjRgDEB+UsGII4H5Vhn1mbxsGoulFpSe+ZZdOKw8k2t04x2Z10A7kbbNO0en9z6oRu7qi3ZW48AcL+FX2ewbwUktOorsuklfTfCZz7hpIn6x0rxTQyldviUe2yswIJNmKkkceBrW7sJrCuqa8ZnrmzTveA6Zv+87WexMMce6aPValdq0qrpxPEZc+ZfT7YJIIviLcKqcNYufVW3FpbT00dOU3LtyPwaVVWi3Tnn27ayFOqNzXUTppzJt7LCjlVVrOpIJJwtyqz70QlLDxaVfGNXKJJXXV7hherptti7xl9PrE1Oij3TSs8y6j3FEhKsw9wk3AY2te3KtrAq48uo1R7L3Kcx4YhxWJ0PRVbp077jNRp5Ns6b9vU6aYiediqOjObqoBFmuBhxqn7qwkp3Kp6kb+cNNRo0Te0G77VD2u3KLV7to4ZhJrvc0s08cbi8Y/gLBjfkefCvPPLFyWPi4xbXi6Unv75ll9yKw0k2t05Z2D18P8Ajx31EqaUTaLUqgJQKzEg2JJAHjfxq47yQbwmhVo0aOVSSv6d5jfdOTbV7pl9Pq01WkE2jfVOmo9xUkOUuue7Wt4cBWeTK48AtpUdHTRTmMcds/EaHo0bp1j7hdRp5+lNjMeq00rHW58qSIzEGO3pAa9rnG1UndeEo351T1bz3ywzeSduOlayN2G3bbNP0RvcGt3XR6eUayXNptRPHG2UwgXsWDEEc/lU947NyWKg4xb0LSk3ukZXcirMk2tZwDoTXRf5h7JNLIun0w3cM0oy2AMhAPIY8DXTZhBvCTS0vZKrDSSvRb3zrP3GS6Bt06fbTa2KfVvBMNTp49QJMiqwyEoCQl7n41Td1VNW51TSqqaKf7m9nDjtxo9NN837f9Xo5exUaQavS2O1aVEjaVHNlZfTYkEtYeF6rcNbks2baflPc/bQbV2S+C0Nakc3+3bcdDpN56jXWbjp9EraOP2V1EscQf8AU5FyLkeFWfei1OdqGzFvTuJvcNTKJxjOVWloNL37fNv0PeaXeH1KDbtu3uLUTa3T2lDRoQzlMoObnbxrfw+HnPLlbp4zg1R6NPCa124o4na3FIx/Wm47b1X1x1ZvuwzyT6HctO0kckqmJjaNFN1fEWy2rayvD3MPhoW7miUVucZ54u7G5dlKOpmT6z6k2bcu2nQPTun1ksm+dNq/18RQrGnuKVFnwVjwGFa2Bwd21jL12SWzOlNOnRwHpiL8J2IQT0x1nZNk759IabZtt0smy6r3Ns0MEMjZIspaGIKSpuTa48L1RX+7mInclJTVJNvd3WWFvNLUYpOOpIzmz98ek93lXR7fsWu98xtIsAihTBBmP8Vh+Na93u5iIKspxpxs9YZpaloUXzEPe+9PSD6LXbQNrnfW6zTSaRYLQGNHmQood81sC1za9euH7u4mNyM3NUTT3dwwu5pacXHZ0tU3DD9/pYP8KdKQjVaWd4pRnWKRGJKwqt0Aa+W98RXt3aT+IuujVd9cJhmrXs4Kq/ZEnsjvG1Q9u93i1u76PTy/U6rNptRPHGwBiAvlJBII5/KvPvBYuSxkHGLehaUnvmWW3IqxJNrd3TlPY/cIB3GiknlXSpNBq1jJKKrM2IDHAC/iOdXPeG23gmkq0aNHLJJX1XhHu8cm3f5kg6fVpqoMulk1pTUe4EdiMy5wWy2AGA4UyJT+C0qj000UIzHZ9u6OurdOt9+tTp9T0NtBi1WmlLayOTIkkbs1oiPSAxPPG1UfdqEo4qdU9T3Hvljmsk7MdK1mK+3zdNu03THUEOt3TSaWUay/saieOI5fa/N6mBI8Tyr17zWZyv23GLejcTe6YZTOMbcqtLTvnBOl9fD/AJibbOziDSrvSsZVyYL7tg3IcK6XFwbwkktex1FVZkvbJ8J2X7jZtA2p6dk0+uin1bJMJ9PHqA9o1K5TkBIW5Y2PP5VRd1VNRmmqKq3Kc+6WOcOLlGj08Zuup1mil7DhItZplH8njiVHmRiCHF1ILAlsDYca0IW5LN6tPyt7g6DYlJfBUqtRy77edfpNJ1JvaazXQ6JX0FoUnkSMP+otwCxGI8B/VVt3otynYjsxb8bcVdw08omo3HV00Gm9yNdpZe526urxS6RNbCW1EMgKsPSzWkXlc+dWGUwksFFNUdGauMknfb3Kndu/+p02o6L2YpqdNKTrEkypJGzH9Mi6gNfC+NuFc53ZhKOJnVPV1lpm0k7UdK1kH7f9023T9Ib5BrN00mml+tYnTaieOM5faAzZWIYg+NZ95bM5YiDjFvRrSb3SMqnFWpJtLTvnAOjtfF/mFtE8jjT6YbwrGYZcF92wPIHCumxsG8JNLS9nqKmxJK8nwnYfuNl0Da7p5tPrYptY8U31GnjnEmVFIynICQtyxsedUfdVTUJpqiqtyn+5YZw4uUaPTxm87lq9FL2IVYdXpgDtEEaI8qMcHGFiQS2Hx+dV9m3NZtpT8p7hszkvgtDWo5l9vO5aHS9Qb+NbuEGhV9AohWeWOIP+qtwC5FyPAVa96LU52YbMW/G3E3uGnlE4xuOrpoNS6r3LSy94dTNFqIjpE3fTt9bAySKQGUsysDZrEmt7BW5LL1FrTsvQzXvzTxLddFTqf3GTbfJp+nZNProptY0kwfTR6gP+lZSGMYYhbk2vzqn7qqa9onGi0bm7xm9nDi9lp6eM2jadXon7EPHHq9MltnljCySoSGzm4bMwxve161L8JfVk6PyluM9rcl8FSq1HHvt/3DR6LrLXfWa+DQxybdJ7ZnkjiVjmS4DORjwNhx+VXXea3KeGWym/GWpNmhlUkrul00Gud4dfBqO4u8to5IdRCRCPqIXV0YlAWGdT/Q1t5HCUcJBSTT06zxzCSd6TR3fuVqdrm7ObY/8AM4jOum0P0cfvqjyOVVXBiVvVYE3ww41zuUwuRzKS2dFZV0dZZ42UXhY6d7d6hP2/azSR9IbzG+pghlTWu8qyyqDf2xY2YiwsB5U7zwk8RB0b0b3CTlMkrctO6cD6E1UGl7obNJPrIdNAu6N7mqLokQN2scxOUA+IPwrpcyg5YKaSbezq3SpwrSvxbe6b39xm46HV7zsKaLV6XW/8FJ7ksEqShPV6QWUmxxJ48PjVZ3XtShantJrTuqht5vNSmqNPQaz171RsXVmi7baPadZNqdx6e0Uek3ISRtGqvaK+UsAGuV4gVu5XgruHuXnNJRnKq013zwxd+F2MFHXFUZ//0vnBqodR9TqQukmssj5l9tiCbkcaAY+l1QjzSaaYJHgSFJ/N4jxoCVpV3HSSxzaBdXo9RGQY9ZAJInXmLMtm+NROKmqSSa3npJi3F1Whm/Q9xu4XsjS7prF6p0CAAaDqHQRbpHa3ANqI2lX/AKriqyWTYatYRdt78G4cy0cxuLML1KSe2vSSl06ecnbPvPRW7btsp3PtlNsWvO46T2dx6b1s8MPue+mVn0etGpTJfiFdcOFeOIwmLt2pbF7aWy9E4pvU/wCKOy+VM9LV+xKcdq3R1WmLpu7zqjbfubTXazunLPNBKZE2bQRSP7bZP95qBgLX5Yc6ru5jby9V8+XUbXeBJYrR5q6yvzw6gOwXRy2XFkEbEG44cK6spBP0urEZZtNMEj4kKT+a3EUA4un1RASPTT24h/baw5+F+VAOfRathnOmlZlFhaNgT8MKAZOk1Puj/hJFYY2yN4fDnQCRo9YGAOm1FmADDI/lbC2NAejS6zMSsE7EYXyHjyB8bUAtoNeiFl0kjZhkwjN+BucR50BHSLV3B+mmZhb0mNj8r2oDbuh4NSesukZBo52P880DHJExNvqE4YVpZkq4S92JeqzZwfv7faj0o7B9zx1T9wdnYaWR1XY4VICkgf8AETk4gcca5ruP8lPtv1Ylv3k+Zj2etlezp9WSXTSzFWHD22vgPhxrsjnxh4dVGyj6SV+LE+22PK+IoB2CDVapXWPTTLgbxtGxIHjfyoBLabW3KSw6jhZQEa2FsALUA4sGskQKdJMGFy5MRxHjwoDx9JqcL6WcG/p/TaxFr8LUAHQzlCDp3BYgm0bX+FrUAhtu1JDINLqLD1A5GsBhck2tQAmh1QCounmF/UZPba1vMWoB0aLW5LNpZCL5rBDyuRy+dAex6SbMgOmnfO6kXjaw9QxNHqBaT7ttHKe4fTkUWmmKRdNxZgqnDNqtQTfj4Vyfc+NMLc7b6EXmfut6PZ62Vt1mm3D/AAiix6aeSH66bMpjclCIVPIYX866vdKaOoxnR+l1y7nCBpJgC9jaNiAMrXJ8qzZG4GwaXXjaupj9LN/79GpAhcG2Zrn4VCEdZi9i0u4ru+laPQzO/uplURub+teQHnSeomJsW+6PVvum8loZ5ZPqJg7hWsfUQeWNREwZZv7gdMzdvewM40srM+wNnKoxN/pNDjXJd3I7OKxfb/NIvc2dbNjs9SKrLo9VmGXTzsykOCyHDw5c660ohDaLWjMx08oC4lVRrkcDjb5UA3/LtSXLDSzkAZiio1wLceH7aAcXQTgq7aaYMSSc6ML8uYoAbRzg2+mly3vdY2vx4cKAX9Jqxj9LMCtzjGeA+XlQDckWqZ2c6bUIig5LRsL3w4igHU0W4ODI0E1o1Iu0bGwvibAcqAhn6g5wukmaxuZCjfHDA8KAkLp9ZYlNLKLi5HtvhwN+HOgG54tSkRQaOVmA9V0YWHyHGiBbfu6uqm7IdrU+lnkKDbBIVjJ/Lt8gINgADbhXz/u5X6xivt+ujqc2+Qs/Z9UqQ0WqGZBpZbBrkiNvkOFfQDlhMMeuD2TSzMrAKSYzYC/wwoB46XXWCnTTAgW9KEY/13oBv6XVhCVg1BIwWyMMuB8qA9+i1YU300xGFsyPwB4XtQDseh1UiqPpJQrDBgjW44HhQAdLrBY/TSlV/gETY4W8KAaOm1EjhRp5zJIL5cjA4C/E0B59PrM7E6SXM2IYIzcD5eNALGk1EwiyaWUNIbf7tixJ+VAWy6zn2Udk+yn+Kdj3betLpdLGm2bdoZ10ZMn0t29+ZoZWyW/uDNfia4XLY4iea4v2Uox06W05bu4qpcp0uLdmOCse0TejUnTc3dfMcTj65m0LsOke3+w9KGMjJrm0T7trvJvqNxMwHxRFrpXlbue+u3J8FdiPJCnSU/xux7uEY+DafLKvQa/vXU/XHUaj+fb7u+7xLw0kzy+z8oVtGBbkFFbWHwGHw/u7cYvfS08uvnPG7irt3y5N+HRyajV/pJmdVXSzLJIMFEbA4VtngeHT6wOxOllBbg2Rm4fAc6A6F0j1FtPTm2bg28dHp1E2t1UP0w1S2ERiSTP+ZW/NnFVuY4O7idn2dx26VrTd1dBtYa/C1XagpV3ye3cnpAzapF7N6KSDUW98SG9gvDKvtenzIrQWUYqi/UyquD/U2HjLOn+UtJBXuJ0QHmB7Hbe0SsCjKzAk8814yB8qzeV4z/8AVLkI+Lsf0Vyk9u5/RaiydldAwX0x50WwubkH9Jv315/R8X/+qX7eEy+Ns/0Yi/8ANDo+fMjdmNul44WQXt5exy5VCybFLVipc/7x8dZf/CjxO6/SUItL2X21cp9CrGjXvjiWg/tqJZLin/8AZnz/ALyVj7K/4YjK90OiDlI7JaGNCLPdIyx8cfaGBqfo+L//AFS5/wB5Hxtj+iiWO5HRs5V07I6GQrdczhBhxwtAf20WT4tf/alz/vJ+NsP/AIV+3gHD3P6Tjvl7MaFI0JFyiMSTywhvw41H0XFbuJlz/vHx1n+jEal7jdGupmh7L7c8jNeVXAx/CHj8qyWUYvU8VP8AbwkPG2f6MRg9wukIGcv2N2pgwxVUGcjiAc0BHzFZPKcU181P9vCR8ZZX/DEUe5vRyG8fY/QZAPVdUxJwuP0CAKw+jYv/APVLn/eT8dZ/ox/bwD57l9GmNXfsrt6LmOQZE9NrWv8AoD8OFR9Gxf8A+qXP+8n46z/Rj+3gGX7m9GtIgfsttjKjExkBcSTe4/QwuSeNZfR8X/8Aqnz/ALyPjrP9GI1q+4nRsytfsltshdSDmUZreZSHDnwrKGU4uP8A9qf7eEiWMsv/AIYix3I6RjGQdldqVXGUswBFgBa6+zUfSMV/+qf7eEfG2f6MTx+4HR8LTSQ9mNtZZyGcSnOSbAHKvs2A8LVLynFtKuKlo4P9R8ZZWqyhT9f9IyJJqJuyW0FsBGQuLDliIfPHzospxS0LFT/bwj4yz/RiODuJ0YoRf8lNviXKMpZVNrm1v9ziMKx+kYv/APVL9vCT8bZ/oo8HcvpaFZMnZna4/aAUXS5sTwF4eHwo8mxL14mf7eEj420v+GI4vcjpFM00XZjblQKUU2XFVxykCGwGFQ8nxT0fFS5/3krG2V/woiyd0eiRIJB2V2+VxZSwRMwB42PskYeNPo+LpT4qXP8AvHx1n+iiQe4/RM0QSTsvoSF/IoChRbl6YrnGiyjGJ6MVL9vCHjbDXukOxdxdhjPuDsrtynEBkUAeIBDQ487mjyfEv/7U/wBvCFjbS/4Yjw7k9GxNcdndFEzj1ho0a6njY+1a96h5Pi3rxMuf95Pxtn+khpu5PR8lhF2a0LiwztIkdrXxAHtE/P8AZUrJ8Xu4mXP+8h42z/SRDk7k9HpZF7I6DKXLOcq5SrCxsfavf9nlUrKMX/8Aql+3hI+Ns/0UPRd0ujsntr2W0cCkHKuRLA8gf0LkVj9GxbdXiZc/7zL46yv+FHq9yujhmDdmNvVg+ZVyqSfH/wBSMb8PKsnk+K//AFS5/wB5Hx1n+jEiS9wuk5jDIvZrbDKk2dxIuZSpwsP07ZiOdreVZxynEqq+Jnq/bdMXjLT/AOKIabuN0nA+VuzO1RkljljQ2s3GzPGbHztWM8oxMv8A7M/28JMcbaX/ABRM9tfc3pJ21gl7R6KBvpZQxADXHgB7YwxFY/RsUtWJl+3hMvjrX9JGK1XcvpJNRBJF2f0Us0QIFyBG2bA3HtENh486mOT4qjTxMtPB/qQ8barX2SMdJ3D6JWdAOyG3yZwffN2BF/ACO3GvT6XjKfNS5DH4uz/RRKi7mdERRqqdk9Eq3DSR2DWsTYgmI3Pyw86weUYx/wD2pft4SfjbC/4UOJ3T6QIVD2Y20C2CKqKBc8v0OfhWP0bFf/plz/vJ+Os/0Yng7odI6dmH+Su2xwm97IjG48AYLc6PJsU//tT5/wB4WOsr/hiNt3U6KlZn/wAktAZAQfcKR2ItYWAhFjRZNi1o+KlTw/vJeOs/0UPr3L6KmQxp2T0UhHqAZUUXB4m0JONFk+MT+alz/vI+NsUp7FD57l9JxehOymgjYj1elCABx/8AUCo+jYt68VLn/eT8dZX/AAr9vAJbuV0ZqQWbs1oGnRSELqoB/wD7I+fG9Ssnxa/+1L9vCR8bZ/oxIp7g9JjJMex+04cCVubg/wAN4SOHI1n9JxWr4qf7eEj4yz/Rie/5l9G5R7fY3QLITYgqlreGEF8fOsfo+L//AFS5/wB5Px1n+jH9vAPx9zej5RIT2T29FAu4Kxkm5tygHKsfo2L/AP1S5/3k/HWf6Mf28A1J3N6NyZR2X2xo2ADgquABwBtByuedZLJ8V/8Aqnz/ALyPjrP9GJ6/cjox40H+Sm3ELaysqn/0QIb/AI0WUYtP5qf7eEPG2X/wxI8HcXpGCMMnZLbFKszWHJicbZocayllOKl/9qfJ/qQsZZX/AAxHj3A6OZo9SnZnbPdjDKccsVmN8EEOJuPCn0nF0p8VOnFp6R8ZZ1+xiep3B6T1IUS9k9oMUdzfILhueHs4XHCo+k4pasVP9vCPjLL12YhF3D6NVLjsjtwBcBiFGU+YJhNuHCoeUYt//al+3hJWNs/0Yi17j9JLIoj7M7ZaT1ZigAwHG3s2uKPJ8U9eKn+3hI+Nsr/hiep3K6Smyyf5M7c0iN7skgVV9QwVgPZueXGn0fFL/wC1P9vCT8bZ/oxGp+5/RZssvZfbpHRj6CiHEcD/ALnj5H8ahZPi1qxUuf8AeHjrP9FDsXc3ouVDm7LaJFf80ahAb8MSIhbHgBUfR8Wv/sy5/wB5Px1n+kj2PuD0ytvpuym2nTpjEQPVhe5zGG3jWbynFPXip1/bhMVjLS1WYkk9yekv97P2b0UcwNg+RCtx+W4WLwrD6Pi1oWJlTw/vMvjrP9JVPH7mdHOfT2d0ckrMDb24wobx/wB148v20WTYtf8A2Zc/7w8dZf8AxIhy9x+j4wx/yS295GTIWjReJIOP6Qw+GPnWX0jF/wD6pft4SPjbP9FBD3R6PiJt2T0MTsQZXVUsWP5iCYPwqJZNi3/9qXP+8LHWV/wocPcvo8yEt2a28K6kCRlW9r+nD2eGJv8Asqfo+Kp81Ln/AHj46z/RRH1HcTpDULLH/k1twBi9uK4uL/7QWNfT+3zrKGUYqL+Zl+3hMZYyy/8AiQwO4fSsUiu/ZjZ1JVFLpETcjmV9sKBfwqZZTiX/APZn+3hCxlpf8UTMaXuf0odZpw3Z/Qxr7kZRxawYtzAiFseVeayXEr/7Mv28Jn8da/pI/9kARFJBQ08CAgEBAAAAkQFHAkcFABv//v3d/n//l3Xf/3z5su7/v//f///Z9u9/3x//ApNC/wJaQv8CWkID/wAAAAAAAQAAAQAJAwAAAgEBCQMAAQMBAwkCAAICAQEBAA8DRQndBE0FiQPgC6EGA9UIEQelAgUPOmybEIM1UW5MVf/PLaV1NZkpMk1J3ipvkJJJILTUiQCIRqba/ueXhdUsZ5qrxHkm05IaZDs2/lQmvYZxAQDgigJDog8AAACgQAADAQAAgQEAChgAgdmuNgBmRSQOACH9IwBOXWHA3dgbIETID4DmaAgDgBGc9BOAtmAtALdrAQCY9BMAAIDSBwAAgCFbAGhCWjYAlBAACPhrBSBstTYAvJbSAgCKQWQjAAnYDAugExoagAR1ZEkEAABAQMCu6gVwOQC6ABAhCc4A56H+VwDaAgIA3Cr6CUBbQOAtAABrAaRFC0DtYFcbALfisRbAQ/19AaD3Gy0AmBjhsgAw0TzaAQAKRGQHAE7IpA8AAACUvgIAAABI4BYU/v8EAACIC6AtQOD5BACOz6IAygWmAdhX6waAkLquAARp6gOAOTk5AE7RsRoARNGcA4DV1e0KAL3TEw1wEwAAvJ5x94cAQFBcDgAompmTAKi68pcAfGeGBRgBDQdAgr4KAGZTUQDmkNUAIAr5AdAcIAGA6iUMYND2PwCABtb/CgAAAAn6PwAAAMj/CQAAMGDI/xWAMxASoEiAEkzqAYC01bIB4IQFfOwAwAkZsgWAJgTSFgBOoCMWgCDlXwIAE0hIIgB6oEQFcAZAgq6gAABAAUADASRoCwpgAgRgPBMQAKl+4gBMgEQAbOaIAPABKAAAAAAA/z8AABN/6r8AAAAAw0ogPxN/akAOAAMBAAsDBTFw4HBwCzUCmQoXu2IifiklOP5cMBkdtJ/WnZ8upybmDoL6Awj6AwCI0D1gWSmAuBwAAP8AALA/3E8ApMEB9wP+BwAAAMwA/wPAAfcDAADgPwDgPwDw/z/4DwD4DwDQn4AgQP8QdMAA+YN7AAL8/oAQ4H4AQATQ3j/gfwDwfzyMBwAA+Mc/dMgfAP8DAAD/AQAACgEBAQANA6kVpQLgA+BVAS0GpQIZA90ELQaxDTWcQpZW6T74iwsIklmPbo8Kj2depIbh9HniplZI+z30wJ7H8lZ9N0TyaA7M0lk6IboROd3/bV3ggdDnAwBCAggAQALm/UaI/tBUkqIIZ3EA2KGkzL6jnwVb7RYw+gBA+gCw1+ESLriAmG2z2DLr2wm0ecKsQ7EDRIAEev2JqhuZROx/FgC0oJ8F4naw7Wq1AOjFxdy3XpnulgKx3CqRrSl8LS6jDwCkDwAALf8PAN0sIPab5XgCCQCevocOkZMUYDThMfmxWYmd2SzsTwBoBAHDIcuusuYkbrkUNWAD7aQ3oE4+EfYTwHy62f4DAPwPAPwPAEn7f4HQwGtzU7jiptfistfhItmZMufNeLkf9B74ggGuAAAYCMjCg9sMzE7QLgIAAAAA/w8AADhwKcNRbAPCMvGpQwwA/9j/4RBtRXhpZgAATU0AKgAAAAgADAEAAAMAAAABCAAAAAEBAAMAAAABCAAAAAECAAMAAAADAAAAngEGAAMAAAABAAIAAAESAAMAAAABAAEAAAEVAAMAAAABAAMAAAEaAAUAAAABAAAApAEbAAUAAAABAAAArAEoAAMAAAABAAIAAAExAAIAAAAiAAAAtAEyAAIAAAAUAAAA1odpAAQAAAABAAAA7AAAASQACAAIAAgACvyAAAAnEAAK/IAAACcQQWRvYmUgUGhvdG9zaG9wIENDIDIwMTcgKFdpbmRvd3MpADIwMjE6MTI6MTIgMDM6MTg6MDMAAAAABJAAAAcAAAAEMDIyMaABAAMAAAAB//8AAKACAAQAAAABAAAEAKADAAQAAAABAAAEAAAAAAAAAAAGAQMAAwAAAAEABgAAARoABQAAAAEAAAFyARsABQAAAAEAAAF6ASgAAwAAAAEAAgAAAgEABAAAAAEAAAGCAgIABAAAAAEAAA7jAAAAAAAAAEgAAAABAAAASAAAAAH/2P/tAAxBZG9iZV9DTQAC/+4ADkFkb2JlAGSAAAAAAf/bAIQADAgICAkIDAkJDBELCgsRFQ8MDA8VGBMTFRMTGBEMDAwMDAwRDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAENCwsNDg0QDg4QFA4ODhQUDg4ODhQRDAwMDAwREQwMDAwMDBEMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwM/8AAEQgAoACgAwEiAAIRAQMRAf/dAAQACv/EAT8AAAEFAQEBAQEBAAAAAAAAAAMAAQIEBQYHCAkKCwEAAQUBAQEBAQEAAAAAAAAAAQACAwQFBgcICQoLEAABBAEDAgQCBQcGCAUDDDMBAAIRAwQhEjEFQVFhEyJxgTIGFJGhsUIjJBVSwWIzNHKC0UMHJZJT8OHxY3M1FqKygyZEk1RkRcKjdDYX0lXiZfKzhMPTdePzRieUpIW0lcTU5PSltcXV5fVWZnaGlqa2xtbm9jdHV2d3h5ent8fX5/cRAAICAQIEBAMEBQYHBwYFNQEAAhEDITESBEFRYXEiEwUygZEUobFCI8FS0fAzJGLhcoKSQ1MVY3M08SUGFqKygwcmNcLSRJNUoxdkRVU2dGXi8rOEw9N14/NGlKSFtJXE1OT0pbXF1eX1VmZ2hpamtsbW5vYnN0dXZ3eHl6e3x//aAAwDAQACEQMRAD8AzSJDGgAkAAujw7pOYNAfc1P9xTt51HPdRNumIjUAAePdMGtLnDaOfARwOU9nEtjx8OFFhLg4RyRrx2akhctYAQANOTCcbTrAjtIT7Y4+fmk0DdP3pJYEM3DQE6z7YHH/AElIMY7QtaPOE79HM7fS1PwS8o/vSVSzW1jR7Bp3hRuqAY9zQNu0mQB4IgiNfghXFwa6Dy0jT4aJKKVgAjc0eJ0Ck50wdrWx3gKMyYOgCUT80lLAN7gGUwADXgCZdLRHkNAkSB/EKbCCOJ158klLNrG33c+CfZ8JCnoeD8E3Mg6EcoWuoMHiSGkeKYbQBGpP4pPcZaCO5B+5Nt79zxHZFb1NK3A6QPEwNEj6e3UAacwkR49vuUn/AM28gfmnt5JKf//Qzxxz21CYEzodPxUNjyAC8n5DwTipw/PP3BRNxT4/LB51CakyXg+I/I1O6l5P0jE+AUK2Ol0PI18BGgCS3tol0M/HRIADXklQDbY/nDp/V/8AIpEODZbYSBrqGnT7klX4Lu+nX4S6QeeFMkRz8IQT6jrG/pD+dGjfDyU/Tc4yXn7gkkHfRl2JJ48EK36LgOYcCPkUT0nwfeeI4CHbW8Mc4uOg0kDwSUdtuiXTaHTBI5SJhunhr4pm1vIALyBHBAP8FL0if8I7QeDf7klfRCRB1RaXQ08yDAHwAS9An/COIPGjf/IqNbXgvG8gNdwQ3wb/ACUlJTP0+PEFO5vEmT3Qwy0MDd544hv9yTmWcGwxHG0fhokri8FrC3fWB3Jk89lIxIHbuhPYd7QHERJ4aO3kE+2yf5w8eDf7kkd9GYAPfzTWfQfEiGu544UQH7tbDu8NIj7lFxs2Ob6h4IIhv9ySr8H/0c9u0MBPPHzUo08CoMIiNY8lKZMFRNwK1A3HlDYNXAaa6IgewgwZ+H8EJg1d4E/doEkHcMiIBkiFGD2PKkZnz/2Jtw8PKUlMA2LWSf3tPkrEiYHP+uqA7Sxo+MH5Is6cFJQ6rkfuqNo/Rlp7/wCuiluaBJP+vko3EGoka6aEJJOxZAkgQU8Dtp8fBRmNOPBOZ+aSGXbU6HxUGBoc/wAC6R9wUtxjX+5RYdXj+UYjXsBykg/tZGYgePhKi4kHwjjwUo1M9lB7YdpweR5pJYvB3tnkSngnWfNPDS/TjukZjxHOiSAwjmDxyQovadjiTHtKmTrESf8AXlRsINZd2gz9ySX/0sZubUP3iPh35TnLocA1xdHdsaH8VSNYmQfOBI8/5X+v/grhrgRPbxQ4Aye7Lwbr8mkae7UQNOw15lRZfXLjDjrA08h5qq4NIBnnWR5/7v8AX8wlYhsmT7tCR8EOAK92Xg2ftDI1DvhA/vUHXs0Aa6NZmB930kIvGuslRidQjwBHuyTHKqAa47gATqY8PIqTc2o8zPPHCqvaDzGvl/a8VD03D6JJPl4j/X/X8wcIT7sm83KoLt0uc4caRGnxULcms1OY0OkTqWwJVVgH0SYDtEzgDuIJBM6f70eAK92Xg3/ttR0LX+P0Y+fKl9rqENhx0kaDT8VWLWucWkuA4HhromcSdBrJA89NwMf5qHAFe7LwbRyq9fa77h/AqLMtjZlpl5kD5d1XAgSP9dP/ACKYt7a6acefPKXCFe7LwbX2xh1g6jsnOQwgS06KpqJP3pt+unOnx14S4Aj3ZeDZdksNjXtBgSIjyTnKYTO133D/AMkq7fcdOO6Rc0DmEuAJ92XgmdkMgw109tAAfjqo/aGQ4EOBIM8Rx4oU7uPFRcOeEuEI92T/AP/T52f9fkpCPo8fh/r/AKs/qIgSf93mP9f9alA9oZIIHuLiImfzdv0fb/6jSUs5rQTPxUtNsfimJG3XTQjTy+H/AEf9fUTZNbfDX8pP8UlKaAR8OFIaHRJvn/tSJM/k/wBf9f7CSmNgjz5jWOyYxOuo79v9f9f8Ipnjt5QFEBst3AxOoHMeUpJWcAWzPjI+Xh/r/LUBAOp7anwUxodw+jMieefb4KD9AQHcT/qP9f8AzBIZ2OjSSAeR/v8A3VIEgaj3HmZPb/X/AF/RpjqY005B7Qk8agDUeP8Aqf8AX+QkpkGy0umJ1EeaQ0AI+KTTDdHa/GUmge4TqHEdh4JJUSAfj4/d/wCY/wDQUSGzPikTrp+H+v8Ar/4IkDOmmnw/vSQyAImdfBRABd8fyJ2nkDmO3kk1JS8AfwScNJPz7H8PinJ00/1KXY/6mEip/9Tn2gAcQY/gnLTB1MRwJGv9n/X/AIxNBYW7RPHnp/1X5v8ArYpmC2eANPv939V3+tlaCUVgkaanXTWfmmbIbJOvKRDiSSJ+KbUBoI7TPzd/mo0hLtBE+Up4jQxCi13b7lOPl+ER/wBT/wB8/wCMSUwcBoI/J2CeAYA47j5fNIsHtHc9vOEmuIJESOQeZP8A0v8AX3/T9StBKiD3JJ4HMeX+v/VoTwZ0iNde3y/1/wDMzWSJg6nXx0Pu/wBfzP8ADf8AGgeCGgxqNT/5GUUMmlvqObt+iTr+CIWN1O0aHXT+8Kb2kHdOh1n8UxcIDmjuPI6ah25JLE1j6JbBPkAUmNBbIHHgJ0hqIxxI2kbT2UGy0kDUbvygT/0kFKLQBqOOPmocSBExpx3U9SD5/wAdf9f/ACaiTrp5yfE/6/8Ak0ULa8nkcfNOyHA+Xj4KMkNd5Rx4yk10Rp/qP+/JKSbSJj/X/X/X/RpiBHbQHyiFKZEj5dtP9f8AM/4xMWiDPaY/H/X/AFsSS//V59z5aBHhp27eH9VJjoHuJOukDxR2YYEan4kpzit7mJ/vTeIMntSa7munQQBp5fxUZ4J+Ef7VZfh1lusx5H8fwTjEa5rtTAMCfCAlxBXtS8GuI5jj79dU4Pgf9f8AX/X9ywMQfvE6cfD+Ul9k/lbfIf8AmUpcQV7UkDjBbpOpj7oUHulxI+R577v9f9fUO7Dl7RvMEnTuI81IYgDYkjtHKXEFe1NA1wPi46OM/wC395Qc1waZ00In/UK6MJh5J+H+5Rfg1+5zXODgDE6pcYV7UvBqyXuE68c9tv0tsf6/+fFIV6e326k/DzVqvGrIPud79CfbqPo/u/uon2OkEBu6JkjQajzLUuIK9qXg1Q4ggcnw/wByiXtHI7x5R8IVsYjDBk/LlD+zUyW6naSJ40+SXEFe3JqOs7dk41aR/rorQxaoMA/en+zV8t3DXWD/AJwS4wr2peDULYB7fimaWkccxyrj8askNEjdodewCiMNuskxPbx+aXGFe1Lwa868qUw0/A/LRHOG0HR2vio2YcNP6Q8Hw7fmpcQV7cn/1s/80Ce0aJTGkTCgSQB7RHcpwS6TEzpH96ibdsgTEcz+VRrHuOmoPJUmg8HWO5TM5d5OSV2X7RwE/KX5E4BlJLEj3N+JTg8prJlnjJ/IoF7uHCPBJCQl0SExduY4+Xz4SrmDPIStb7HECNEldFxED8EiSdd2iduoEanslA76+SSWAed0HvqmDZLiD3U9REGB5JqyCX/HT7kkLbiJ7z3Ttc6ZP3JnDXQfBLYWnz8ElLvDS4T4FRa48E/7E75D5OkNMhMA3bOuh1J8SkjqWZJGncpnD2n4JuO8ypPPsPwP5Ekv/9fLmz/RESNfcP707HWDip3n7mqYPbw0Um8Som39rDfZOlR+8ILLLS+xzazDXFp1ETA9pVpQYdXz++SO/ZqSiNte7A23AmGAj+sAYS9W8CTWPvHKIBpG2SUifzY8kka90T7LTYxvp+Om4eCU2HmonXQbgnO71q58Ha/CESe3KSR5sA+yP5o8fvNUbrrGUvc6uGtaSSSI076I6jd/NWRztdHhwkojT6I6nXNgOrLQfEjT7kSXT9DQ+YUiddPmEx3yY+SSfqVi53Gwn5hDa5253tMzJRdS2dQAhkO3EnWZ/BJBUbARq0+XCRukAAExqCSE2k6c9kxAOg0SQuXEkSJJkHXlKHgQG951+CTGwZ5KkXeGsJIG5YzZxAOnieZTWuc2t5A920gD5KU7jomtk0vI/dJ/BJPR/9DOaNeR8UQGRPCEHtB5kE9lL1WcfeeyiLbiR1SdpUGjkg8OOiRtbtlsOJ0AOkfFRrsaQ6XDduM6gdgguNXTMH93/XyTEidR2SNjNu4EeJEhQdZXIkwAPHv8kVhrus0fpmDtDvxARdBqP9qAXsFrHBwI90wZ5CKHs01+SSRWqT/WFG2Awye3+oS3jyHzQrHBtJLnajU9zCSSRSY6EyZHiU08eCRez94RxyEi9viPvCCtFCDwfuKh30Pj+VSDq4klpUC9pcS1wIk/6yig1oqBP8UiD4x+KW5szp8yAnJZoQ4T/rwkpQaWmPJOInQ6d/JRLmh+h5B58kmFnIjz8EkDdToJ+PIUbI9N57lpGnwRC5gP0hHx4lO59W0yRwe6Sa31f//Z/+0YBlBob3Rvc2hvcCAzLjAAOEJJTQQEAAAAAAAPHAFaAAMbJUccAgAAAgAAADhCSU0EJQAAAAAAEM3P+n2ox74JBXB2rq8Fw044QklNBDoAAAAAAOUAAAAQAAAAAQAAAAAAC3ByaW50T3V0cHV0AAAABQAAAABQc3RTYm9vbAEAAAAASW50ZWVudW0AAAAASW50ZQAAAABDbHJtAAAAD3ByaW50U2l4dGVlbkJpdGJvb2wAAAAAC3ByaW50ZXJOYW1lVEVYVAAAAAEAAAAAAA9wcmludFByb29mU2V0dXBPYmpjAAAADABQAHIAbwBvAGYAIABTAGUAdAB1AHAAAAAAAApwcm9vZlNldHVwAAAAAQAAAABCbHRuZW51bQAAAAxidWlsdGluUHJvb2YAAAAJcHJvb2ZDTVlLADhCSU0EOwAAAAACLQAAABAAAAABAAAAAAAScHJpbnRPdXRwdXRPcHRpb25zAAAAFwAAAABDcHRuYm9vbAAAAAAAQ2xicmJvb2wAAAAAAFJnc01ib29sAAAAAABDcm5DYm9vbAAAAAAAQ250Q2Jvb2wAAAAAAExibHNib29sAAAAAABOZ3R2Ym9vbAAAAAAARW1sRGJvb2wAAAAAAEludHJib29sAAAAAABCY2tnT2JqYwAAAAEAAAAAAABSR0JDAAAAAwAAAABSZCAgZG91YkBv4AAAAAAAAAAAAEdybiBkb3ViQG/gAAAAAAAAAAAAQmwgIGRvdWJAb+AAAAAAAAAAAABCcmRUVW50RiNSbHQAAAAAAAAAAAAAAABCbGQgVW50RiNSbHQAAAAAAAAAAAAAAABSc2x0VW50RiNQeGxAUgAAAAAAAAAAAAp2ZWN0b3JEYXRhYm9vbAEAAAAAUGdQc2VudW0AAAAAUGdQcwAAAABQZ1BDAAAAAExlZnRVbnRGI1JsdAAAAAAAAAAAAAAAAFRvcCBVbnRGI1JsdAAAAAAAAAAAAAAAAFNjbCBVbnRGI1ByY0BZAAAAAAAAAAAAEGNyb3BXaGVuUHJpbnRpbmdib29sAAAAAA5jcm9wUmVjdEJvdHRvbWxvbmcAAAAAAAAADGNyb3BSZWN0TGVmdGxvbmcAAAAAAAAADWNyb3BSZWN0UmlnaHRsb25nAAAAAAAAAAtjcm9wUmVjdFRvcGxvbmcAAAAAADhCSU0D7QAAAAAAEABIAAAAAQABAEgAAAABAAE4QklNBCYAAAAAAA4AAAAAAAAAAAAAP4AAADhCSU0EDQAAAAAABP///8Q4QklNBBkAAAAAAAQAAAAeOEJJTQPzAAAAAAAJAAAAAAAAAAABADhCSU0nEAAAAAAACgABAAAAAAAAAAE4QklNA/UAAAAAAEgAL2ZmAAEAbGZmAAYAAAAAAAEAL2ZmAAEAoZmaAAYAAAAAAAEAMgAAAAEAWgAAAAYAAAAAAAEANQAAAAEALQAAAAYAAAAAAAE4QklNA/gAAAAAAHAAAP////////////////////////////8D6AAAAAD/////////////////////////////A+gAAAAA/////////////////////////////wPoAAAAAP////////////////////////////8D6AAAOEJJTQQIAAAAAAAQAAAAAQAAAkAAAAJAAAAAADhCSU0EHgAAAAAABAAAAAA4QklNBBoAAAAAA0cAAAAGAAAAAAAAAAAAAAQAAAAEAAAAAAkAcABhAHYAZQBtAGUAbgB0ADIAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAAAAAABAAAAAQAAAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAAAAAAAAAAAAAAAAAAEAAAAAEAAAAAAABudWxsAAAAAgAAAAZib3VuZHNPYmpjAAAAAQAAAAAAAFJjdDEAAAAEAAAAAFRvcCBsb25nAAAAAAAAAABMZWZ0bG9uZwAAAAAAAAAAQnRvbWxvbmcAAAQAAAAAAFJnaHRsb25nAAAEAAAAAAZzbGljZXNWbExzAAAAAU9iamMAAAABAAAAAAAFc2xpY2UAAAASAAAAB3NsaWNlSURsb25nAAAAAAAAAAdncm91cElEbG9uZwAAAAAAAAAGb3JpZ2luZW51bQAAAAxFU2xpY2VPcmlnaW4AAAANYXV0b0dlbmVyYXRlZAAAAABUeXBlZW51bQAAAApFU2xpY2VUeXBlAAAAAEltZyAAAAAGYm91bmRzT2JqYwAAAAEAAAAAAABSY3QxAAAABAAAAABUb3AgbG9uZwAAAAAAAAAATGVmdGxvbmcAAAAAAAAAAEJ0b21sb25nAAAEAAAAAABSZ2h0bG9uZwAABAAAAAADdXJsVEVYVAAAAAEAAAAAAABudWxsVEVYVAAAAAEAAAAAAABNc2dlVEVYVAAAAAEAAAAAAAZhbHRUYWdURVhUAAAAAQAAAAAADmNlbGxUZXh0SXNIVE1MYm9vbAEAAAAIY2VsbFRleHRURVhUAAAAAQAAAAAACWhvcnpBbGlnbmVudW0AAAAPRVNsaWNlSG9yekFsaWduAAAAB2RlZmF1bHQAAAAJdmVydEFsaWduZW51bQAAAA9FU2xpY2VWZXJ0QWxpZ24AAAAHZGVmYXVsdAAAAAtiZ0NvbG9yVHlwZWVudW0AAAARRVNsaWNlQkdDb2xvclR5cGUAAAAATm9uZQAAAAl0b3BPdXRzZXRsb25nAAAAAAAAAApsZWZ0T3V0c2V0bG9uZwAAAAAAAAAMYm90dG9tT3V0c2V0bG9uZwAAAAAAAAALcmlnaHRPdXRzZXRsb25nAAAAAAA4QklNBCgAAAAAAAwAAAACP/AAAAAAAAA4QklNBBEAAAAAAAEBADhCSU0EFAAAAAAABAAAAAE4QklNBAwAAAAADv8AAAABAAAAoAAAAKAAAAHgAAEsAAAADuMAGAAB/9j/7QAMQWRvYmVfQ00AAv/uAA5BZG9iZQBkgAAAAAH/2wCEAAwICAgJCAwJCQwRCwoLERUPDAwPFRgTExUTExgRDAwMDAwMEQwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwBDQsLDQ4NEA4OEBQODg4UFA4ODg4UEQwMDAwMEREMDAwMDAwRDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDP/AABEIAKAAoAMBIgACEQEDEQH/3QAEAAr/xAE/AAABBQEBAQEBAQAAAAAAAAADAAECBAUGBwgJCgsBAAEFAQEBAQEBAAAAAAAAAAEAAgMEBQYHCAkKCxAAAQQBAwIEAgUHBggFAwwzAQACEQMEIRIxBUFRYRMicYEyBhSRobFCIyQVUsFiMzRygtFDByWSU/Dh8WNzNRaisoMmRJNUZEXCo3Q2F9JV4mXys4TD03Xj80YnlKSFtJXE1OT0pbXF1eX1VmZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3EQACAgECBAQDBAUGBwcGBTUBAAIRAyExEgRBUWFxIhMFMoGRFKGxQiPBUtHwMyRi4XKCkkNTFWNzNPElBhaisoMHJjXC0kSTVKMXZEVVNnRl4vKzhMPTdePzRpSkhbSVxNTk9KW1xdXl9VZmdoaWprbG1ub2JzdHV2d3h5ent8f/2gAMAwEAAhEDEQA/AM0iQxoAJAALo8O6TmDQH3NT/cU7edRz3UTbpiI1AAHj3TBrS5w2jnwEcDlPZxLY8fDhRYS4OEcka8dmpIXLWAEADTkwnG06wI7SE+2OPn5pNA3T96SWBDNw0BOs+2Bx/wBJSDGO0LWjzhO/RzO30tT8EvKP70lUs1tY0ewad4UbqgGPc0DbtJkAeCIIjX4IVxcGug8tI0+GiSilYAI3NHidApOdMHa1sd4CjMmDoAlE/NJSwDe4BlMAA14AmXS0R5DQJEgfxCmwgjidefJJSzaxt93Pgn2fCQp6Hg/BNzIOhHKFrqDB4khpHimG0ARqT+KT3GWgjuQfuTbe/c8R2RW9TStwOkDxMDRI+nt1AGnMJEePb7lJ/wDNvIH5p7eSSn//0M8cc9tQmBM6HT8VDY8gAvJ+Q8E4qcPzz9wUTcU+PywedQmpMl4PiPyNTupeT9IxPgFCtjpdDyNfARoAkt7aJdDPx0SAA15JUA22P5w6f1f/ACKRDg2W2Ega6hp0+5JV+C7vp1+EukHnhTJEc/CEE+o6xv6Q/nRo3w8lP03OMl5+4JJB30ZdiSePBCt+i4DmHAj5FE9J8H3niOAh21vDHOLjoNJA8ElHbbol02h0wSOUiYbp4a+KZtbyAC8gRwQD/BS9In/CO0Hg3+5JX0QkQdUWl0NPMgwB8AEvQJ/wjiDxo3/yKjW14LxvIDXcEN8G/wAlJSUz9PjxBTubxJk90MMtDA3eeOIb/ck5lnBsMRxtH4aJK4vBawt31gdyZPPZSMSB27oT2He0BxESeGjt5BPtsn+cPHg3+5JHfRmAD3801n0HxIhrueOFEB+7Ww7vDSI+5RcbNjm+oeCCIb/ckq/B/9HPbtDATzx81KNPAqDCIjWPJSmTBUTcCtQNx5Q2DVwGmuiIHsIMGfh/BCYNXeBP3aBJB3DIiAZIhRg9jypGZ8/9ibcPDylJTANi1kn97T5KxImBz/rqgO0saPjB+SLOnBSUOq5H7qjaP0Zae/8AropbmgST/r5KNxBqJGumhCSTsWQJIEFPA7afHwUZjTjwTmfmkhl21Oh8VBgaHP8AAukfcFLcY1/uUWHV4/lGI17AcpIP7WRmIHj4SouJB8I48FKNTPZQe2HacHkeaSWLwd7Z5Ep4J1nzTw0v047pGY8RzokgMI5g8ckKL2nY4kx7Spk6xEn/AF5UbCDWXdoM/ckl/9LGbm1D94j4d+U5y6HANcXR3bGh/FUjWJkHzgSPP+V/r/4K4a4ET28UOAMnuy8G6/JpGnu1EDTsNeZUWX1y4w46wNPIeaquDSAZ51kef+7/AF/MJWIbJk+7QkfBDgCvdl4Nn7QyNQ74QP71B17NAGujWZgfd9JCLxrrJUYnUI8AR7skxyqgGuO4AE6mPDyKk3NqPMzzxwqr2g8xr5f2vFQ9Nw+iST5eI/1/1/MHCE+7JvNyqC7dLnOHGkRp8VC3JrNTmNDpE6lsCVVYB9EmA7RM4A7iCQTOn+9HgCvdl4N/7bUdC1/j9GPnypfa6hDYcdJGg0/FVi1rnFpLgOB4a6JnEnQayQPPTcDH+ahwBXuy8G0cqvX2u+4fwKizLY2ZaZeZA+XdVwIEj/XT/wAimLe2umnHnzylwhXuy8G19sYdYOo7JzkMIEtOiqaiT96bfrpzp8deEuAI92Xg2XZLDY17QYEiI8k5ymEztd9w/wDJKu33HTjukXNA5hLgCfdl4JnZDIMNdPbQAH46qP2hkOBDgSDPEceKFO7jxUXDnhLhCPdk/wD/0+dn/X5KQj6PH4f6/wCrP6iIEn/d5j/X/WpQPaGSCB7i4iJn83b9H2/+o0lLOa0Ez8VLTbH4piRt100I08vh/wBH/X1E2TW3w1/KT/FJSmgEfDhSGh0Sb5/7UiTP5P8AX/X+wkpjYI8+Y1jsmMTrqO/b/X/X/CKZ47eUBRAbLdwMTqBzHlKSVnAFsz4yPl4f6/y1AQDqe2p8FMaHcPozInnn2+Cg/QEB3E/6j/X/AMwSGdjo0kgHkf7/AN1SBIGo9x5mT2/1/wBf0aY6mNNOQe0JPGoA1Hj/AKn/AF/kJKZBstLpidRHmkNACPik0w3R2vxlJoHuE6hxHYeCSVEgH4+P3f8AmP8A0FEhsz4pE66fh/r/AK/+CJAzppp8P70kMgCJnXwUQAXfH8idp5A5jt5JNSUvAH8EnDST8+x/D4pydNP9Sl2P+phIqf/U59oAHEGP4Jy0wdTEcCRr/Z/1/wCMTQWFu0Tx56f9V+b/AK2KZgtngDT7/d/Vd/rZWglFYJGmp101n5pmyGyTrykQ4kkifim1AaCO0z83f5qNIS7QRPlKeI0MQotd2+5Tj5fhEf8AU/8AfP8AjElMHAaCPydgngGAOO4+XzSLB7R3PbzhJriCREjkHmT/ANL/AF9/0/UrQSog9ySeBzHl/r/1aE8GdIjXXt8v9f8AzM1kiYOp18dD7v8AX8z/AA3/ABoHghoMajU/+RlFDJpb6jm7fok6/giFjdTtGh10/vCm9pB3TodZ/FMXCA5o7jyOmoduSSxNY+iWwT5AFJjQWyBx4CdIaiMcSNpG09lBstJA1G78oE/9JBSi0Aajjj5qHEgRMacd1PUg+f8AHX/X/wAmok66ecnxP+v/AJNFC2vJ5HHzTshwPl4+CjJDXeUceMpNdEaf6j/vySkm0iY/1/1/1/0aYgR20B8ohSmRI+XbT/X/ADP+MTFogz2mPx/1/wBbEkv/1efc+WgR4adu3h/VSY6B7iTrpA8UdmGBGp+JKc4re5if703iDJ7Umu5rp0EAaeX8VGeCfhH+1WX4dZbrMeR/H8E4xGua7UwDAnwgJcQV7UvBriOY4+/XVOD4H/X/AF/1/csDEH7xOnHw/lJfZP5W3yH/AJlKXEFe1JA4wW6TqY+6FB7pcSPkee+7/X/X1Duw5e0bzBJ07iPNSGIA2JI7RylxBXtTQNcD4uOjjP8At/eUHNcGmdNCJ/1CujCYeSfh/uUX4Nfuc1zg4AxOqXGFe1Lwasl7hOvHPbb9LbH+v/nxSFent9upPw81arxqyD7ne/Qn26j6P7v7qJ9jpBAbuiZI0Go8y1LiCval4NUOIIHJ8P8Acol7RyO8eUfCFbGIwwZPy5Q/s1Mlup2kieNPklxBXtyajrO3ZONWkf66K0MWqDAP3p/s1fLdw11g/wCcEuMK9qXg1C2Ae34pmlpHHMcq4/GrJDRI3aHXsAojDbrJMT28fmlxhXtS8GvOvKlMNPwPy0RzhtB0dr4qNmHDT+kPB8O35qXEFe3J/9bP/NAntGiUxpEwoEkAe0R3KcEukxM6R/eom3bIExHM/lUax7jpqDyVJoPB1juUzOXeTkldl+0cBPyl+ROAZSSxI9zfiU4PKayZZ4yfyKBe7hwjwSQkJdEhMXbmOPl8+Eq5gzyErW+xxAjRJXRcRA/BIknXdonbqBGp7JQO+vkklgHndB76pg2S4g91PURBgeSasgl/x0+5JC24ie8907XOmT9yZw10HwS2Fp8/BJS7w0uE+BUWuPBP+xO+Q+TpDTITAN2zrodSfEpI6lmSRp3KZw9p+CbjvMqTz7D8D+RJL//Xy5s/0REjX3D+9Ox1g4qd5+5qmD28NFJvEqJt/aw32TpUfvCCyy0vsc2sw1xadREwPaVaUGHV8/vkjv2akojbXuwNtwJhgI/rAGEvVvAk1j7xyiAaRtklIn82PJJGvdE+y02Mb6fjpuHglNh5qJ10G4Jzu9aufB2vwhEntykkebAPsj+aPH7zVG66xlL3OrhrWkkkiNO+iOo3fzVkc7XR4cJKI0+iOp1zYDqy0HxI0+5El0/Q0PmFInXT5hMd8mPkkn6lYudxsJ+YQ2udud7TMyUXUtnUAIZDtxJ1mfwSQVGwEatPlwkbpAABMagkhNpOnPZMQDoNEkLlxJEiSZB15Sh4EBvedfgkxsGeSpF3hrCSBuWM2cQDp4nmU1rnNreQPdtIA+SlO46JrZNLyP3SfwST0f/QzmjXkfFEBkTwhB7QeZBPZS9VnH3nsoi24kdUnaVBo5IPDjokbW7ZbDidADpHxUa7GkOlw3bjOoHYILjV0zB/d/18kxInUdkjYzbuBHiRIUHWVyJMADx7/JFYa7rNH6Zg7Q78QEXQaj/agF7BaxwcCPdMGeQih7NNfkkkVqk/1hRtgMMnt/qEt48h80KxwbSS52o1PcwkkkUmOhMmR4lNPHgkXs/eEcchIvb4j7wgrRQg8H7iod9D4/lUg6uJJaVAvaXEtcCJP+sooNaKgT/FIg+MfilubM6fMgJyWaEOE/68JKUGlpjyTiJ0OnfyUS5ofoeQefJJhZyI8/BJA3U6CfjyFGyPTee5aRp8EQuYD9IR8eJTufVtMkcHukmt9X//2QA4QklNBCEAAAAAAF0AAAABAQAAAA8AQQBkAG8AYgBlACAAUABoAG8AdABvAHMAaABvAHAAAAAXAEEAZABvAGIAZQAgAFAAaABvAHQAbwBzAGgAbwBwACAAQwBDACAAMgAwADEANwAAAAEAOEJJTQQGAAAAAAAHAAcAAQABAQD/4Q2paHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wLwA8P3hwYWNrZXQgYmVnaW49Iu+7vyIgaWQ9Ilc1TTBNcENlaGlIenJlU3pOVGN6a2M5ZCI/PiA8eDp4bXBtZXRhIHhtbG5zOng9ImFkb2JlOm5zOm1ldGEvIiB4OnhtcHRrPSJBZG9iZSBYTVAgQ29yZSA1LjYtYzEzOCA3OS4xNTk4MjQsIDIwMTYvMDkvMTQtMDE6MDk6MDEgICAgICAgICI+IDxyZGY6UkRGIHhtbG5zOnJkZj0iaHR0cDovL3d3dy53My5vcmcvMTk5OS8wMi8yMi1yZGYtc3ludGF4LW5zIyI+IDxyZGY6RGVzY3JpcHRpb24gcmRmOmFib3V0PSIiIHhtbG5zOnhtcE1NPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvbW0vIiB4bWxuczpzdEV2dD0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL3NUeXBlL1Jlc291cmNlRXZlbnQjIiB4bWxuczpkYz0iaHR0cDovL3B1cmwub3JnL2RjL2VsZW1lbnRzLzEuMS8iIHhtbG5zOnBob3Rvc2hvcD0iaHR0cDovL25zLmFkb2JlLmNvbS9waG90b3Nob3AvMS4wLyIgeG1sbnM6eG1wPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvIiB4bXBNTTpEb2N1bWVudElEPSJENTNBODU3MTBBNzBEMzU4QjA2RkI2MDgzMDc5NkVEOSIgeG1wTU06SW5zdGFuY2VJRD0ieG1wLmlpZDoyNzRlNGI0NC03NDBmLTY0NDQtYjYyYS1jOTU4YWE3OGQ1NTIiIHhtcE1NOk9yaWdpbmFsRG9jdW1lbnRJRD0iRDUzQTg1NzEwQTcwRDM1OEIwNkZCNjA4MzA3OTZFRDkiIGRjOmZvcm1hdD0iaW1hZ2UvanBlZyIgcGhvdG9zaG9wOkNvbG9yTW9kZT0iMyIgcGhvdG9zaG9wOklDQ1Byb2ZpbGU9IiIgeG1wOkNyZWF0ZURhdGU9IjIwMjEtMTItMDhUMDM6MzA6NTYrMDc6MDAiIHhtcDpNb2RpZnlEYXRlPSIyMDIxLTEyLTEyVDAzOjE4OjAzKzA3OjAwIiB4bXA6TWV0YWRhdGFEYXRlPSIyMDIxLTEyLTEyVDAzOjE4OjAzKzA3OjAwIj4gPHhtcE1NOkhpc3Rvcnk+IDxyZGY6U2VxPiA8cmRmOmxpIHN0RXZ0OmFjdGlvbj0ic2F2ZWQiIHN0RXZ0Omluc3RhbmNlSUQ9InhtcC5paWQ6NWJiMGY2NWItYzgzNC1hNzQ4LWEwNzAtYzQxOWM0MjI5NzhjIiBzdEV2dDp3aGVuPSIyMDIxLTEyLTEyVDAzOjE1OjQ0KzA3OjAwIiBzdEV2dDpzb2Z0d2FyZUFnZW50PSJBZG9iZSBQaG90b3Nob3AgQ0MgMjAxNyAoV2luZG93cykiIHN0RXZ0OmNoYW5nZWQ9Ii8iLz4gPHJkZjpsaSBzdEV2dDphY3Rpb249InNhdmVkIiBzdEV2dDppbnN0YW5jZUlEPSJ4bXAuaWlkOjI3NGU0YjQ0LTc0MGYtNjQ0NC1iNjJhLWM5NThhYTc4ZDU1MiIgc3RFdnQ6d2hlbj0iMjAyMS0xMi0xMlQwMzoxODowMyswNzowMCIgc3RFdnQ6c29mdHdhcmVBZ2VudD0iQWRvYmUgUGhvdG9zaG9wIENDIDIwMTcgKFdpbmRvd3MpIiBzdEV2dDpjaGFuZ2VkPSIvIi8+IDwvcmRmOlNlcT4gPC94bXBNTTpIaXN0b3J5PiA8L3JkZjpEZXNjcmlwdGlvbj4gPC9yZGY6UkRGPiA8L3g6eG1wbWV0YT4gICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICA8P3hwYWNrZXQgZW5kPSJ3Ij8+/+4ADkFkb2JlAGRAAAAAAf/bAIQAAQEBAQEBAQEBAQIBAQECAgEBAQECAgICAgICAgMCAwMDAwIDAwQEBAQEAwUFBQUFBQcHBwcHCAgICAgICAgICAEBAQECAgIEAwMEBwUEBQcICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgI/8AAEQgEAAQAAwERAAIRAQMRAf/dAAQAgP/EALwAAAIDAQEBAQEBAAAAAAAAAAUGAwQHAgEIAAkKAQACAwEBAQEAAAAAAAAAAAAABAEFBgIDBwgQAAICAgEDAwMDAgQFAwABFQECAwQRBQYAIRIxEwdBIhRRYTIjFXGBQhaRUjMkCKFiF7FDwdFyNCXhglMmkvDxNaLCYxhEVCcRAAIBAwMDAgUDAgYBAwQCAwAEAxMjBQEzFBFDFVMGITEkNBZBYWNRcXNEZHQlNQISVBfwtEUHgaGUJjb/2gAMAwEAAhEDEQA/AP548Q3mh5HS0awy1LGovSbCtpfYqwuYo4rBAZzGGGCQ38u/pn16wB9I9tYRJzdNJf4v1l2vItLbRpSnhexPNHWhDqrESFVKBT/Ien/DpY0v4PCUH4huqCNcp7LW1powKJhloEpGB/FfFZfHB+vkDnpnkkfiUAvz6n5AjeWeKTSbAzFbLoYXiliwCp8FlDDGcdv26AV9tAK1EY41n2nF69u3BII5IKkYMZyvj5LNV8gACc4xj/A9Az42aEI6bV6/eSX3ipRPRKrBJrWjZbLt5hmKyL4sg7euR2OD3PQHWj2Apc0MTLK39khEaSYCVYg9kPIRgPGwB8Vz2xnHUDdgs1tTqJvGFNfDBZQtUcFVVi/oSqyrnPf1HUlhxC/DxrVV3ip/2itFPCjeBFeI4UfcWL475Pr0C/GXKf8At7Ue1PL+FDJCP6NZnZaxSQqFYo59MhuwP6/TpU9/GQf+3M92mn1tXi+sujU1Pz7d6zWtXBWinZoVVgqEup8MFO5Ayfp26szFeCglcpisuiqWZrEy1K9WzeMdnY7CenBIxeEEQlSi+UYHbxA7/wCPQWOvtCCELLUoWg62tNFJRSSKJasNeBI0kZST4tFGM/dknIJ6Bpb2jCW5OP8AGdesOyj4/XaeJ2SZY44gHjk7t7eFPc9ix/X06WBr2hB2gzqOMcRgv7mbT69qFjZJHJs61otJA8iRhswiQsqRevZfU+o6ZK1b21WGulx/Ra/cV1g1sFT8qmEYRxIjIyyDx8PEAHIJ7fX69LC2bwlEsNALhtIlFnkaSSGR1BP2RNhVmPYIr5Hifp9OjjlnjfbEE0NUKV9XtKv4te3J5V7bvDDCAWC+2CPJ3xlcHA7+o/UdRYLH8bSAuy4jxpTsrNvUo9it5zx/iykmTIJwoHbJ+pyMYwOosCv4iuC6HCI9hKH2nHxU80Wd4XtKzZ7Hzyp7AA/xPRYF/wARgFXnHAePV9NNtakSBlxHEsg7hvPKfco8sMP1+nr14MqwFJkvaEOgucN4Rx3cLtJ9/GTsNXsLfHXR2neOP8SNc4AZUChW/TplZWAMJgoKN0Z7Xxzw6CUSXNZGg8Q8Nj3JvFlkPqQXAzgf44OB1HSA0v40kU5uD8NmnEr6qCzGv9WGCSOUeXhhMqVYdlIIJ9c9HSAPxBH0CF/jfRWI/eocdgRZ/JGqt5J7rhs+bsWypx2znv8AXqOkAfjSRXo/G8VBrkZ0vsU7Xis2uojM7hG8v5EgALnB/Udh1PSAV/EUSLY6PS0NTo7lPj9WSa+8kXv30nUBASQ/t+WSEOAQex6640JW/iEFemEtXw7j5q2bUmkXa2KS+/LXq1lh8xghY/MkDyJHkcEgZGSOlC7W9opBib440U9aN4qFeejadJnWPJkJPd/PxLBMZOSMjtjqSx8Kl6BzJ8b8XqNr1oams8cavEqzV/cIUqSrMzEtksT2zjoJ8EiUr3x3rgIkHswuWVYVWNa5EzP5AqsRL9iBhe30OemStZ9tJegTkQcPkt17dCCZoI4rLCSGGVPB/wCfkWRgzZP6ZXv36FyjyeEShgLdPiab/T67Z2njR5nf+lFXgY+yGJXGUAz4EfT9jn16VNKt7aSCK/HHHPx3jSCK9KGE4nuVYv6bNHgBgAMY+mPr9epGvxlH0CMfFugDSmyEq1ZQ7yVYAwjV/L9/5En9T2xjPQH40kVE4jTZZYaesq3oLHhUh2FtT5JJ2+3xJ+71Jzj7f8ugPFpQkdjhlKuGiuVaqzVisdqxDG3nlMl1bxBBUD7snGew6ZKJltHtQBCxoKlqaijxVZ6ndaX9qpQlj7ZUKpMKKfuPqxP79AeNnmPLPxtoNnI7WOGpL+W7C5JBL+EG9li494I/t9sfaABlul7BP4PWFTZ/Beh2Uqpq4G43aUsks8NyayJYmP3hvdDd19Fwe3UdRb8HhOK/wnDVPtW7jSVq4SSJ5ViaSwH/AJsPLJB8vVsjt11YGv8A4/SCN34ToezLZq7yb8gJ4pTleNYpm8S5VsAsFCqSMdyB+nXPFI0//X8AiVuF8XFjSaSzbsWtxtILm4n1usuCqJYa0sSwTecKmQofJlf6dhn0J6ZWWMSzjIIXaURodf4n4lLH/cU0CbGxbT36tO9buQxSM5JLkqX7Fu/f69+3Qa38F0F5+A8Q1zLdm+O4YJJXIlszbW0Zo3iHiGIsJIpGT2/yP06Bb8ILx4hwK/TSG58Z3688cbIlk3zYEkfmT5lldSzH6E+o6A/D5ixb4j8ZTRV6Y0jUajsEIm9+L2yq9lPuZByf/djpkVa9tT+gDKvw7wp7U2xSrBM8QDJYaaQlPt+4DDYOAw8s/wCXQHjoO7AVL3xudfKtilq1rQUvGxXOvgrPG2W7lfJPcEnqQwP/ANHR0GuLiyivxzxGaKcX6M8VzC2ojZk9vzU5YsSQGLfv/wDX6gsfBplaD4o0l6tOpnkV3H/bQRzyuhTxJ8T5emfTPS5Z/jaRND8T6yCsqPr47lxCsv48BT+mM+X3NIM/bjyyfToD8bSCOo+OtT/eale7RjjpRobt2BAg8g8i9/IeJKkHGVPfppYpPcmDghgtFxPjfRW9tZomnG8Mj+Gt18nuRiNREHYEKRgqWYdz/wCvQyMYTBwTQ1ZSvZ+K9CryWREBF7v4KRhpiclSMlJD6ZBHfv8Ar0qWa/tpI4f4j1EcUVSWrKkEcrTQ1opGjRZJEVCWK9yPEDsfp2H16CPxtI5n+PNZXsGjWphq9MrZWKDClrCqEzEp9HIADMuDj1z0B+NpFOH4611exXlbXRpWtTRNbgrMsaRxsQGHkgVslgDkHOfr1Auz7ZgojHyf4u4PFQuWxrPZmqSptTroLF6KmBhIi0kKP7ZcBvEMoJC/bnqTNYvBw1qQrVfjriPsSPJoJXqyAe3antWTKzhiR44csBn7Rj0/49R0gNNr7aSCFTgHB5tYrRaqYQ0jNI81u/ZUwu+JJSzM4BJZRlh3BHXXFiOfxxH0C9S+MeN21Ly8fEMMcix+3Jas/cfEMcHz9Rn6+vU8aE6/EEfQK7cG4Tev7C/a11i5uL1mWzvJrE0zu0ocM7P7HjGhBAICKF69yGfbSXoC7yrhXGNPutBBLAyxWIrb67WX55bIrrURfDBdiRGPPwjTJAJwO3Sxm85g4FNo1iDgHBToFZ/j2nq71iN5FexKbSlHUfeV9w+2wyw8fTPp26eFsZhIZprooR/DnBVj1zQ8VpyR1GB2VmdfCa4VbH3+B74zk4AycdefJ1Nd+MwGlar4M4RKk9ibTV5NeoZ6teRHjQrnxXzYHC47+n1+nSvJGPDJegW//g7g6Gy8Wpq2DbMrWJDXiMdSdCrKpIZxFkeoKkn6YyD1PIJWwaXoEln4p4JpN5rZqPH6dijFFOmzq34FmkuQsyYMrTBhjJwigfb656go84tBRBOq+O+N73W29pLpallXsSR6Gk0Zg9uKK+YiXA8U8QFKqBkjHpg56GBnB42DhXYByT4z4ZDTatS02vpWBMnjb2sB8rkxbAif8XGe7ZR0Ge3fIz1BY+NR9AOQfFmsEM42aBbINiFpfbQpLGxVY3VQFdfHJwn64Pp0Hpx0fQIaPw1xSTXWIr8nv7Gw/lJszEf4eQX2/B2+7xj9M5Hl3Gelz18Yj/7cQ+UfBHAk1+03EVD8yCCWJ6EcVNPyjVmlVZIpCwwrF/HLKB9oP1PTKzQvksIlR2CHWfHHEtly6bXanj9PVRwauzs7FetVjSpJLHNHGpszR/1FBB/05/TscHqWTNe2sbBeqmoaL4X4VpYy2zWHcxWC9qlp5I5I6srsjSIpaZvcUKpLeKMCcdyScdK8o1vhEvQFK78W6WrWvG1x7Xa7ZqatCDR8Wpz23YvH5QyJLIv9OSTD+anyPYZP16OVqM+DT9Ar3vijT6aqsvIzqIvfidqNCzMq2EmHhKrM0kXh5juCQRk5x9R0B4NL0BP2XA9HUk8tXLRkiYJCp18c8Xto4yGzLGmfLPfJ+vTF8pWvF9qA8oaLjFaJ/wAykfahdAizulaEZfyA/pkl3J/iuT26kW6wTbUBebScarPHNqtELF8SyzQI9Uo5ZnDODJMxBHYAMPQ4x1PID8arAW5pEt3JWfjcRd/GSczNH5x+bdmP2FWJI9cZ6NGRf8SJFreMzxWKNfXiY2YzSp04ZAElVlIkaU5A8CV8gcjP+XXNgj8HhA6cV0tx6CPrIjbll/Dq1oNXDG8ca/029xQxIwFH35yOzY79RYD8HSP294iE4zFZu1qdevSeDYyzeEaQpaiLBTJKFLmOMsfIZwSMEdh13xqxWte2kgvxHeaHklTSrFNUt6rYy7CHUNUqwP7ccdhgJGaIMvi58seX3DtnqGRbB4NFvdNIf4v1t6tMKW1RKUsTTTzR1oQ4DMHwpjC4OQO3/DpflGl/B4Cg3EN1QRrtLZa2vPFij7E1AmNAP4qUWXx7/wDuBz0xySPxKAAT6nn8byTxSaXZCciyUMLQyoBkHwWVSuc4OCe+P06AV9tAG3GUjWxtuMwW7cEnhLDUQe2fIEeSzVfIABjnGMfTsegZ8bNCENJraG9fZNHSikpMoifWmNksuzOGYiRfFkwVznI7HB7noIV/8qPYCt7WRzGZxpYvbjkK+NNPKwJZDnDRsBkL9MZx0dS05C5ZranUzBIUoxRWF8qzl1RXaTH3FVlQEf4gdHQY4gQi47rITDR/tlaGWCNhGohjY+APmW8yD3J7k9HUOi5T/wBu6X255GowTQBlr10kZa5SUgAlGPoT5ZAI6VOuLCAKWsp0/j/frJqazS35p6jXUCSzJHJaVAckeQ7AjPbBGQMdWR89ya0HNHi7xLVexBXoQi21rCmdlZ3jjk+zxZ3yS3bPfsB9euuSa1XGwQlGTjvHKk1hpK1SMOymOO12XAbwPivYKWb1IHpno5OoeMhP0dTXo8qRcdrNSEsn3TV4nDhBjP8ASz9px9rH9s9KhQgOf7Trve8Tqq6wKzwMn48eUQgHHiAOwPYn656j4EcYA3OCa/cb6OemW1U0ETotla0bN5iVWY5LKviEP17gj0PfoKX3LjBk4vpNBVp7bXiuHn0VmSn5iKJ/cQP7yMf5Zx5An0x1JZ41awFBrW/K/ItNEEeIlq6pCPfHmSJPcZe2Bj7foe49eg96EJ7XrEmNJKkTtXct7JiTyEyEhQCOxPjn1P19OpOwjXjr+xHOsISMeaiKcYmUlS2Mdx2OMr9OgAYInkikAKGUr4q5jUH3Cc5fABYD0I/TqBVkznS6elf/ADIbzpspqpEka2U81j8pHb20JAwuAMD/AIdMFJg1tbxxu9HpI45HrauuJoB6zR4jZ0H2qyxlcZz6j09epLvx0AKqaTXm3LHHC0x8IvGK/wCDmIAFPBW/iwBH8wO4x+nS3J1GcbjIIRm1PF+LoYU2Wsins5kv2I5wsjSqp+4K2fFAMAgEft69SXfFiLUuv47FaiD6uFoo2SRzOhZh5egZskkYP69K9BrRWErf2Sx7O22+u0LzU9hYlYJB4Q1xDXi9ly/uHAZfEeXjj7e+cnHVmt8z5/nFvrBx1ej44utgZ6yK3ZkhpwwsM4H3MzAkg5yeqzofQOLqVqOi4+39xW1rHgrVvelL+CKQo9GHgCc9++P8ugU4+p+TjHEJ5JomoOrSxEPK48gwfKIVZgD5KR6Z/ToF2cbB6BYqfG/AxrbMewmEmysuJG2Rj7lPIIYyrv38UH+rP3dxn06BbxcHoCXyD4b+OrFLZ7mrSW9WSWNqK1qsbWGryyhZUdiOxL+OWUDsD2yemVhbJYRKjsFjWfGvEtpyr+3azQU9KlfVWNjJBXrxLVkkjlijBsTR/wBRAQ30yc9sA9+hgzXtHGwXqpolD4q4fpGihtamDbiRmsJRCSR1pC6koD7hZ1jGTgBs/r0tyjW6YxH/ANuK1n4245FFZ/8AvPraVthFrqlDVVmbIjXyDrLN2RmDMXLevbuegPGI/wDtyJvjLTQ15pthFr5ljQywwN2mSQBXV5JGjKeeM5IIz9OgnxuL9AW73x5pq5FjVyUDVmArwNrkkjKr4+RI91F8s5Plg57npi+VzWuM9Ah1uh41GkiS0jOa5WUVQyQhVDe5kqnkzZz2GT2/TqRTrBNtQF5tFxesYJdboBZuCWWauJahjdmZwzr5yuQfQAEeh9Op5JP41WAtvSJcuSSScajdziSczNH5xeZwP/qZVu/1IyOjki/4kSJXCzPFPRr0BL+Qj0qdSCQBZUKESNKcjKZHkO/fHXNgj8HhBMPE9FfNGH+3RG5PKKdapDqoYnRFzG5dQ5wMKPvzn0bGT1JP4Okebziyw8WS9frVY61D2djKUjiSMWISwBecKXKJ5dxnBIwR6dTqtWKxr20kf//Q/mH/AOPOhsyaemKqnUVZn2e3ezCiRG3FI0cckIT6ohQRsTj0wO2T1gGD617JWPsH2a7w0GUhBVdLtOTARY3jBRWHhnt4sR37HPShvgffeq0Nt54VSEIpJ8fJQV9CnfJ/+x0AZyu0WTZ2UgikqbCg5aCGbJR89i4x2YYOc59D+o6bFi1c2ut1sUTTtG0yfZKtZVUuAC3gBH2Udsj/AOyegBY3O30qapD+PJaE/gYLNhW9wPI2SWZcOqgHK9/26NBpYl9ieLX17lbaSyVbEQUTbYiQxuAc+SuRIEH6hif26CtZVralbT0prNeIyRmFYzhxXMs3iSAWRRIFKIp9Se+e2egrPGUdoYbIvx+Sw3mlsFjMElcl3UYwI5EHZfQYI7fUevQNeS1KNjYIa0lW/rWi9xnMKXkwpyh9yNZAwUuT6EnOPTpYs1mYZgNZrrc4fxxIYlWM35I4JImC+MMkspw2DkhRgZ7npkolv+zOIKcEEsInkCrDOtJKkifbIojLGT7j3fJAUD/HqTWhyDUVVsIAvuyxOsldvNYyGHc+f7kdAFO5qaoCwqwWKTImIy3cNkYx9M+p6CTy5W8JYJ68fgY/bWAZBBMQUFQfoP2OM9ADEop7RaV1pGr32sCtK7EkSrJ/TBVVyU/iMEgfp1BSZNWrBSINJZMVze1pVWx7fs7pEUypA3ty4ViI/wCX0/z7HHQwLe2mbNIY2kBlXYSztVnYmpK0heV8BC2PLA+4Zx5Yx69KF0AorluWD270Pivk0LrntOfLyLRxv3CH1DE57/TrsXLKssFR7kNaGSOZZZ/6EZJjfx+0nxGSCO4A7n165JU2SGjFQ31GnR2NT3qNt4pHire6yusUgJXIGTkjsp7fr26aI7BmPB6n583LLtf3Iqyco2ytEFVzNIkntt4qxAHnk+Q+hH+XUrbRksJsjWYtPGTQh10qiCyLE8NyQhUh9vuc/dlCM/49BeBSQTIUsIpkHmYq6L4qsMZXwTxB+gGex6gsCuPxbs8UKsyG07q1SIsEnx3yOwIUAljg+o6CC3u2v1qV2KhJFXk2HhRintq/9YswQEBDnt698Y9egkUkrau7clrV7pD6+SYVor0amWRFf8dWAU4YL3JJ79+gWxml6aQfJqf42slhgskJDXet6FVj8wEzlcEfXpQsiOlXhipV6sSe3F3jSKBwYwGxkknHqfXoA9iV6oRVlBjqhoEjgZQW8h5Fe36noA/DXV5ZzPYSMwxDsZSvl5MPAk/uB2Hj+mfXroXZZFnfVdOgkXYxuuu2MY0lmVzK7Ayh1iaMr2A8vq4wfT16ZWKTOXgvx8Qa7VUNfLeeZ68QiqJ4lp5Ch8PBFT9x9uB6dLGkV2SCbcjBr1IXprMzRu0iszxSJ/zDAAOfp6DpnjFYznIISHSw66zLEdpYtbPY21arWpBPFIzgsyTGRgWJx/LGP+PQx8ytXZ5k1KUL1tCagjiq1q9LESRrZUtNOxVWCksx8fRsHsel+SXXgoCSvr69d4nuhWlwleS3sJPP3HU5RQe2Mfp446gcVWghCYmhEUCyQBAqFitdgU9xSWHgYz3JXuT2HQRyoSrHfvyFq6VAIVb+s87AJJHjyU4XHYn6Hv26A5GpF+XcSQR3fCNiU9yGHxKqVz4DPqBjBx0Ecg7m2c0hkL1vciUKgmOMBlwQPIdsZ6jqN8vUnsS/mRtZooK1tYVFaWRUf2pIsjyjzkEny8R39Og89D530Mde5zer7TzNv7OgsxbFbACww0k3hCl8/aruwkHipwRjyGcdWix86aWrZk+iakcOvqPDGGpQ2zHZj1Y8sIWHjmPIJA+3PjnGeqs+jFK9Bc2k8RmkiRytnwSsAVMU0Hs/1CwwCG7kDvnoIL8cP4mrjptG04gVYG8HIPgf5dvrk/p3/TroYBE8VCQs5g/HrTI8UosAuWYkKCiD9D2LfTHXIv1O5OP6S5XhkkoLPHJ52IZqbEZlZQjuFQqBnGCT00evH1Jtjo7OvqrT1u5Nq1GPOuuwPvRxRN95jGT5KnoO3fPcevQVbWDglBu0SFZq9HY6r842lZzsKGLaQvKDnyjk8XCMfX9DjoKxnGekVKvHas2tr36FuWpZto0UZ8cV7CISj+DP3OfQggEH69AyqzPDDdIaUMdP3jNA7BiaImiUmPyYkHuRnvjx7j9u/r0DSzMMwwUYKWy5JQlkRRLSrfj1niU4RQ6ICv0Bxnsc/Xt0FZ7mW2QnXq/k3N9HOPyK8Vx/GWURsQzIvYv2I8h3x1LBZYT7OELtrasokWzVDWGBF2eFF7jxA+1m7A4wO/8Aj0sXAJ/2/wC26SQW/LzYMok+5jH4+JK+JI/9eoO+KX62qr1Jg9aqiyLH3tzIPNyRk/cO2cd/ToJZVonl+lDchlM8EAnKAR2kHgS64ZPuUYOCBkY9eo6C/F1AOyuC5oXqWYCTtak9CwqmNZIZPLPmPLt45Xsfrj6dNGQ2RP1tynGpjso0da1AqhmwAQnc/fjyWRTllx6jqTWlm1RFNJVlli2OvtyN5rV8RgMQSD4/6nOMH9e/foA4YWLtWWo5FZqcaTV9pC3tvNF4syh4mJIdFwMsMMPT16ABnG1ZZ7diHY/kUrEskcsEkYR5JCwBZyfFfFSMAdBJhnMqdqvyzX2I/fsTPLZpVK9l1YCqWW2pUnIZiV7YPYdMGJ92rd0+la92SzBR/udiGPVxQRvrhXUPNP5DLe/gYQnIPqR0sXeN2S3WtUJhTemTZkl844Gk7DxiAJXBxkt6AH/HoLMZpLkt+KnBamX8WugFil4Nk+LH2yuGADJnDN6kdKHJLqZlq+7Yq1WguSSPKzRsqoz+OO/f71IAGD9B279SMEVreRibaSmP3Tr634MgrkGdpsljHCpGPub1J74/TppYwPuVm9TD/HKH9m0Wk1VuRdhYrwo163KGKJOyHyeMHsOxPkB6evqeljSrLUYKQ1awwBrBlUoYUEMfuYJBK58ovbGQQOwPb659eg6LBtKgZXb3pbTExliB5BT5BfsyML3Jb9T1AHk11ZozAZW+0NFEIgFKs7Z7kDtn0B7f+vUkA21LHKhrMQYpf+4nEwKsoWdJGXKklipUFvrj16gY7Aj6q7Qfl9mxR1Zqz3NdZm1cjB41mrrejChm9QSSS4GO/wCw6aZKP21eJtDynftdN3kMyXdZs82Ldm2EQVUC5RKZDAKoYfciqS3qTnpY0rTMEJV2/wAn2q1PGqpO1bzaDXWgPJXsE4dMMfNSFyXYeg/fpko2c76QjtXsE/lWtaljYTMJGltJ5rFGe6+wPJsowGR4j/gegX8bO5dlJ5dVPcsI899q2vX2oquqTsHZWw/kHYvlwSPXue/QWXjIIT0UNGdppmGrehLXBqJ4zLKJCJBKokI8lHiR5Z9e+OltC9V1+IzT/l2J5WaN5b3eMV1ZTEsIHmvioH2nI7ZOT36D33iJIi089h0dordb8lbkYaNK5ACBAHLEsScnIGMdBHF/cgOiWpLClWX8ZZpHPvMzSTyKV+73JMHtknBHr6dR0PDi6lOTSx64saPuVoVzReZC6P4sQW/qEPjJP3Pj17Hps5M52scf9phh2dsbKOqj3KeqdnlkcohxDOB2fwkyA5AH6jPfqNCkyeyJ/wD45aa1Nx/XLCP7RDOdpt5ZayJF+THK8cc0IUZ8kQp7bH9sDtk9Bk/ZC59mrXhlholQIxVdLlJseCo8YKKw9vPbxYjv279KG+Bd9qrx3JZ4gkJRc+aeUeVPZkGfIn0/+noAzr+6h9pbjhhepf17l4Y5ASr5OCy+oIx3z+h/XpsWLVza67WxRNMY5Jk+yVaoRTIAC3goTAUfXJ6AFjd7fSLq/D8aSwZvAwWp1b3BJK3kSzLh1GO69x+nQNrakns2I9fBdrbSWSpYiAE20IkZGH8gyOfcEf8A7gxOfToK1lWCYG01tLTjl/HVmEgiig8pJA0jDyaNfPDIqEfXuc+vQUbONnh2hwK3LMEtilYeOUBbq170o92WKQAp7UmFPj2xgjsRg56VLJbJAyzsE9ialsda0JkLtDHeXAIKH3I0lDAF2PoSc49OjoWarMMxxXKy/HNs1qwZLAsKPx/ESeBuEoSc/cEAx379Wixh8l/2QY000Fdfbif8d7ki2JGZmMeVTDZ8j2AAHYf8OlTbtKl6zdrTBBsY68lVUdr8s6lfKJxgKWP/ALsHsR+g9eoFitap2BRP9qEELGsVqkfZWQRyAqSqKcD7cEYx37/r1I13yYzzTRV7sN2P24AILcLR9iP4P5vgsqAr3IyB26VOdVRe2+0sV7NK3ZrMK1adbNuK2oyK1lgjM0idsAlT5g9x9B02t8ytzeN+jLYhMO9trUM9dbUSbZpIFWRHMbLHKCRj7gjAnPr1DIt7aZrQUg+0qiJ18PzJVCyvC4jgYySf039rOBn28ZH1/wAegvOISyTT6qQxV6vuQBQ9iywIPlOSodPElZCQuHI9PTt0HJZhtieyJDlUiAqNEiq0cr9v6jqFyWHpkH9vp1IgWRalnjlsRhJGBZXbxIR5FJV/HOGz2z6enXAyZPwm5NbO4evEYTHNJWLMQUYLK5BwAPEjPcd+mzNYHvBTamCpGvuyMs0yBYLMEYbFmQl3+1j/ABKr6+v6duli6V3jpU11oV4qVJorKxhpxYKqqLgp95bHqc4/X/HpYvOPqJ1t97QvNYtQ+5FJG1WGVlDAxMp8kVWx92PRsev69Mig3B6qa9thiSxG8bC3Rup4ZJK4IJIJDZwfrnpUsQ3NNc1fGdfpFjnpyywQUpqc0DiCQ2pGeUiVh4o+Q5ZTkkD6ADpoxa+k8ztUJyQvT/EQsssSqbEl0SLho8+GBGPTOcjPr0tobhX5liBVE4DS/wDU/gikg9vuAOD2JH06WgGGji0fAyeJCLYP9NSQOxyM9/8ADr3KwD2Y3vIEc/cGWP72BDYUnII+pHbrsXGrW04oYlq+0v458HkVcgeMUyO2PE5JXxBf9uuSNNgram7Q/wB1WrNKh+BPc11mbWTMrItiAXowASckFicuBj/HHTTBS+21qxSi3GwuUG2G6lT8m0XkjuXVHisaEERwxxkZRSMgAj0ySelehd5PJwwi/JuKs0sS2dlamijjDSz2EDe6jHLLGrBVU/8A22T+nTXG1M0zk6xdloV7cgvVagaC7HXlhXdSSkgZJVmjUkHOfTt0saVXBnEmpKsn5P8A3VZvbFauJPCFHQkD+mjd/wDEt0B4yCHUtJZo15I4ErqplHtRyweLeUisWYeg8Rj1JGcdQWHUnd7E8knsK7zqPBa6uGjEQUyAqB6ZI7HOT36kb3jlInaazYlVpIrNZbCWo1aNK5wIwn3FiWJbJ7dsdAcUrjSNTlhjryfie9Ix92UmWeRWGG9yTHpnOCPX06joL8XUrHTJrS70lkrx96MthWdHKkgkCRg+CT/JsYB7dNnJm22jQamCHaXfzYaqSW6uuLySyFkBPtTheze3JkeZAHpnv1GhSZPZP//R/m58RJcu0uLUiHhk06XI7MdRwr4/NnkcOBggFm749PqO/WAY+Z9j9krWD6Hh2sqNLVJ9uBEibM8Y8fH0P8fqCPT9elzWljZW4QruQr0vFlEagAKQuc5HbuT0wQJc8NfBgE5ZIIiRafMkyocAoMY+0+hK+nQTxRZlWavW/uUetexD4NSlnsCOPES9vNc9jjIx+vfPQQRIInjWEu2bsTWotg0QVYWlcLIr4yckH7V/0+o6Bso62Kxann11cr+LLh5Ht/dCBX+1XU4yxUD0759e/QNcbU0fQAamnNtr0DSUKys7Go3aWUE+KAMewby7j656WKtr0jN473I4pLF3YzGLW27DyxvdVp4PcbLloWhx447eKjJGCfTpkXaxkEwefct+DWba61Xh3cn41TXWJkzZLElZUeRfFgBk+GQ57Hv0FYyrPCdWq34+trUoR406WwSU1YEfzSt4M5fywcYLd09cnHQLY3eqktRHScW4ZlimLGskMSFpJEkH/TxMG/xPfI/Xo6Gt4xZhiarJFCTEsNEPE8OFR/Fny4kYDyZw3YM2T6Y7DpU9ji5FJXkmswgiGZg8QbwknjTz9yMB8Y7Zw7f6h2PR0PTiahMRQokUliEKLShmabIX7lyM5x6n6/8A2Og8wdr6IiN42bDQ0LOKkrRhUkc5BB8lOT27Z+mMjqTxY+Z1XtTRVY66oavIqkrya6zDg+UZGGcF8AjAz+nfI6ZMT8VJyWtYNkOY5p5Vgsezt5rx8Jog9YkHLD7mR1B7gdj2z0ua0A7yvubdWeHSTed6q4tRCs0fm1bxCSH+qXIHofHsSf26gVYrjBpj+DWrVoq4lngUT+FaP2DJLIPIjBfCgfUr6HP07dAL/IILeuVLSQUInMzT04Ky0kLuRZm9ppXAxhcnsV/XP16ZGuTZMm4XBa12y+QaMJjhjp8r28NVTJ73tx/lHyOUPcl8lvrk/t1K3zMTjNgeYNkmwm2arVSfXN7aVthHHJGJ3WT7j9wVh3GR9CPXt1Bo9oIVqy2o0nlUWf6iwxVVyihPHuxzgd/0+nRqMr/I7kifBMERN7waKGZV8QR6AfdjDdsf/T0uNCztZbuym1715kMVZjq70VhgPtsxtHO6H1EkanAYgfcT49h0wK5KyMkWrqK1nYUqoDSzF68z5VPbQYBGMEdu+M+vSxZrrUSvarGKGWwt6w5kgSuKgkDU1wctIE8QTIc47kjHXJyTwH3YYpoJ1hZJAS0qsfEZAIK4x3A9cf4d+gk5hRAwZYvGWd3BEGCyRn7hhSCc5Hr12LkdzYRQK4mIgr/Z+IZWVWOT3z3OMnv+o6gFVRE2Sy7a1HWS3KNfDF+DAk3uM9i1G3qyKA7Due+ASPQZPTK3zM3nKE01IctfDNSrPVpw/dVbxlLIGMokTEzSSFj/AM39NCcqPpnpYslq0waj43ro7Ul2z/We23h7Yd/x2VOwUM7eTj6nPRyi78HBDdAkxQT7OyY0jt0aiwxySZjtPFn3IySD9wGD+4wOmv4ikZtTcoM1NrXuU61ynEJ4pAs0diEq2Qx8JFIH1Qg/v2z0rxTScqtCV556/uN5oJ4pVf2ZCC2QCFUuD3GO4yvp0FKT6qGu0KysDVjnPm4sKEEuMRr7v1OABgH646kYObMDfl27ake1ERDUMeFAHj5r5KThu+QCB0AJ0yq1iVlWSOOUDwiL/f4BwzAE9j65H69ADJVpMY5Ir1eWsdhH5R1cShWySpcefqF9B9B69+mDktpC9WnLVEmYPZKOiEt7eQV81ZcH6fp69+lSyMk4xHHLzClGkiNNLrbNGKNpPIvA23Wz+SGPbtKGUA5OSQemewYlb/ujbrk7r5xlewMlOtYjX25I5GPmzqXPoCMtn6Hpc+gtCxNsRD+Owf2LijxUQt5eDu+Ptx/pI/ke/wBemhUkn3iRbKPVwWBfmCpNa9rBK/d44U+oyTgdAH59qK116tqykuumh/Lo2wpSUOHUNFIzdnPkT9uB6dBIyCVFl9iBk/KRPuKKFUM7eWPH1+mM/U9ulepPK1OgJI5XZD7ZZikvhnsHYlc+Qzn64Pp/h1J6ALarJU2zGmrw2dmU19Z3ClUDEM57A/xGW6YPJm0W+YWbev0EOgq1Z02s7LDBAssalKsD/asTEkB5Ccn9e/SxSLXt0Sq2w3UM60djCNtuJmjgak8cta2+AGyXJIwncjyAIHcdMizOM9IOw7OJ9veaGGObZ0YvYuWxJ7SNlhIsckY8WSRQP5kdz6E56CtyVfalGnSzQVTsYo3b8ezYNyKx9+MFVHiyyff657/THQwaX22zZpBSJpJpbkNyuG14T7g2V9wn7Sp8T2HfsR36VNKEijsY0VFSnMggQwj25EAUDwye/Y9sjoAgEZNmSORTI0q+PhI58FVVKgKF/wAe5x10IEh80SPwJdG8Y2Xt44U4Pcepz/h1Go6qJt3WRnYwrI5jrQl7dAx4dg5GPLuM/aSe2fXHTKxkfcuMF7aVH1+rlhgaK7NYtwSV59jJKkQw/lZYeKv4mRR5hT2zkA47dA3hGdaJRrxJDVj85JHkhbzj1NKMSMqQN7qhk9G8Rk4yOpLApwNXub5bPsxEzv8AnihWUxwhyv2LJ4d2GRkEehz9OgCvMLdmS1dmmj1P+5zLqoZYy/8AUatIVcFUHj2GSpyAfU9AGRc2pePJOK6ejZ/uUk1yOGG5MPaJV6rMVLEY7eJGF7DGD0wZH3bs6G1CtNBUjhiqwV5fbP5aV2OAA2V8Wk8iVVfTHYd8dLF51O6EtezXCAhoPIFfbQll8RjB8sMCSP8ADH179SWY5QlAIBKxXyUB0AJbBOPX0A/XPShwXYZZUlgr1IlmuXm9mkCPJY8d2kOcABVy2T6Y6nqejDNGGqRWaospT19NY0ikdLVlyQ7GOB+ze4vfMjDJB/y6a2v7Hz/GLcx2rKaJA9O1UEaWvYnheKaxU8X+3w7l1Pclc+hz6+vShreKcXDDZvmzTrpXTU+7Zhix4eyX8omGWP8A0ypyMjsx79dAD7VymqxTLbVq9WczGSurMs0EYDRjyQN4Bm/b6fp0AMbX67HyrFVaRUKND4t5CRCxVexBDA9/Xv8Av1z1DiiPd5VSr2oIZYUMsDhKDEnCKrp7hYnsFA7MScMcD16kGbIFkt1js603uCWxSWzVWCRmNVY7c35JMyIQHkUIAij7QDk+vTJkVsnPDaiFcJBdpbOBK0n42wP5H5jV8TRhm8AIUDZU4GcAAfv0sXa2M9Us2NLShKGq8ljYRsrUL7yeMg8VyCiqPHBHqBgn69QWfjYKIOryvqWiMlgyGRjXhlteQb25l7AEA4+7GO/fv6dNFbjGaM1KUvxWgZNjZmqBqypG9i5jyaTxfvnwzgDOFwO/fPSxdsBGOzRp1JMqzQtP+KLMKlivu+v8ck5PY9vTqCFVQohVPJo2/HndfamkiAWURM3mFbGWHp2YZ66Hi00hVa5NspHEzM3uK3lM0gOchcZUDAxj9+lzoiA/GhghrzPZFbzmZrMpHl/qCsU74Hp6ZA9OvYWPWrSTlQ0f4l5/bhMX3zJGrHzKgMwz5euT3PQAhch1VeOKzPBRiFtYTcltsf6kjmRgPJTjyUenftn9em1/mV2c2NRA+F0uXtVw+kM1308dqGxHUZUbx/OnkbyUAEKzMMgdh2yO/UGU9kLWD6Qh2ssbzUyTHCixyh54/tC58SPt+ox0ua0tbK3AiyyMqzUyjKIwMBfFcjuO3ct+vTBAj2Iq6iSvHOfCvEP+7c+5MI8YMYxj7T6ZHp1BPEFqRZa9b+5JrWsQlGovNYEcWEHYOuRgkZAX/wBepIIoxE8aQF3JuxvagvvGESJ5ZAsiyepPY9lH8fUdA2DtXFPZsya2AqK85X3Wu5aFfY7RsGHdgFGT+v79AzxtTT+MUIVLSXI1NXXZ8IwpdJp5FJbA/wBICH6fr0u0VjXpF2hrtfsfc2dmGWAsAupl8vvSqrEqVYdwfPv/AIY6gZWWs3SpZoWxDMJ4Tu6UxL2IAVSd/uJU/wBQeLtg5+hPQKs4OttFOrBpn1F/T6rIq30kSrWsJIv4v9T3G9wMqspDjIB+v6jo5RS+MvVCGGWoxSjPerfkJJHG0EhLpKEXOFZcDPf16OhpOlbaCf4ro1n86URVQ3jUrPHH4eZAx7gdD2BbsckEeuOuSCerSLQS/wBNZBEXlhhrZEUjjGQcYBX1OOw6AOnreWQa8X5Mn9WuNeohNVVwQR5swJ9Sc9s9AFS5Ur7uvb07zx3cRuKrhfZbAU+Uqo4ILj/SAcZ79ddSeOC3kneCCuPbg5DpJYh/b5D/AK40BUv/AM0c6nt65JP6Y6sTENf8c6GKslbaa+vbjrrZquiqK80Z8fcDMT7inBDDJUHP6dVxt9dK20cLr1jj9umPxlqCR9dDNG7hsMPMxAkjzUjPf1xnGeoPYrp5/lV3hRFNpRDMPFVLkj7seWPEds5HqemivaWLcliWNmPia8bIF8QwJLI3qpbODjtj69SICNx9YfKE1qyrHfrrtbFmOUhDY990P29iCVIJQfX9emNDNYLemGSzxuvdYtZ8Lkw/rQVvNkeMJ9oHkhyc5xkdwO3SpoVQDsasmrMVq661JnYVrOrtqWswsP6ir5ZYspVsp3wB+p6noNcjQk10ElyCv7s0f9wmYrK9tGBCRv54kJBI8hgIowR6/XpcaGyjUl3W3pjEsmr1UiXNnCI0cG7D/Uhic9/JVH3H9Bgep6YFs4zRhLm63C7jem7RK2K+lSfX1LMo9tVvWiEnm7nDiE/ZgZz3HQK4RbWjVlK26rU6uBBc/KjWIiaT2fadWTxTxlyWUN3JGCe3/DpUvFWgdShCyKqSEzKSyO4Hg5j7qO2CT3x14j53cxM6pJ4+2yyM+ezeTEkJn6BSMjr1K8hjmMccDpCVDHymaUgqE8fRT2xnHr9Op6i/FCcXMNTB+NH7UcjxMPxJkyVUK6mQsf49l/l379h0A0UJrsUt6jYcNM6rapwQgn2Gitz++xaJP5yL4KEC/aB3PfppkzONan2oiomji2sYXYDxavIZgtcssjhP+nkZ8EX/AAHfpflGmWwUE26V9nWpJBHUSvE1HYvFHPJbDtAZw3kkhbJIY4xkdx27dCotksbBNDSJ623qtsNpQISSas4mNV5csYJQF8lPc4Vh3/x7+nUcUssZkqxE9iUPYeev4wRBS+RknxbAI8Mgdj9PXoIY+Z1FPQrwTM6H20m/GaxChcj3BjPbv6nGfoOglf5hauyKrSRyCCZ1EUzw4EojZvIK2PuHp6jqR4ue8WWDyseENcux81bymMmcghcZGMDGOlySJYxWgir15Xuex5TNJZmKk4+4KxTvgZx6ZA9OvYWJGrSzkBo/xLr+3A0OXlSNSS5UAkE5znJ9egnQQeS62pWS5YjpxC1HB+bLbLYkmJkYAlTjyUdwM9vLt00t8yvzWzMf/9L4U+O6xh2e1sVrDSvFYngGwrq8eVew8hYjuPHDhD9Tj69fN2j7r7IW+jNKmUBJSU/KaNmU+K/coc9gPHA/0/8Ap1JdlCWXwmrUKMHm6wuk0srYEQZvLBH18mH6dMEGabqrsKcKVoWkJseM+0tNICJZVPiETJGFUeoP0P69AEcO4glNSvZsflxyK9araZGSNz4+1Ixz/pOeynCkjPQTyw5Bbilrf2WpRe7JI6j8qTx8GzlllIYkMpYYJ/Tt0DQ1U6lhhRW77f5MCu4FZgPtYAKHL475wBn0HSx78aiXL1b/AO87a1CWqoTbvOuVZnL5VfHuSScnt9MdBWqrVrovRaGKukYvwPtKLSNfbX+JbB8T4uuWUBk+oGMjrkZFajrtDcu21vW11cGsCvqNXbf34zAzGdQgkJzGRk4XsT29B02dFWGfZae1Yq07n9wpPIH11eIqOztkCKTLHt5dg32sfTHQVjOMgmHmjq6/IjsNprtsatjUOhZsiOzGjYQPLCwZPEklQGPfOc56W6kLV4QSLr6m0mi3VKSzLsZmmrW63kVt+j+ZJIKOMd4/qBgE9MlnySSvaNm5KtSzBTqCGQhbyyRrNJC/qjEkhgD3U9h36UII1uTJCRahID+TmKUnw8QfE+Oc5x2OB+uegCrOa5s0iyFWTNcySP4MDIw8PAHsyt6Z/wBOP367FyzuKrWQs1SOI7DTMbkUFby87SxuFKxMcYKqTnv93cfp1AZJatAFzV1e1hXkOmjW7JTQflTO0rflwIhOfsPeRMHwBHp9uAegrVWYQNq65keF6sUc8EKS2G9xint+6mY1UEMSzjIH1H+PQMM/IvmL8O5ViltYeYCxHRvMZBEYe7IrnD4X17/U9AvySwdjWuXqlW7mGzOVtz0I2c+0FcIje9GQQft7r6ehAPTJHJsmdcNuzWrPyje9mOFbPLdxD4wL7bO6iJGbxf8AkD4nC/qf8egzuNNFjsoZjUKFbM8gS0nmWUN4KB95OB9uMgAAHI7+vSprTqLb6mW1PRhkesI0im87dadIp0dioeJ3GJMEYOO5+g6CSjFO0l1vZmlfVSE15NhWjaQGZpFjMaAej5OMn079dHuTpoNbHYsQUCJkpPHBYnIVZGkjXsr49T379+oBXF3qgwC5GrilHAY5SfCOOthw4QAA4fI7fU+n+fXIwBrMeytV3SsGrxxebGWdQB4oCcKTnuCegDulCUgjkZjIgKpCZcMfPIOO/wBM+n+PUnuCNlsU1jRKrNd2MzN+LrkADkB/AByo+wdst+v06OggyzRF147Vi3Ds9w0RnnWSKvBMpCQ+TnPswn7y+F8S3/0DpkzWTammtRDPY0sVm7Vk28opwRxJYgrISuSqgBpGUjyLH/RnH+PXXI1Gcbg4dyUje9FDHBXkHsyfd5UIyir447klcqrNkAYGSD+uelOhecoKTWjMZoUkkoNJHGrQzlJWijjGSyFuysO3/DvnqBgV9tThsjXrXnIsrMlk31XtCiP7ivjJJx6svoe/06c5BXNK1oKQT47QGrk/FjdWqbMSz69w6e15fz88pgAt3Ygfp+vbqGfmGEr0aRYnIE1aViyRwrJ4RxfaPtGB9x9QfXsPQ9LEM/Ile5DHWrBEyjSPDNOv3+BbHdVbuAQf5H69AcY8tIyzNVLGSOJFCWnyv9ZW8gAF/l4qcg+memCSbSJWlhmgtQR3wYzL4yBsyzROZEMmMBghbKqOwPrnqRlQKT7EXJTKzSflMq5hv5LlGAVvHOMDPoB0tr8xlf5lawi/224rgV1ZWP5DISY/JT4sQ3ZgCMEfXPbqR4ybR8gpy8s1OmgpGSzodU9m1djCZtQ7bYCxFGoxkMohLMOwA7D6nplk+dYPStk7prTxQWpkAsqxq+9E1UkyeULnLYBwYyQMjLZ+nSx9FFCPUTTbawLNpZvxE9xo5FKZWY5HiygH+n28u2OmTxCF7bVae5rPSrQzMfH+4ye34KmScSBhgAfqD6+vShySOxgq266wfkXLryTRvbTEUaMxX21DAksQxIwP88dAC5NuodTsY4aCNsvwSsEMLKzSTeQDPF3wS/cn1+me4PTR5Drr9t787SSq0Qsr/T90erJ/JWVwMAA4OcHI6VPdZkK0aZktz3LoX2S0UOvkkDSKMjykkKkjKkYUMv06nqV2UvQlHf62XdXQztJFJZQLXwSwjro32gkAeLHHrjPft6dQMcaiL+311WrWs2ZaEtzcB0nobmNnjnHsIcKrqwYyoAQBjJHYnpo6BB0mnGo/J1+9im2tlEtq+MyJNFibwDBl74buCfu+ucdAarVixqd3ZRphtJ5SIISr34VTyMr4UJMi9lHY/evb1OM9+jQo2sZ6Ron9vv66jDe1lxNhT2EMewr1YZPOKxGT45ViCyqMYyuRkDOOlixVY9Uua/dVdlC8leN8pIantWUJkUg59MnH1IPoegvOUEGDrPIwkhkkMLxxCbP8z28WwQ3h39OpPM5ga0lf3bsQidfJLVWuw8GYnIaNz39B6Z6jUdVK8tdnLiJomkreAHgSSzuhYq30BIwTj6/4dAsytWgpC5PBRbW3af40luKyCl2rMR7oMfiwYHHZlPcn1DD6g9M6Hz9WunMZpce1FKNdOZNladvYp27I9oWUk8XRwY85YBcGNT/h+nQaZZmGYMWIbNm6ZtjXZ78+KzxFljkEUY9CkZOBgN93+eegZI6eons6qDarsa9JqbPBWjlj/qRwx5Ei+LkRgSfxJYdx9e/UnuYDzpzXscRttYkiuNsJrbS4VzKEUBWiVftBIzlV7Y9e/TGpkfdmzoblHfhWxPCtBhXIWovtSd1CqCFZiM4Iwcj0+vSxpxj1lNvOSVRlrDZUJgf6fFh3+n6nqT3DVwLVgEpXJwEFdPukYqQBkfvjGfQevSh0zpSuyl+O3X0lCSxsJFmsXglW8FwxVH+9Ia4BIJOMMT6n9um1lqR8+yeTnyU9KIr6u0ZrNzYPHHVtT+0gpSnEcaZIEQYD6IM9vVsk9Kmtxy1GGlEM5aSrJDchQtYg+8w5GJFjfPix7HBH0H7dBYAjdzRzX0hpVV2D+bySWZGZIoCIy6OSCGGPI5/TuSM9B48fUr1LO3lkMIhWGsqRT2LZ+z3LDjxzgYHiP5Fs/oD9egZWWO52BD1obMaXYpkhIjLxHwMZlLo69j932+3+p9egWZycEIPjUyov42vDzyf9w1O34wugfIZplHkAGIJyTknuOgreNO4BYdNbbkGwu7G7HNRrxJBrYXVhECsZyUQ9zjyILN3OP06NRlbGUQ9XimKwSpTWWUqkE3mSvkr+R8vId8gd8Z6gfPatRqyxMs3utmQolU+CN5A4RwM5x65Bznv1IwDptZStSCtYVYLFZZNvrctI0PsxkyOjBfuCqSQrfTPQZ/OYy9VBWgsvVgjomRzIkj6+ONva/hIgdGkMRHkir5YPr5d8HoLJdqtdC6Vno01jpoUnqIFoxWO8hhdvuBP+pvEev1+vUHsFFmpi3CsTiG/bhWwsZ+9mjH9NkPj6BCe/1/ToA9Ms3uv/AFCklWSOPwcB5Pbkwowq9wuc+Oe+OgDyLxl9pTIjSGdoa80Xj5F+/kB49gRjuOgDyeAvIjR+aqJDHM8sreTKqny8CBktk/4AenXQwBuVV0fVz2IxNZamkc0osurNJCX90IrDxCKpHYZP6nqFPmI5tX6KYAfHVH2Lt+etaaZoZpoU2VcPHkPYaRmx3+3DhDkZOO369DXzM17H+yNNlVikreH5bRMy5C+JXyOMLg9uw9OpLwqTSe1NXoVofdVIJFsSTNgQ5YuAR9csM+nTBBmW6q7CnEtaF5P+5xY2VxpBiaZT4hFyewUeoP0Pbv0Acx7au5p1rNj8qKVHq1bkqMkTt4+1KTn/AEknsDgEjoJ5YZr2opq39lq0HuyOy5tS+Hg2csspDEhlZhj/AA7dA0NtSjYC05LYR7daOWSKOng+4WwkUR8v5FnwO/ovfo1LFZYaoqD0+PVNWt6KSztHnr2diMt4tKC9iQlR28VBC9/UjqtFdFq0xMsEM6ez4COpDGsUMXYL4KgTscg5A9cdHUtGViKsY18kZUHgGSwrv96eJ7AK3qcd+3QPAtKlI0hWkeULS8hDsJXVrSIX8k8ZUX98kHIPR1EeKZhsuLWKF2S67G2jsFkuKwBZDlwGQ5Cv9ceh+hHp1ZLMnz/JYKeG7EN2hTeLQ9yuxuIo/HfQ2CpnYM2WaMyfyAB7R+v6HoIxmd7TQUgmpT2PdrOAjMILEbK4MQyqyeajGfD18cDOMZz0qawnas0DyxU5fyY2978C77PtI7pJ4K7BixWNwSWB9P4k9BBbAWxXte74wkEQ2SzBH8JhjyTxxhSexC+nQAG22kjt2RdgEla5TWKEFQnv2KiEZQSjt5D1+nfGPr01qzqIZLGcyEs19XMdhYt8duS7Grs0a9dq2CI8WI2ERQ+gimC4yvox6WaFcb9HNSJqdwyKrwz/AI3cz2KMY9tlcH0dSMqe/dRgH1+vQaXilUzSwB5DAZ7BL2JJXPjCCvcx5Ib9QP8AHqOgvxdThJ68gZhEksokVZ/Z8XMbSAAjDY7AepHTRRsqmb8EuVpbEscviV/JsVacI8lHto5Htuxx3yPIn6fr0wYnGM/WzGj9oqcj1LDNImZFlkYe6S74X7iAS3l2z+n068DXAOpC83hdSnHauxf1bdm2C7CQf6S6erAjt64Hbrk4WJ4cba7LS1NR6U4MdrbbcN7kUEjL3DFs+5J+iKcj1Y47dSNss8PdGC/fi1Gvrce4sn4Ww8XhszzqZWSJmy88rfSWV2PgH+vf0A6DNKqzOTFanXr06coNItXp/wDaSRwq7TMBgsxZz/VBc9jj1yc9Km+J7cCRwJVqRxIksYEzqjAE+JGCD6kYHfoIKleqYy0TSeUp8S/j28iB65+nR1PTlag/ZyxwCSzYs/j1YULswVcPj7QQMZY57EDueoFBHsW9jv6s1cRNS1IjLo5zHLYUS+JLuSAqE9iB38T36bM41k/SDUFWa1qrD01igrM8YkswJmONMYZEjbGc+nkFA7ds9HJFVcZPNNdLccWu08XhDMfxFjCi+jK7l2ySpYnyJB9PofTpU0vWCHaJYb8S1vNmlgEcyzyX1kVlk8F7qUwAcfxI6kFmSCyIpUsyWp/dZgSKoQAJIfuUIoOPHsTjGR/h1IC9rdHPXWtsIWaSbXrK9qsWX3q8MjtIIT5Alw3c5PbGB0zyLBSLK8Nwc7z/ANOaSGUJFYiWYWIj54QjIyP9Of5dLF2Da/hCQtRcSxRMYo3YZJADPn1HcZAx3PUAqEKdlCwsV2Ed23kCJkHkyocMpB7gAHP69QPhE2JA5QSYNR4kKsPJ2jl7DCjuBnOM9+pA6i9qX2lDp5md4q88ZX+ffyGV9CMHqAP00LPMjxs4RJGjlM0jhiiqfLwYDu2T9fp10MAHlNVG1di1G8s5pRpPK1p1ZniL+4EBGAqKfQZ/c9+oVEc2t9HMf//T+LuN36sey5NuDtYa80114EgeaOMzxpGiA+DsCO5bxH+f7dfN+KfdPbdlIbo7UTykRSiNfGRaUscviv8AUQJ448iScDAY/XuMZPQWbPyBtiuawllcmt7xDLayftKj+KgZ+7PTBIuPu44I5PzKpmkVJbV6Z1i8K7SqGTKt3bIOMj06k9xHq6SSwJI64jst5RvHGzsiiNixwo7H7QP1OT2x1Atx9DRdFoIq6RtKXMkTGLxUeOQpLEE/xVRn+P69LFyHb9h4DHaqTQzxQIsklaUlU932zlXJH3eAz/E9yR9OpPHOMfClEXqJsQVBeusK00khtTiFe2CMuAO+ABgADo0GlfmR2fE620tKNDcliYJ+SSofzYhVYH0X7jkjv+vUHmIS6Y0fa3F9K0FiKIwwVZneYxSuxMfhgAAj/SAMevTR48YAp+MBLAsbSXpYneazWMblZImLNnwAx4Z+1fHyx6/ToJJ4WEpgjok19zQZnszNK8R8PDKr7q9wuO5Q5U+hwelDka9Vsm2duHj3ITDHf5AgSK/d9ho5oVDFYowciN/+WPIy3cHPbroX4oC3utPFpdpq7FxthqoljsTbGcO0+uaP+rH7viCftGQ2TkAjIx0Aqz2pQj7hvaj8/YypDPSkf8N6yEJPAEIjDhslWfPYj6fTo+IzyNQbHTteFKSdHrTW0PhPNk+AJyAFk/0YH29SLDTTjpzSJ5KLlbwDPbLo33KoBjPmue/q2PU9cDAD1clnS8s2K1VCRW5DaapP5Qo0kOfIxqgPtykf6lGG7Z9c9dFcysOdO3T3t+3JW16Lfi/7hqkzCrbgBBKkI2Vf1H8QR/h1AqyzPDugW3VvRpYtzRTRxebGdISqWCzd1BVwc9x3wfHHp1IvyYZgHONlFO1s6y0tvZPBXXxrSOiofEF38AcYUZX9+mRRrYMx0O/1VDd8/wBnsJv7Vr6vJt1PUqIk0ryTyPHmVI41Yszg5IP8Qf8AHoK/GrDS27r3jM+tim/JMzPNM6fjIjSjz85WseJIA7faD0amtXA7bIXbureXYtJYa1BDFTp1pBBIiH3Diaf2yAAD3wo6BVnJ+kbEsrPZvyamN1r7CRpf7jI2Wdic5RQQO49Wx2H6k9K9S8Wsn4BYlMIQrApKxtAceTnv5eR9Sfrn/Lqf1IY+ZxVukTsJa39eNfPDAqgjByvjkfcDnuPqeuQK080SiaV7BIiVYoonbx+9lyCqt2Pr2z1PxJ5GovvyC1Jbr6nWxST7NmFfYXKwV61GPPiGlbIAZj2VRk57+nUizLPaO7FV7Gykr0EkmMBEWw2okcIsnj4jDN9zyr28j6DJx26CtZV5gYi1NKm6P4vYvSyqZbQ8TJLklyFDdgpIyQOo0LNbSGEC7w3dYj25p42jXwmoiugYjycI4TPYqBkgkdv8+mhVlmiUpJpIbFSH2lqzXhI3uH/qPNF4vklhgZB+g6WFeSWpba0F/GvnxV0QxTlQW7Mxyoyfuz9D69A0t8i7SiFiFJfEe/Zj9q37RBBDKEc59DgZGM9Az09II8e0e0i1e1qXLw2lmhODq45YhGIQriWAeZPkfNT39MAnqNdSFVaJFckTaipYMTwV5VaWMAnCNk9j6dgwKnqf1GWD2ah+Q8UViT8MsjNVpyCJFXywy5zglR6jOf8AHoF1dSqli5JA3uCaEw+ft2I1BWQknPh54IDYwM+n+HUgMGthFY1LDQ+2kaEGFEy7AjDFfLBGQcEj/HrkZVVIr2y12vsyzXbQppbKmFZ5oTMcjAViMDP0yPp0AstRBGw5boaKSwHaQ2ZE7S16zNY+0jAIVVcfXGOpGmGYDCuEqY/kvlW128klPU3tPSu6yaJI45nT3TDF4hBn2wwKFcZJOO3TJ82W0rZOakblfNc7SHYULIWFoITeRcIH+0F2UOcALk+Wf8OlT6MdVZKc1jcS7L3ZHprmE2VZZYqx9JFMeFXJwR3Jx69NkgWk9ihYJrASVwJFks2Ao8x7WYR4juynJBI+vQAz3IDYs16WycTVrQLUJtePb9klQrN6+WCTnzPp6dKHIvw0rUSLqdbHHYWuo2Ams9pSF/pf1JP9Rcg4b9Dj16AGBtZajmW4t4PburDD+KVX2nkVVPbyZmdkAJx9R9O56g8ApZu7W9dao08F2O1/Sa62WZK8PjlYQqjwUYCgnuM4/j10Vqu6H5mEeKsrlfOSOQVsY8HQZf6/of5E/t0FyL2+rWLkmti1kMTVIyzGdpPbeFC3jlWwW/iv3fXH165PASLmug1FVKDzQe0z/kbOeq3izRs2Y8tMPHx7hQcjsT9T02dAxpapgr2oa7w1KvuxzfjHxXEYy2MZP9NTgZySOwz0AF6dzawzvb47YWrRvSeUdf3TXBUpklF/jG0g9ZFHqe4B6WFN0c9WtPlurt7HWbBNFPoQsD1lWNHqlEPkbIH/ANTYgkNkq2c5B6A408JXpcpknlgqWF9nZPGVr15PcC2oYmX708gCCPLuD/EfqMdHUaWyVYcVC+/D4TM3kzf0YlDHwOMsQcdv3wOjqNcrU8jYFp5I4DEbMxlnjLeSe62FLgEkgFQAB0FisyC7tD82drFWOShsqrf1fzf6bTBf9WQSGB/UemMft0FZk8bA4Il6oZq09c58as62Z9fYRfbfGWIUkDBBOVYYx69umTE8adQGrKteVLyVZbNZGMaHYBi0k2FAVbLKQ/tn/S36diegvFc7BMVb0muMEt3bVbmsej5XBrV8pMoWIUAwqc5x5L933D1HQXvJ1MK57e0k9jRUZBHVsxXTuEfXhY1BmhcIvtp3TzUAOO/ke/TGhkPcuybLrvxJ82Pc/IYhbE0dMmUjyUD6A/4d+lzS6NQxbpqdP3W8KevrgWvCNYvyF8nHufaMRL+vp3IHRxyiZ9zQQ7YTFfUaqxBHdaxe2kavIddrZY5JrJYeI8wcBUU9xnCg59egzf12SAe1rzbC2j34lSwwJp0ajCOKqpXPgpPd3/5nbv8AQYHSvU2+NxkCe0CKwfPsyBoggLTeTeXg2QCfX+X6HoHxqRhqKf5t6Z3pqjyTFVaSQqgygHgDjJOB29ep6npytSCQTzTST+cVPXWqYmt1bo/7iOeT093xyFUL/LGTntjqDg8uWGtuv40fuRxlK6tN5J7kaLgs4GCin9R/x6krmcl6RSqo0CqakxiZlcVdlKnjLEG/6TJHKe6pj9e/r0CyuM7sp+o2JKshWzW8LZdpdjbrDEMxjQH3B5Elsg5z+/7dHQs+RqXIZ4p5YvHLye2qRSRsp8gGwFK+vifXP6dR1GuVqfv4T/mzl0jVsVmiMjw5c+LBlJwGP8fLHoeg8ylLX/D/AATUtPXowytct0Krfe5mZlx/UDeKBj6r0ACb8tk3JY7WoM9ekDJLtIpVaJoWUiSM5+7LgnsMgsMHqTxaVrQkE2jr6m1DuaSuEWVILcxXEQeRP+3sIg7EDyKnB8T5D6DoKzGrUbQf/EmlWIXlf3IJxchGfFn8UJjzg9znJ8fTOOoLkq3LLywR+1RaqkkYkSJ8xWYpiSXjYocqTnAA7Z6AJ6nnYgd0jdGtLDWhkh83ZRHlh7mRkEfv6dAEWadHW2acUaV3YN7ECMUkHmSGZXJJ8iCTn9egksalI9ZAYoNsliMn8+u7uqSRL4BSPFywP3AnvjoI6i5zPf04ePXKuskSCa1HPJV9uZZhJ5PhyV9cvljj9PTptc8ckxDRC3HbdWLY8l242sMM09w1o6zzRIZ4o4kRcqzZU5LYBGfr+3SvFM17bspjalmKSYCGTwQpIKkkc3irB0EZXHkST9uAx9D6EZPQWgLs1WrpLLIfxPfwyWmJYjxX+AK+QJznA6YIF+XerAj/AJlMySoktu5OyxeNdpY1KAqwywIOMj06k9xFq6SW0skUJjtkGN4kLsqiMszHwBx6Y+ucntjoF+PoaJo+PxQRxtKW9xCYsAeJwjFiCwJUKueyj69KlyN5GvuTt52DHSqVlqTWKKv7kd+zCyxxKFwxZAfLK9u46k8s4zRhI4PfsRWn2C/ie1H/AGz8aU/YPZb7gFj7Bi48iR/h9D0EYTSxVLCQ5ADzGB0VbMEZQhnUr6nPYenboLxVonsEzB3sTRxThC8ZCD7Tn9xk/wD0dLDxXLxpaVoGdlkU+8rsDFI5H2kKP0GDj6dAmH+LbDR8f5Dqdlybh1b5J0tf3BteF7XYW9dV2KzQNGqy2Nf/AFo1jdlfCD7sYOPUAmxXo2hASrc1luGxULWYlV45dXDhSgJLD2ST2IPopPcfuemSkyeDgcuhl9eu3RtrStxVto2KzW5RhbCA/dDZUfxcenme4+uR0GaWyc6k9KUrRKs4sROhjtRedeeq658Pr+o+0/Q+hHfrwN70LaLCwkrWR70RCKgiGPFkH+lvTrk74pM8YWKLzbAjUBnAAZ/I+jD6nv69TyBnjEUOY2svSsGhbniBnYDMcgBHj5g5+8f8w7/T06jkEM4wr3FE0kPvl6e1ZREkjFR75B7H3Vx7uAcBHwf16CtZrwle7Fu2f2IqP9xmrr5o8jrXfCDuXjP29/TIPfpkWaZFb/cemVTFYhlpMzFWBgb2g4IRkZsZHiQfEfUdMlcy1BMJnH9tDZv0nZcwU6ra+MhI419+K02fuLDJ8JAT9e3TPQxONZ+tqDr+dJbtyQ6Oq96tXYSyOuEi8PAsf6jKMAFScn06WNHyYC6musClWgv2Y6d14muV9eryqsiscsZ54ySsSAdwndj9f0BfyVEs1uQwiBdTxtYovANDd2OtZf7fVJxlYVc/1JcAFiSVB+pI6CFsFNNukGtSChOjQ255JJmc7e1ccvPNOSD9wX1DLgE/T6dBr1rOgV/Ns5mse5JD4eJEoDMCg7sgz6KSfX16VPUhe37pQOfxZEHtCJWPiq929WyfTqDwFbY8hj1yyySF5oJz7VCrTHuTTTKAFREHdixPp/8AW6knk0TmaW3Y11Gzsa0suyusG1+lBX3oCuRj18U8e5lYk9/T06krNWaxaqaaNkhsbYeaK2UoFvciic4JyTjyXIznGB0E4zGQQli9VtyVKk1WQRw11zZSwq+bo7EeZKHsBk+Byfr0DLQrJcnMF6YQrOaPux1XmGEX2sn7UUdwygY7+vQVvJLkU0qQR7ES+/TdYyqMFP8ATL+QwH79icY6ZBZg7rWqeynmx7YqqwaIxlSY5CGVwmO5Hfsf3x0uWQVq6zaryPUXYtj+LTvK9e3RSJZvelhAaJcg+pQdz+o6gOME7XuVGvaj8URrWVrtIxsO9WZiB5+GeyNlcf4fToGOyCUqFarNAz1YWUs87KpZlYBvFmc+nl3ABHbqRc9mVUT2KsHuRvEGilgP9QOe5UuhyPLOQAf/AKOoLAJUxPMJW8WQzRxQRTqSSPbPkPPy7gj9Se3XIueFalDXT1Io0gVv+lCSYzlmIYqxOS+CSD1IweamSvrK/hBuIrClvzYpHdUkjBULjxYv5dxnoAA8x3lOvobtfXSpE9tJZq4jkWUSEyYdmTsfvBY/4fvjppc8MkxDRP/U+HrtrTWDTku6g16MCGVJrWvdU998zL7jKr4UNkA9zjHWA6n2PG412GbYOaVbVxI9Whs4akspNoiJplSITYcv7dhOwOewzgdBZcWc5h00FizYoT1E3g2BSOjMsq+3IwJ8wzVnBV2yfXAP646CFq5ePFdI8oo3NjfpV2H5CV60gkRZDJ4Hyr2g/ng/aUDfv6dBZcmiMZ4pdrbWBtftanKUrp7CQbLyoWAoHdWYecXmpI74XGMdKFkSTPNqpCt/WyVDKohMDjzikI/j4PCWTPkexJ7jqeo3y9QJspkj2tTV2pP6uoVbt/WOyATNIwB7+hXyOO5xgdumjM4zpNNVGjaN+RHDVVhJXJMtxQAwCKQ4zjHocHHS5qigUlJkeMmZIQ008Qx5+JwAMevivr265FypX1ZHikdtlkETy0WYo6Rl0/0iUEZD9+/QAtWtHuP7NZmuSR0KlWRrmwRE8XmA+2SUOgJBYj9s/QY6AIn11CG1Dcq7OQR+x+XbhnV1b2vLHiiMAXQEhZGPp36k8OPqH7FaPaSbzR7K2K6s/wCYTXMLxyxzMjBe6hSoIyhTufXt9eQBU8kGhSdLlSS5rVsRtp+W2XjnMdpHVmWw4JEsRx4hipKjIYlfToXZxpU3MCaTZssc7cl19qE39rTrSiH2nmfLez7eQQv2+KfUYx2x0yVq2TvUiWs67lLFuSUgVY0aR8t9sROFyvfGTgHP/wBHShdahODXW5q8F9Y/xrFWY+VeYjCyQjxc/dkeMgPkceuOgDvb6ihvqUSvsBNLns8jNGY2ycshjOfNsY66JnB9lNhaOuqbF/OaNVNDduUFpvBwpCnOEYYHqcY7+vXJAQS9uIthYqw3G3UOuAgRtmjW4/Fk9Ipm8WcEYJz2B9DjpsrmsZAELnIt1xmzqdrbSpuYJFSSvBQmavZifyAKlGLI6jPZfXt2z0LlZksGZB8Zbm1wmH5A4vX19rdOm/3MtKamK1ZfKRlkR1eVvM93LMxXsTgd89QUmNxk8w11tTvtpNHsdxFW0xd44FFU/mSKYx5HwJClQCfL7s9/27dLmu8br/UZY+L1arJNEg3FsN5PPtSq5B+5pCfQue+GxnHUFlxqIRu36WtfXQXWahJu3fW6+SeJ1QlI/dKyMAfbVwAFYj1wPr1JDAVsSQwVhYi/qMiCdYkAKsVJH3HuD37ZH+XXICTtdg0MDLVP/wB9XAR2mDKsTFvu8c/afHPbPXYuU4TtdxrrphlBp+JrVdrOCs1ySFPEpXwM57/cyjt6fqQwLcmjCUNZUmvva1VKU0+P1nMlqQ4E07sAsorsPVmAKtIfQZA79BWrV5t0bFaanVFetElGHwSOhU/0pXQ/yDn08hgHOew/XpcuygLTPKp9325K4/osnkc5XBVWP0JA9O/XuLCtummjjRZvGMD3F8SrERoO/n4nHkBj/T10LlEV7Mvt+ATZx2JfBYYz9ySqAwwAwIB9cZ/YjqDwLg1OysXZFsWEgghRGrtKR9gdiSrYHbHif8PToPZa8P1CpXjlnrzWhYteUV6G3DlYT2ChcHsCBjH6/XpYu1VgPsLFzVbaLd15/cjkU1bcRB8fxy3gJMDtlCMEnv3/AEHTK5W5yvDDaK9OW1r9hK80bQxEfnUFVcoXcEyDHcE/6sY+p6GBbBs1oQxqtTuK2vSpW1qUKflI1SzyGWSSaNJXMpBLGSVssxIDEYBwBgDpYsmWYQdXkaElbvI1js03mBr04hCniWJVS0vk3798fp6dM8Yzf5L6QBngp1K6JFPsuUX7SyWGkqTMUjXJ8hKEKlfHIYhc59B1HSAn/kxTr8UkfYSNY0T2JSoQWAyTxxhMfehdj3z/ACyvfpvlQimmDdlGWtW2/EqxvPx9bNaB3eR60leK1I/iQJCSPHJz9cDpQvVsFNCBoLqbrnWttbHUuteXXbJk1ZhWxYiY2q5iSYIfBQrK2fEkA+nc9NGH1xk/MpxD2p05avC8MWvuQNLMwv05o8QmM4KeKH7SpPkST9OljXLLO0D9DquN2Kk8sApspRAka2ZIRZkWTIIYmPAH6gevbGOoLJVl0Ma7UUNgJp60d7W+zGtG2lt0sokxbyRWH3H2pD3Vlbt9elxnyf7AtoNtJ4T625TerRAMutsB4pYoE+yTMzZiWNgD9Qc/r1Aco/UDoa2vs2DLarRFyfOV5JGEchJEBlj81CLn+XYA9SWSzME20Q6u9NbsX5IKws67SymhrNpTI++ZgHYq/YMUjIBdexJ6CkzbNEYeKz15ZrVxLgspf8porPkG9pYZPbxgAYJPcgDB6Z6FljFqMAVsCR7k1qYhC39CCUJ3Eat5EDv6An06XHSCSnLMsUMnlD+Q7WaVqJsiMxnsPt9T5d/8+uTwB2x09uWjH+Cv5hecm/VsCORpmK4XyLAHs33foAP26AA9rSypt4xvNkWbYRH8VtfFJ9qJ4+f9NUwT/pDMMHOemzo91lSSCjsEq7EWRPBM2ujLK4SKGQMwUup/q5H3ov8AEDI79Jixbs66nuK8O8TZSQXxA8dWrDJCCfcl8vaCuAZI2YA+Dj7v0B66JZWrHtT8Pb3rGh2YHC9oa4fcwSf/AFUQSFzNVLnKj7vvXyyq9jkY6CsaWpAOlvrdIV0sRu17EkdTcGQmOxGuQySoMKHGOxBwex9emWVScWzWNFq2oRDVtEvi5ErjxDfehIUN5kd/E+p9O3SpcBaTLI6NKkkUR8vdOe5Hr6n0J79dDBVsQVNrIiXkM618XIZImZHi/wDcCmPUdiDnP6dQPMrwzAKfSWJa4NO0LVR3LtBOXUIclVHfK/X+XiP3PTPIM0zhIe0eCk/uSTNRnfY2nYXHjHmrDAXKiJ0AUAYHb9egrfBO1rR8o/NG+pV7VzQa/USVthqrtGXazbBEEhjskFngC5OHIAyT6A9BkfctevTlPrXV8h1aqK2l4YldmVYvy706qki+IP8A04B27egyB0dSyX9oTFyzb2Lp7IuxUK7vgRa+JEZcf/1zl/IfQ9HILxb2hBDugtZaWrWG7Vhkqwq717tuGatPYltkgmX8eXxk9soQoPl2IPb69Az1nimpHtuStJ52BupLM59qT8OXXT1xIAf6hLszL4qCD+p/w6BlVqb0Dt6IhklnHiJnQE9mLEEZ7KO3p3Ofr0sPnT2UkYSvO8ZgBqwtXIMDnyBV8eJJcjtj6/Tv1AFQEqLM99ggj8Z5YJXRfaCqUeWQKf5g9z+h7AFs9SU7LPaiLKVpp64tW/c/rgxQyPmOWdVUhXdR/FVGCFPf69BZK4yjdJvYielNFfqRrWhIlFhzJN5uHCgg/wAlx279v37dQexFdNn254Iljgkmf8Zbknk6mJMO32j6kEhfHpfoeHGOo4vKzHPFBG6RBYAYyQ/iO4HbGD+2emRb/CIY54E9z8cNHNSbw9iz5HCA9zGqesecgs2e/p26jqMrWStNbbXyVJJ7wrSWGcUK130k8YzI8OVGB9voT3GfToPcqfkj8aVUomJTIZIKlpv4ShD9rN3+zP6dNnR3ptsbukGq2deSrYPnrWd/tBrSEmFkVjjswwox9M9KldkmaII0tixGbOomqS29hrJZKtyvWDuElH3sS7faqkYf17A+nTIaM92U5nTaxbI2rEi0ajxOj1k8rckecMpxAcl/9RxkgenfoK5rOwQl6zDZoz2FvbY+wixqzR2hDCw9SSIv+qWBz5diMY6BRnOzkuvvcc9qOB8yuZVURe35rKfABgrTYzgY9SPEnoFv+UmILtdHsWoodNI6TTCaT3hiVcdiEAJ+wY+v16WLLxrAv7FdhQis2BqIpyEdxTu2I2RVc5BQIn2uMDyKnuf8emVytyWCnDlgS74UrA4rWio6dpzsDM8ALOsvnkIF8sRk4XPc/uOgXwmL/wAydxaXa1qUyUtBbo3ZJ5ZUjoyQ3Igjjs6ebqApJ/j28ejQsmVp+0ApFqVg8G+iH/3ydIKVXcJZrOXQH3WHtKnkQAxOMdhn06BVbnQjDqOJ6ffp7NPYW5qhBsPW0VqC3Es3kMt+PYL+4CDjxB/fHRoXizU0O7AMs3DNpQ28H4Oyq8lirK1ZYtkrUJig7FC33xeakjJwMY6X5Zc9T9YuPoTI+218lEMErPXf7opHJ8Y1jeEsnkzEBe/fPUE8msMNzV3tERqbkMcu5pJHsJUESMRsLf29pUYhjE47ZGAq9NbRifi46QQ046davVLMxgUkvK3kXfPkxJ9cknJ6rD6YdwOhAMlmRvEFpXTwBznyyc9wcEZ6ZE/8I6WSEvJJOwQqMhVIYg+mMj0z0sM8opYVZUkT7qxPmYoCDKvmQMnH+IPQLcksPKGUrE/tFT4tYAUxlOzEp/7seuP166OCTxURyQ0yryR+Epkk7e0jnuO4wCT9MHHXJ3xawBs0pFls36bGtZl8a01ax5GKYockShe+Tjsw7j/Dt0cjQWZwkDkIdgahtYjVhVaWxpf04LPj5z0pGX7ksIMl4mHbPp9Qc9umd4yOjL2OmK1YWTZngsUmrXKRU21UZiB8CQ0bejKQp8T/AJEZ6RPoCzME0Bz7nuvK4/p+SEw+GT4sfqcD1H6dKlyS+zWkY++7lwqMPaHf+WCcfX/Lpo8ixcEXtNVeM3YpGLssyh+wPbOf/p6gXB0CTwxPXq2pljBLRVrYE0ePUhQ/dR3+h6965V8WAG7LV2NlC1WapC7y5/HeszxSEgd2IbPcf49Mcoo2fbUExnHCbMnGF5JpbNZ9q+4uHYR1rjI+sqNXQQ+K4y5MrYdgD2PoOrI+baYOeGakaHYv7RsSqItdURlU+zEZJWkkUFwxcjEWRkYwegu1cHR3Sva0kmweatuZHnpqsd4UHZY1fKElmjXAw36k/wCfQWa1naFiS/Lr5l/GrRWacgCzUrMTROvkAo8ihGT2zkAD/j0sXauobpTLeVVnRXCtkz4GVX0A7H9ftyfp0sPheWSOOCaW1JJhcCPxz4MwIJwB27enXJ4CdHs9nJsjTqxLft2HM8NR8ivFDFkmaZlBYIAe5P17dNCwOsw29Xto0qH8re2pJEr2wR+MKzRqrP6f0oSc5KZz9MnqSkZZmmmtDPR1/wDamacFZbErCbbbZcFCPL7IoYz2WLH2gev1PfpYs1qEJDduTxsfe+8WD4yRQ+iqcj7h9Ac9s+nTIwU7j2TXciTEBiMMlpy3kQg8e4XsoXPYenXIuJdVLLtIsNiOOYZkWi5AAPhkxliSGyBnyHp10VrJdj1+zmoQNWripFaZRLFIc+ayNntkt9fXv+3QdjTq9elFYbFm0lsVpSHgpA+79+Yxk9ifEfT/AI9LFwssF9xrEmoLSr3miWP+vDJHnzjbzIRsr3BDdv8ADqOoxx9RatbHZbCGpsmr/wBamUqX0hX/AKcZJV0AGB9PIZ9cdN8cyauTm5tKULV61y1fF/W6uS4Yq39see25Sm0Hue8vaQ+PkWwS4Qtj7fTpU0h1sIdjSvKuy21ahFajeJ49fG8jiTyBUCSTxT6Z7L0yqsUbOcogq4uvksG3Y5FZtxU4fb/ttKYI04Yk+QEYyzfU/wCGB1FgW1ybsu0KF2jfmA9nT24oUdQ1a2weyfFezusjkYceoDYx27d+o6QE8bKTB2HR7qaX8qDTCRJVLyVdgY4licA5AIJx+2f2675Aytg3ha3nJbFTV7p6/H2pTa2CXyk2skMsLs3gg9r2PvDAnLZxjI/XqF/mUebVmhP/1fi0JdtqPZsmPVxyRLs9jH90aMoCnKkfeSRj7Qe/brAH6j3iSZak+xLLG9/XTMtkWcMJo4kDebhVwB9Tj6AfTqSOp7PRrW1uaaGnBfryKuxfbqFjcRxEHw/p5GfH6r9c9KHIHnhsV7UE3H9lbju2JHjuU68qz+3JCvkD7FnzILqAfUD/AAPTR4cWE9iv7r3WrQpDc2EoHt2aQeGtNO0hARhhlHYf1O/bHbHQLeL9ILx8mmNqnrd3aTWbRl9ubTXy8HkQCsbJM39J1cg/6s4Hp0sLcaaLdCu445epO+11O4g2OzuQhk12/dI1bwiJEdaaIY8VxkKwOM57Z6CyWoRQCXqdjuVoHVQUJK3I4EFnaVdupiRjKpBIySWT6ZjJ74OMdMjKzIQq3lJqa/xlq7NGWOxGr+U0YZh2LN/JGOe306nQC9P+ZPPPVkhYwxkX3T3RHHHAMgAsPuPcZAH/ABx0ocHc1yI/1JTYLwukysJWEJ8fEn7FBBwPoO/bHTZ0Q19jtNmbmweqLEO0LJLNMhX25pGw/hDkv4MniM+nfuM5PShySWqVJdm1ZK81rXpELNmk3mgU+TLGtceXj92MevYevUgVdnb2K1YzroHjWzP/AGjRcPigKRFcHyeY9wEJJbzb0x+nUano18wLa1Ov1OkSTZbiOlZp2Y9VsdvcUJGk7v4JWgiiHkscfrknIALHAIHTRkGfqzjQ0NurrtrdInWx2LFfazQQ+RMjSByw8jlh4gMO2ADkduhgawbU/dGyn/eqVmwlvYwvr9u1iaAwKWLPGv2IA3ZSYwDkdie3SpoRZk29ei9yGO5I9kyB41jiCKhGM/d3BOM4P0Pr10IF9LC23lnRfNImW3JNMQERwCShVR/rHc/TrgYClbZSxRMdfhI1j8nEJyB4N5Dy8iD6n9MY9epPcE7mrHa1NtoaccrJJBJBVl9vyRkcyOweRsAMCwU59ceg7dNnZnnB7zai/wDIptIk92HkOxglaEHIHuDxVGAJ8Fi8Awxnyy3p1Gpk/bWyavR2yWK4vSQuqzBW/HYZK98D6Ag4OD9Ceg0fGCR2GpLwSMDGC3tuPE+I8vT06WIvkA3sdGdI9mhnazI1HTVq0Tys5RDInkD5BAAP5OQo+p6NBZop67cSsKf9wiFKWwrS2KgIBp2DkNG5QFSo7gkdifT16CRW2O2/u12bXVtPKusukLa2kMiYtlELyQx4++PsoyfoPTuemSsZZozFFOQQvfq8du1Jf7HAprQ1dOxgOZEw6NID9siqR5MpH6H69HGJaZs1Rjbw49sNfpnBWCBC1G3hTFOi+iqo/i69/JR9e47dAsszWGCzaWerFYp1SPJWmqFvLxWPP2qfP/V/7SOgseQLlq+xgmkaoC+VSwsIIaEv3yCAD9px6D/Ht1ySCNnUsXXqLJAwEft+0bbB1AcePiRnyAx3wO2e+OuiOPoEa2vjg9+zPUMC0XF6pIrgoW8j/VTyA8mJP/HpYONoHYHkmriCyxT8j3I3JTCOVAYE+X792/fpknj6FC/ujDM8FKu0l2ONpJKsCeTDwX+QHfsPXP8Al0oWILk3dacQ0trINelsRXLFWeQ4MGPcJcj7sOQTjt+vfpvj6lbks5RJjZ19d60+nezaUAIl3kA86/jI5YIGPj7mCQoPrj16CuWwU8wyVjsY4LNbdXnnWUva8Io1RgZcKyLL6kduw9f06WLtXG+qVWq6qGrXaHWvNNsDmzbs4sMy+5hpEEnkOwx3PcdAzxoISY2Yat/8tIf6AC16wEWD5L3yo7gED6n165IIRsq0NuSxFTlrVrBEDTxowfK9shE+3wP/AD9sn6dSMBZm/KkzhrNMhU8JixPm3p5qww2PTB9euj30+Z8+cb2KXPnPm3jKtXX6bSLFBWdCI4JrNuMzo49T5kq0eB27AHOemDB4xr/mZjdo4LKGefdWpac00Ii01b7JGfyY+LlhnxBI+uP06VNoV6VSpLXkFkLrpgqxV55E9xJ2gT71bzI+7BHdcHuOmzsjnq17iV91e1w1FWSJteY6UjxMIY28XYtEVZR4nIJPbHShwB1j3lY2qsGya5qI5RW9zeezZhmVPFh4zDwbzby+3BP7g9+mumglopAWKl/fHxu0tXLJTRDBuUrmT3ljkDKoRD4FvtGXA9MDHfoFPB69oYOMDU8glt1KO7UeQdZtjp5I69hECHDrXsqp9xgT5N447DoFuNeui9vdZudOmugopDvePVZV/uM2lDDYRxxIX8ZoAQx7+rIex/09LF3yDs7S/sEpbOGH3ONt4WRPG5SaMhQB9qkYAIw4YBiemRjk1QrVunarcbVljGoHs+JCwJ5s33qCe3bPb1+nSpyc15pGZdjYjeFbiCGFXlBd/HHmAi9lyR/L1+np0ARXdsaSzRQmwh2yJQtCyZJ5Ui8y7iL+Ph44yMkD1+vTZ0EaVee4kMG5rfj/AIMbsZqni8jyuwBdXTxCt45BGPLH6nv0ocg+l7cVb+4/2x9hfX+pqr8kTTGIeQSKWVJDnzJORn075x0ACtrV217YzQSbKaxrdC8dnd8lMSiSORxj2azTdssH+491TPf6DqSvyTNkE8hq0oLs2r19qOCz7da5Y49GHeaOrNKCGPiAMrgOynuAQTjqyM2ytrDdiGqrQ3dKpf10oXVbiw3vU2sxKkLwSP5SDsT4+KnIUeg/bpY12OZrF1r9ypSkm2dhBapPJWt4UMF8AGU/q/kpBGB+3SvUa5epPV5FFOsfjcCQygQ2Hkj8GPfsfE9h29FHf9f06OocrUOHZqVrxSymhXkBrQkSqsyMqjDgqCO4/jn0z6dB5lyrNXmVZlkdWZvbksTkfT7A2O2R9SfTroYPlf5TsQWNjsdkyRWJX2lGtUtS+HtNVhXwyxUDzAJGPpn/AA6sldk+de8PvTa9R4RCMNN7hgXylU4dlyoQAsMDv69LH0AYfsmZvE4KsAsbAEAgZ+7/AC6UOAZa1RuM6wHwVfFmaVgQ+e/3MAMjt/w66GC+a6RtFLPMtlmxCyAEhSTgk5HcD/h2HXIv1CEk1Ba09+vfV4pH9o/kzqY/M4jGCoPgGJ7j6noATrli6bS/n1DRLRvr9fUmJr+17WA87kZAJXv65AAx3OepM7k2e0erV189PU7HT35buuLq1eS8fNJZGHi6WFIYoUPdSf45BPQdLWZh4WQ2orZjjbzgZYoK1weBSRQC4YjuMenb19RkdLGsWK01uT70KhFwUmDYZXD5Hdj/APR69Mg1+gHMgnrGa0Vx4NFAgLBgFz5HxBPbH/rnqBMHU44a8VQRS+1XRfx4I5Sy4iSQgIwJyCM9ie+OpPBVUr8mU3F/tleWURE+c8tbySVH8gyBZFIIVl9euQLVJ5lr0qs+ybcvI5avYuxp7hCgqBlcAv6jz9TjoApW9hVh9mISuk1xpPGzJG8kKsuQHJK4JGO49P8Aj10SyzBDukMIrTQRbHaX1NlY5Ip7MkkVWoreQUMgyQQCoPiSSO47dMlI1lKtugH6G8SvU9uFI7xikSGL+4yPXEkjgklCU8mC+J8vIg4IAJ79Ar4OeXdB1nz2dtxY26S2I1Nj8Sl/RjiD91wEHk5yvbJ7D656CzWwcBNEmur1o1KwRWGVibUYbx93sTguS/j/AInPSuheK/Mq7atpL41lDZSRmSwsk1OrBIBOFhZfckbxPYEnGGH3fTOOoFAnDNU2M9io12Su1aerd2SAkHwjKzxxI6kfa5ADEd/UHqT3BnLrdetqppnmj9y0WuM5KKPbU94ge5Hln0Xv+nQV2S2Jxg1e1s6ejLHeotYtNdmWYR+KeBeUePkxH8VU/wCJPb9+pPDHf9ZAeT8k2jysRTc1IyypKo9nGSQPtb+R7fy79MjAva/lG62UzbCSnIXg8qCQjycKJT4s590HJ8F74+megCymp1te0v5FNLK6+I2qMutjau4kcj2o45IfFj374BPbt0qNLLDVTh2VVK8cG4eP3lK2INqn5cLyEhj4iT7xg+h8h0vrPoWXjKwViu21sNHbgljrN5VBbo+E7CBlwPOGTBcD1OCcfTprlC2mNol6PWx8lCzDZPYv0HlmhbWygJEWHj5zQSBSWYd/u9PoeuRZazMDHe5RrMt2IXYB5Fb9BXkj8fLs0sX8l/xGcH69Ll5yTmbzsK0iSrLFKkafkV1RIwirnxDL6dj+v+J79BCpRczGPBb+PZfcIwx8cAEAfXHQdhJY2zZEhWvJOvtyBgqjsOxHh6DP6evUHqt8iOaJZlSSElcK8R9wAMirjLZXHjn6Y79Se50UmjYzN5N5LlmKqpyx8Qexz5MP0/foEeUc3Xjr12eUNF7C+2zuB5OWOSex7n9B6noI2Qc2vgt2n32yi/EeGIQwVlaVBHDjA90xEF5GP8U9Af1bpkrGdapPFPJsKNeGZXq7KgWkiWz5I9VmZgiuAf8ApuhGM5/4g9G6LrfRndRltx+EcohkicparucSq6EEL27EEd8jseq3jaGk5EMxYMzr77xL4SoGw7plXBIAA8DnOfoOujsjmn8oe0bylikbCUkE/bk+RXBx5ZP+GB17ix7BYf7YWRI5hn2plHjJKieLEksfp/w6AL0FgeZiDhZLTK8b4AVGyVHl+oye/QToYtVTYVNhvraxGSKrdvRWbBUKDI4R/FYyOxH0Pbq8U2T5Vm/+6H+sgk10aePnXkLWY2seQkwQDhs4JbOfXt1WdDbcayLV6+Iacy7ppadG0jrHbtgqYmVvscnOAFUeQUn/AC+nTJW/4QFUWRXhmWwoWOMSiyhbDRvHnzQ9m7gAgfTJ6BlQYKcxjWGdY/YM2B5yL4+X/OWAGRj1yelBgi3m+9qtHHSrnd3GIFWvAyr7aH7ZHbzAGABlvr+nfpsXY0ow1RSk3D8brST14Sbe6CvetN3mmQr5MYsH7UVcgg5Hbv3PUFZya20HIP7fDq5eU62raYXkWHZQ2HzL5x/aky5ziIZGYhgL6gdNFdyoNoaNddhnrsiRmzJHEHsPEMeYYfaV9UPf9+3Spdg2azMZ0rvWRUc+FayR5CQHBPcAZxjuSf8APqABDzT2athxVkjYyCtYrq48STlCuHGMfX9PTqQBtDUNCKrGsHjJZZZqxxKsfkASwbyUZKgeWf8ALpcjj6DPTLVpGq1kxBQDRRKPErCy/wBTsy9sEnJP69MktKlm/bgpRTWJn8BZzYSYhQfNlC4fHoSfr+nSoyqBZd/ZhaU2qbU6lUx4ntDwysi+QwrdiGI7Ek4/TqQZydEjrzaK3A8guXdjtJlH5dfXSPIkjSS+4plOAFZQAGI+0g4IHTJm9f8Ayncu0AtqrW6keG7Dfigq1Vep+LTrieNvc+yTzBzll7d19D0F2vg/VLzVtRNbns2a8twwr76tJKfbUghSxUYCggeg/wAD0sWfjICvKkBpyLDSFOzLI088cdcR+0mS2V8APtIGcYJPR+pDGp3Yu17EdJF15sz1ibEMnj7UQCDHZl+5fXsv+r/DrkgvQXzfqAVJJRZk/pe1ZV0IJ7fxHp2HfroeMG/8iL6U+N6TX1oTRsba9XpzP6tYgewjTxhxjD/YCCfoMep6gx3u/sn/1vi+q8sVPe1K9SSejRZNg00JAkjtSP5BlQElwVySv8QQT69fNj9PhJq8cNfTy/l+5SvlZdjPXViTGMyf08eme32kevr69ACqDs6slpanuRWdihrwVfANI1cuSD2AwD6eWRj6fTps6HDVTU7NmJalRtdsK8CWtkbUPtix4r+OQkncyZ7fccjHY9KnscVaNLV6kW4KkkDLZZzXeQsastiQxuquw9EJJGPUft0HfF/cl2fG6e0NuzOGntWYzXqXK3jLiJVz9ndkb6kn/LoJ4v7irf0230VWW9xm2z6yoPFeP7ktLHJJgKRB5DyikkPoykDP7dQVrSsEw12pJL9GqNpFXobCORNesL2CY4bBTzBSbI88kYBGCegrf8IU9rr5KtosoOxuRS++0Nn2/wC4w5RWcLOQqyqCBhHCsBgd+mhlbJ+qMtW1XurHblJsPd8n842VvakB7gfVQv1GO3S5blyWE+3HCJDXWM+/GIuxPiuX7uMYI7Env+nXIuef1JvbngCnyHh7aeKAkevcd8gfXroYJHRxE8MUP5GwmPnBVrL97N4/b7ZPYYwC5P079Qds/oENTJFqadeWzvq6bzZvDU2mwnSR4KiSTBfEAAt7EefJioJbuT2GOgpOV6Qrc00F+Pl+td9nr99roHta+zyHjMqW6DRu3gZ4DPGn9NwMtI6Bs57Dt0yNLak+hmi4o7ceguJBorzs2p2F2NpTUYjxaGQH+cTt4+25/h6fxx0sLMrEfIIDxersJ6vltNQ5V5aoQiSpeixIigeRKRuVPj37d1PqOgFmu0JNqzrYrlS3x968mCLMOvf+BltBclQclnTJBx+n6dcjASMcaxWlRLP932L/AJVqOqVKoGUq2UB7g/QAZHTYvyy1aqSK1cUY1se26CocETMAPJ2d2x5EjIxjGMdAzySW6KexiWotWGSWRW/KmuPiEfa2PJY2UsSMnA9Dgnt1IwJHxLaS/L8gbLK3JJt7bmsWZcBpZEjjhUsq9+/iPu/TqNTKe2tk15APHzKh682IkSBQOxOTgDuRkZ9fTpY1RM4AghMdYqzSlHYInkmftHmxxgf4d+oK9kzvfT157NuGiJEQQtBNHM0gEpByB2bL5K9h29PXpoXY+3B8UNzzQfltqZzD+TeufaR+OihF7dwHk/io/wBP8j6dBHJowBTePLrtDraGooCO3rv+8ieowEviwZvEZBJZx9vfuACf06DNrfVzVQVQrVrukg00WtVeM6KE3tdSVJRZqzyEyMkEsf3sGctIfLLAjt27dGho2PkE4ZP91Vq2pu2y1hiLfFeRqUWSdYgGQ+eMe6F+1iQCRk/r0yZJnGUZqsQT1O1kW++h38U1He1ZXVntKFjtqFzmJjkHHcZH69j0swXmNZralyzDVFuvXDz1RKRZrkjyBYE5jY/cVH079j6Z6VLvjH6edWnqRHEsJzOjqn9ZVQZLMD3yMYAHTRBalSq8M923Zlj9o/kyRze2UWNgFZcsARk9+3fPS5Ik7K1Y9gPRnk14ncezK+VdSMSKcyqwQOo9e7d8nHTAs0z6RNxjaxR76dhAaOstiWnFetIqNLN4Ar7Bf/mY/d6lhjpZoVWanrVS1Q1dGe7Lellj32zM/k1+8I5EXyUqrIigZwFw2R6jt1BeLKwbo4VU8xJFNU92PPgW9svEjZ8vNSwBwD6Adz69QQEkSsav4k0olrs3lCZVbzOe5J+vbHbPQBFbsRH36kc0SENFJShQFXTI8W+8A9jjt29euj3Op4Kliqt0weL+Cxv2yQ+cD+Jwf0z1yeBEKgDxhgySSgks+G8nA+1vX/6egD9KxrQOfBx5KxFQsU9xYx5FT64LE9z12P6HzjqIvb+b/lipbYr+Lr4Es1FCLLhZYJEVyPuQgLkYIJOOmDCYz/uZze1a1sLOiOyjOul2sSe8wdfCVIyWRVzkRuU+4L+vf16VNmV9hC7fm1kEk16KSKHWwwKVQQrlnP3DufuwT6nv+nTZ0UNdasQy1YLlaTaaGoklORIIfMZkU+YCrgSZ75HcYH69KHIdepV2+preVdo9VfsRS1VgxBNR9qTx9wgZ+7yUDxGOx/QddDAVZPZu2aNRfx7FyP8AKLMyj3ZGzF4eJ8SWXGR3yegABc4dolWq6xWK6UVnEC1/NSlhlBV/MfcCpOcBsfTrnoefF1KdJ+XaLcwV7TQ8ipNDLfs3J28LkSqAv9Rk8ROzsQFB7jHr26krGVoN0J3tdHcmvCGwYmSIS7CbWzIkvi6e7G7JJkMmezeY7j656joLatTxbQu0pE1114zHDXqbILDNsdeBXhZmIZgY3BaFyw/jkqTkZ6kslsnBMOAigf7VriCxEx9xHwQ+AR/oz3yfr2PUjx2CyyGQyh/e8Y5EYL4eSqc9m75OMZ9D9OuRc4WKb+qmA8ZIJdgFKk/8oXsDj0PXQwcTwy3rVZKdr8KmZEi2u3iHeKMLnwA+tg/UegByeoPJlmiOERrWq+y1uq5NqdXT1FVLNLV7lnR9h7s4iaKo/hIklhTl/GUr5euehUrWjFqXFxK+6h27PSnhuS7HT2qojZzK7f8AV9x8tKV/1KT44PiQQejoWfF1NGhtRcqoT0d5cShb13e/Brom8hIi+2tuB3Y+EbN38P8AR3XByOjQrGhN212GO5Do+S14zNHA6jZsnjWm9jE1Z0Kn7jICUOOwzg9+oGVmhcqTTS/m1aiR29bcYWrt2EqZ4wzlQCWxgoPpk9NEhqARyW4BA9qGjDARXnt/1YZZ1UHuy+R8f1Ax27joI5JFXs7SxVvNZCQRa5jBKPczk5x4oufQKfX0/wA+pGDC/kGShKuraGylmhY2VD2A/kx+xgQBjsFOMkfXqDFe7D6cprSRVEMKR4X8SUAd8pjuR69iP8+lTZh4+4qx+FYGI5YyqAvkfL9PXJz6HoA5YFG8XiJNg/cq+qRgdyQMnP0wOgAdYQzyxpEDEYUlkeaYr4+hAz6eh9R0AK6W4Y6viWFS286vUSlEshaZQ3jJ9ynxZ/L7A3Yeo9B00Z1rJ0Q7WirJEsF9o5Jo/K5+IPJzM6FQ8hyW/pK2SAe7Hv6YHSxeK4z1Sk9Q1LWYpGEtmOOrbEmIktfeWBKKB4sP4hh+uDkdQDSpee86WmugyTEj8cxyjwfKEL9yuc+SD7T+nr3HUma8nOpNdCVqomzqxyUHjGWMZjnyAshXsGC5AK+o6g2/StCVamtkrwsdjVSOQORPYLMVZAoWMjPceRJz44x0CYMrU54nHvD3ElzCqkeaeK4H8iMn19T0AU/y5Y7j15Y8U/AS1px4/e6t4le+fM57DHbHRoINBRNbVeaSbdxstCIH7FZcgY85PdK4ChB6ZOP179SVjOTn2ogTtdk93TxWNKytAscktaJKz+Bgik9soAf0Azg9jnPUC/F7UoFjmhjsVLlipJfSaEPHtZikqQsgLe14+P8ATGO4wO/f69NdDTKr6w7QZq3XmawLFciatiG2JUykjugPkjYGR93r6/4dLfqcsFut7cM/gIFYSK/vOpzMCihsDA7/AKYB/boDkA2G21/8Kb+zT0tRskjv0JbKe1Zj8wf6VmrL96SeXquTgdz26g9i+mroxPduwIpmuMXsWo/F8lFAYFiSVwB/Eeh+nUniv8wgkMIEruiubUaqsaKrxyISO5I7r4qe2Djv0aDSvzBfKaUP9guI6R2I60T/AIUaKB4qMeXmB+gPYjoFcnsDrp7iTV9yvj+bPPasWaEc+fddIWEZJZ+5IH8c98dz69GhWYX7KEIWaMAWPNdZBWz/AEoc+UnY4C5DFSc9vpnqRoLHU6qP8ppInmh2EP486+8APB41DRx+zjwUAZb65z3welBkBVTE9evIaleOEuskH9t+oVfBMsT6EAd8D07dNFiqsWj9isYmWVyQntzuQyqM4wR6YGelh06R8IPZKqEzKEUf1mLjBJZycjH16AIpErzGEujLajX3IZarFJlIGMh4u/bPoe2egAnrbe6kpPbn2cXnA0r155IljlkghT7pJmGOxwcYAyoz9emSpZVgrA+SrBaim2msRF9xfy0v02zG3lhvGeFsff3+77fLoK3lTw6lYu7oTKFIcNJiNCfeAUL/AEj2yAc5z3H6dLGlWozQkaMrZkkQIkoDIzhpAnfwx92CTj07+vXkXSyx0srtmzHF412myyyEA5AwOx+nbv1JJZBRfWVI61VRbsTkMPFvLxBHhnPr2A9T6dQLg+UpKyzWJBDL2aN/JCKqSEp7jHJHvkeg/wBI7AeXXrAZnJM1do9Eav8Aj+5I0dOsf+ypTk+SKoGJJiP5SMScL/oH7k9BZ8WicX5J4EtXKDK1tUNWaGQL4TxStlkdiP1AwfVT3HbPQLZNasU6xfbxVL+uh9vZ1x+L7OFjMxT+VZwPRh/pb/h2PTJkVmZ1Jw1UkNyvDagVohJlWgIHuRsh7oVJHdSCD9eo6mm5Wp2AZJZvGsY/PHiiB2mCgEj0PYZzkg9Se6pSnqwWViDxe29WQvVnCFWiIXwA8gc4Azn9Qe/brwOS3GZEsRqzkuQMOQsimQDu3i2PUdwOvfoOcox1ZZI9juxLKbAfYbBiCW+9ViiR2LKQT5O2R5dwvb0HTS3zPlnuP/sxx0ViWfSW9lAvl+Sz1UilkEjf9uoUj7j9qgjB79z0r3jcLV+ECbdRiLNmK6GN6EVTBdQGBpVOc+LA4BJx2Bz6+vTJniO1DWevHPcjW3ZrAx+5VQIikgDxAzle4xjoLfGfLUGW7TlZbEyl1TxZWjJ/lgKqqT3YknGQO3S3TUa5GoT11c6obO7fZNraMf4E5JAVZD94rpkdsZKlvrnyP06YMlk8nWtRCdqLGwiv3pYaYO+sxJokmvIZ4LOvZvdEDgAeMIY5DL92Rk9jjqS8W1owh6G/Dx+5c1tOJ5NQCbG61DFpFgikU+FqEyfcqv4t5+JIPqAO46CiyStYlVG4gaU0vv2eHbT3JKdmsBNFS9weYz4YxHj06ZFsa12pRhsPr/wkuKJJY2VGEkIBR4WYhWUAgHBPoMd8dVvQ0nG0IkKV6IevYM6IjSu91MHxb+RwwB8h6YPfHUjRcpqkwgrEywwqC08MWMZde6EEePoR+2fTqAVAN6WKOR61PM09by9+cAqpfBwmI+xYqMlV9MZJx0dQ6LibNdtH8VBHNtdj7kluCWRFmjhrkea+4sSqAoOVZfqM5Pp0yVvJnlHTc/23fW9S8+0Fui8cZh1sLQmJp3Up5faM+2SSvb9ullfmWXWCbdC9Gu9VK4r1EhhK+2tejHgf833DHf0GP/XoLDqH6XtwTGeI/jGTtNXMXh4q/kc4HbOc9+uRc6WSnr1SWKWKFJph77zoXEiuPFkK9yMg5X9+pPchqCG6Jq0g88MstIKxb7fIjH0ZRgd+oPAhWrE6SvCjMtV8xLGAI1kXP0JB7fQdAFpYIoQrp5hI1EwkjOMoq5Kqfr3Oe/f9euiyW/U+dv8AyGEx1HD53IKT72OgJ5PGQSTe2pHt5/1fecqAcgd+gwPvbsH/1/iPT7KSKLX3I9E1qzaheO3JElmm+EckqfyPs9tTnuP8uvm/TU/TPI1J3l/JhVaOqlrVoZJY0u6x29qxJGy/dH74TLAHBJAIPfv1B7BGpZqoLcm02FqlYmDRmGP2y8cRbt6eZYfaDjsOgDivttQiVKn55mu3pmbWW9vF4e2k6hHDsTkK2Bk9s5BHUjnK/YvWGij2Vc2RLJWiLR3TW/6jsPtQIGYqfu/mSMdiOoEzzSWqqUU2K+5FEqyVqkk0ah2qo/k+U7BPM9hjtjtnroYA1naWdpYsXtbA71NRIZ45NgxiAshfLyUMR5rEhyAPtyV/TpgqMkzSAiJDNZqiAvs+OVpnWarbVX/MtN9GwrACLsmCuD3Pp0E4RbuhiO5tNbXivJAbmo2jmOCiye5agHmUVcuMlFxgqc/scdLaEM4ysXESK4pvcelWeWqgNyvXAjJ8QMo4PYYDHIHcHpkrVmp4bRZ1+wjueazwiC5KRAsNpsSqAPdKoGYeWQRkj6dLGkWYrFlrhqKlavEL20uO8GrqBBHNYmH8lIB8fBV/1eijuf3k9Q2lWnqX2cWz3CXN5dgiWzDU85VgYgkVayr4le+SxJy3q3bt1BUcmtaAUevtNILF6f3d03ik9mWIMfaII9iMoFVSwxlwPXoLJVaiFNbWiZSrhLMkg87JRV8ZSf5AhyQe/bqNCVfmCbNAQ1dnJPicL5rCltsgjxLumexBZfoB9O3QeYE0m51fI44uPWQuy2EtdmjEvlWnmqKoDRujH+aqVy2Sf4tnqTPZJYXr9HX6lU1laexpN06u8Tp5NLZr+KxujeS9pIvtY/XBJ+vTJZYxmtCCp0s7aymzMfsiQ/gslUmIllQ+4/iwADKR6A/QZxkdA0WYLVx78a39hLchiR7bh0dTH4/av+rxxJ4+Q+v0PQKE9nZkVZdrNFHZhgYy1AkcjysxHiex8R3z9pHf/HoGxP8Ag2VpNNzGWSuB7+92tOxXjLeMZ97zwSABkq2CRnA7dDHzMj7Z2TfYLzVpKVtqDlvZ9hasTRiFMA+JIYeI8seOfXHShrDqXZGAwyCJZ4JnSKepIVHtgqpbJP8ALyzhcZx69Nlax8hS2cKzbSGWqyPQ2sY1+vgDp5fkeRzHIU7j9yO2BnI6BdlkF7mkNHUrU4Z2s7WaN7KzsQUltB/AuAuQsMPp3z0wUetdyYv6mr+PbqtZtTS/iKBZksAEmZ29wv5985PqF7+gHS5eLLDLMlXV15ZY4DFFYc2TJJ9uZCThmZjgDBP7n69AMrCXdXT8gKNGwWEeE0ctEBPF0ICOPHHfy9Cvb/6OgY4+gt8im5BM2np7ipNs9pWmNDjHI6hMSfjAe8ws2Y+ySq/dPIBWH1746ZKRnGUdoduP7O1bqLU5DMlPfvF4yxwZVJgz+L48gT6geQX69/TpYvFWax3cuQUlHj4llb24I0bwab7gfHuceh/y9egYKHIppNPHDNsQGsqPyJabO3sRxsfEJ5H7m8wARgeTEYAA6FvmUuSznaiKdPTzbJKsuwvtaZczWNTVcGOBC38nSLsoHlkgZH6/XoGMbjKO6M2w1KbHSNXZobUMKmYwuMe3Indcfx+p9MjGcZwOli8szACa5E96pZigmGxkqI9yrEjiJvbIDspjHh3GHAA9Rj9egW1ZhhmpDjDckMLRxWwyySK1exMSGkZmDErgH/8AF/4dcjAZlsxhJ5LbCZPuKvGAU7lfFvsIwcn7icj16nQbV+YpyNemuvE5VVIWQXQAsRJLeWXQ+XcNgKBjo6hytQ8LsntRwxKqpjxlSMZBwe2DgjI6gUJDN+O8qJJ5P9ryiUhnRX9QoI9P26k9ykfyoddIJ7hlmDvZjZCkYjSM+WSWByPoQfX0HUjelb9jD9DyOY/IXLtXblgMLGGv+ElF/wAyKOC35t5/jO0koLSAknuoIA+0Y6ZMCqz/AMnMawm0WKjJBa46ErUJMVIJJpRHKS4URpG6Fy5Der4A9AelTZnthtm1mz/2tuk8patNGXRvYAcL/U82B8grdhk4/XoAu2bWoFerVTd2xL6Q+2qvC3kxclwoAUKRk4P+PboAJVdtrNjNspdbKhSn4zbOHwCSyTygI7BQcMO3cjP3Yx1I3yf2AzWoq9dTJFafYPbi/tf46q6eBZhGrl8srsclmHoMA9QKB7YbLX6HXSQSPMsIDiOCqgdhJnzkIKElgxPcjvjqTtlkTNhO8MNibdoddXvGO/N+PIDYeaIBYYcNnwwrBGxj7mJJGOmTNZNmtNSK8Ve47Wvz4Wk5BfsRJW2VbMJqe5gLCrhX+wA+B9cgAkfXpY0qy1ikGV2r1JX1nJY4o0qkCXbJD/2pDBggOc+LHHicHxz37dBSNYyjdiOpZLulQtBG9rV2B5QSV2Le2E7HA7MQFHofp6dAYzJeqFYXr2a7tEUWKqESw1QLNk4B+4E5VmyAfToNAXIFtbm3b12utR66lQWRd/vUIC0W8QSkJl7GYqfT0X698DoPJlmiSXGhbXayrxy4YhWj9uy8al/Cu3ZjIzj7pJAPIEDP1Jx26CtVVrXQeutjX24oHjioZVZIXiII+0+WSTmRpW8f0wf26gfCtqkstNHjBgMZ80cOAYxkZXyGcAnsR0AKW9u/2Gxq5UkEFoN7bzNEJgjFPORJlU49qRO5c+mO3fo1PRr5kdqtp+Za2Dd0KxarVklqx2IJX8YZB2mjkB/gGOCQfRgGHr00ZH7OYVG2FWGSSfVW3n1snuaxtNaQiGrOx8HjLlRgq6gD6eJ/foNKU4qN+h7sVexNRmX+gs1Y+4CJEHmnifBgIwQf1xn646AKVJpY40lbbTvc2Er1mnh8o1dAcq4aTzIDkZGFx+vfoAxr5lMEEWqewgWT8+hK97WIxje4syQFGZu6oUJb0yT6duwDM+7dnQ+wUqMt61FJ5e7XCOzr3K9shmP/ADeIyfoeg16x7e3X4NM2j4zxBxCk0be43gwIMhXt/H9M9KnmCaTT3listItm3IoENenKHjKRnKFTj0b/APAegCS9fDJbWvbaAzxmQu6K0aKwVGWNxnt6sfLqehX5zJ0SHVpc2C7NalYiGWxEl61s/AJKyOJHX7cMFCgYK9/Qfr00wUuDxta7KMFivTay1pU8LJC16xGUyF7eRf1+mCvf9uljZFdUMVkKGeb2lERtWGyHjHkWK+R7ZLfXsPr1yLluWMzSragkErzE672ZhEihkjDZL4P0A8Tk9+x+nUnbONrCdbl2lPY0jr5o4ZrI8FSwXSKRifuBAHZxjBz6dMmRWZnTmpD5Xn/L8vOBHMOHSJiQqkZyuH7Eg5P+fSp9CB8tlktwpEiNfic2Yoyx9qPIwBKowfuB7DqSrZZghK1talNYmjKW7EatDSq0k8pmkX7seLnCLH/LJwM9ugzTNdyYXrNPaSTVodpaS28BMIoSRzNWUmQOCrRsGd/EnuwwG/bpkvVlqIW1O1gh3D0S01aK1IGiDkJ/3QTCEFASBL/DP0fGeliGV6xT2VCLW3/ARfha/aSNe16+ZZlkwTLHKRnuAfJceozj06jQaV+YLkkvMt21K7ssHi1KQFvNsKQQysRg9vX9OmhVb+UMa2VWpULZgUSWUFazac5eN8+YCpjuWySWI7Y6BZsJitM00kzrHHFG0claUSmR5A2ckqy9mH6d+3SwMnbPXXz+xIpHkb2UQBVeVu7NgD6no0LNX5lK5+NVs17FppUhjkWtbeNi1eu0oP8AVdR/JR6A98fp+hqDXzBvK7atq0FOSFqFmF0luRSkrE7faW80BKqB9fp+nTK5V5Jn6K0PPF4J5EsJZjBtTTzXLM8KlI38iAyJnvgA5xnv0sV2EW+ihHP8CL8lYIpfbE8bCZZM9vbC4bzUgqBn065LooWbVCJLNeK5+JPYjK0qjvHN4ogCkopAbBOM+f646AA0Zb2oEUA2ZGKFMeGEBBY4QYHf/wDB12PkkyXPNY1j95n8nKQAlY++PAhsEED16VLs/NWldvvsK0nl5xnuETCjK9/0+vQKHLKkK2Y4rBaWctEzx+MeIifFj3/jknAz/wDW6BwuWk/JlrVYv6kUUJhtSouFeIf1EjIfvj7QxJ/0jA6BDi3qhxr6LSRrZm8q35SG0lyNQHnRl8ivg/cggejYP6Y6CyoQ/wBAZWnq7VI7VBVkrEszGMSGKZ4j5M1YOVImGcNGcFfpnoMi0rRuRHjfkQQSTsrTxzg+xLY8Ub7hgLIvbwI/XHf69BZ4zJ1i1JCwkknim/GqxJ5TLOuVRsDJDEj9cY+ue3XkaTp8boHtTTWPybHj+MtJD9rssaoSfBCAMKzEnPYfb/j16qqmRzeTnmtRFrj+l/L1w2WwstXsSO+ypa6Ej24Y/LwJkx6vJjKnP2j09T1M4YxayHVoSA+94KKzBleGUFZYpOzgpkkeJHr1Bo2dfgUFZArSOsb1581sd3GU7E4PbyyfQ9Ggu0tVFi4s+htS7hS0lOTxi2derGoPiv8AGaMEkiRP/Vcj9OmTOZPGVguboW3/AHdQslG74DcT1iGjclQsdkfp5dg+P2P69QVuNa7QX9qQr7ZrM6KpsEwE+b4P09vJCgHpc1yyx6W9wtJBKGjlQxxSZJUZGQO3fxOO/wBc+vTIq0Cau3sOxLqjyUlMH3Y8CVyCe2Mtk9sf5dclYY/amSDYCSGRElL7AFZMrK7LLHgrlT5epBPr06ttGJzd7JGg6UxVtLV1yxpI1cSmWWqPFmeVy5kfPbzYdjgkdulD6DybJcnFa2IXhUpH7ePZwGB8QfIAN9Tn6enTPIKxnGgZ6kcmualr4o4HjAlaF3GXVXy2C59e2SCfTv0oMFB9fGIbPIprPhU9r3dWVJCxgnxknkBwfTsoA/f656bMnk8lNtRAOCCzbFmZmniryP8AhayMgtiPIYmZPoXx92foQM9AytjNYTQ6tOoyQWYIGlsUkKq7AkRnOQD4Ed+57en06Cy41kW9httXan/BlkjNlFEinC/kRoSVClgDjLdsH/16gFVgBLW2WnoW69WOXbcTvRyf37jsMYsWI0jzJ7lWIkf1A3fxHb1I/ToFWsZWBfENluateNtnEKnFrca2a7SSSSzVy74l8lk7ouSCUYAoT2yOmRbGsTd00aw9ZXaZLAtLYXPvyn0Udw3l+ufr0uXYPhlnt66zfJZddWLVy0RZpLTlhhAE/jkNgEHJx9B0sLs5KjCKeuksbkWIYLy6qrWDVXnryIJbEynyOSAfM4PoPtHoMkdMlGqrPNdlHnRalaEctaDFawVJ9uysjSMRkHybuW7DPc9s9LGuVowizZhqaqtutfbre1XSaK3Wk1q+TBnOJFZovuAIJOey9v37gqzQiujNq7kq+IaZ47CZXxmBAKtg+6Rj1cdx9M9h1yMjHBbPtZFlJoZHkYrXA8l8skOvmAwBPZl/bt0ABtpcKBpakIMYdVMEaAup8gXJjY9ye+Dk4Hp1J7k9CxNUQlykkjEOki+TSL4n7Q3qc9vQenUHgXHm8o/ypyF82ySMCPyf6EDt9PqM9AEcM917fvPbFessbflQgBg7r6HuCfT0+vXRZXv2ML+XN1c0q6BlsQ14IrytPNtYVsp4QzQzlFkBBidc+RYDyUADvkjpkxPu0//Q+Mdc16rqxMF9ijeqGlRsV7LK0UrMJS0SEsCVGW8j9e37dYA/UFj+gOl1tBqEFv8AuVizsIF9u3WlYxmVyfAzyfTxHYk5wf8APpUg6qU81BZjsI1lvKqlV1kMj5J7EhR9rfQk5B9egD2/Sc2Lk82hihewK8f4sjlhVb1bwDHJwRjH0zj0x0AEtasdPYw04s2vzVgRnjVpBEO6+y/mFHmCfVRn6dAAK/sbFnbT06lN5LViVKNSm0hjl9519tCyqSqxqQXYEjtkHo1PRr5lvZPFrdNRqJOGNkmrBdaORHHm39aTwYHu2GYg9sYH6dNGRW15cxaE0VRalOrG9GRfbaG/7Ksgx2LOsmAxYDuTg9+pNYNApVI4BIiswXyvQPLISOzF8RgZwM5yCfQ/p0sewCaqtCUWdff9jazKLM0U8axxyK758JI4vtI74V/Ueo650EeNWCcEi7FLtmnIse9ihUWB4xBwUkyE/iwQN6KVPf8A49BSX1Jwpqkq8d1J2l4pf39zKk1E9yau7nyEUcfl5hFJ8mz/ACPf0AHU9SyZZrFihqzXaSzJKJrAJMiIxyhcA4yfV/8Amb6+np0DKysEJW2sVlabzRweA8hW9yVsfyOM9j3A/ToBlmiA21jilq69V5GKGVbQ8ZDN5xFRgEHxK/cCSvcD065IBVqpudlWoahmKWIpo2u7Eq8sKRkHEhI7koRgdi2fU+nUnuB49DHt59jf3nI2rb3SWEgqXongjjr+2D90inIfyz4srnOMjoPHjViX+5tyfRHZae0rW6kdivSs2Jvb/wDvijezJCGwpRJO2GB7gjvgdNGb+zmEmpurNayRWqGa9sLDVDJfx5QsTiZSZCiAM6kKpAJxnPoCGk5ASirWOTbOz+RNHUBi/rRWXkheQqnmVUFFdWBCh2xg+g/XoJOdtUj1Wr1129N7lfxW/sqkSlRCysQYiucMF7Fcdu49cHqAFX4p2lqXVcx2ElZY7my5DtbSVIpGEXte57IK47A/aucd+hkzXtrZNVj5HGk+JA1W0oFHYxlDKCWPgro+ceOACP0+vSpow8wqPrSkgAZce1ZGMMc4ySDkEZ79daC7QiQwpBFY5DJdZkZLCamsOy+wW8ZHjwO5fx/wwMDJPTJm82z2gjpOLybeObabWH8KqI4pYK3mAyAN7oTxPorsQXx9ehgZxqtGGkMdhrMSRKY/+2idGliQHAiX0AOCSSSO/p0sM8kiRBCJJNhCJ1UIqfkH3Ildj2T1IyM5H6dMDJ3rq+mqULQr1BFOshyVBXwBOfHB7KmDkDv/AOvUATNLUlqW6l1Pc19tGhEQI85DnIycfaQfTHXQKtnAg1m1kp1trYghkqOZ9TPlhPF5IIW9oJ3yQMvj16go8lX0mqkc+mipVo57N82r4cvqyR7VmxKuVISMghFQHP7nuT9OpJa0nmOoo6jy1LmznFm+oEUcjsruUBK+KAgjuT931ycDA6C7xmMohGKGgiSzUQ2p2j+5FDZni8yy+PgpCP2wAM+Izj9O3S4yUrD36MCR2LA2sqSLL/XULM7uv8cqFQjCkkH6/t0AANbFZk3EN6jIIWmhltVo7DeCSAIzypGM9vP+QYf6sj9OuSGlawxaKmZUrw1roNMIt3XpJkPLWc4aMswXLRsMHt+nUjSzNkYJaq/2+WtBBKYrTLG8aYPmi5z/AIMfr/x6A3SvaoVnbMcRZUUBYv4hBnOfrnOPXPUHsQzxyRqqmMwVx4oyt4Bo/I4KAqD3z3JP06kCZ4ZFkEyqkJAAeQxhHwABntkY6WLbi6lPYR2Zo5gascoijP8ATkcpGv2nxLMh7ZPYYHTIqz+h88cXMFr5i5lYpUy7WFro96VPaAtEKSsH3sZAUCfc3ichh49skWWvHzfBrf8AMzG53pLDJqaGyllgWtLI24ip2GnSdZZCQJD37qreQUZ8T/w6g3gHu0adW9EtO5NsIJWWcW528hh2wQq+hCY+4/X06ACn4EkRkp1oYtxWkSXymgEsQrSSJ5LMpIGO4CgEevb0PTZ0CamuiZ6sJgh1TwwBjsUJYlz5EGTAb0PY49P8fQAORXRDpNhYSlIUpxCpEIkAdA6+Hn5uQ2MjIJGT6dKnsLmrMm2sRt4BalKSGSS0A80LzTAmCNRnJwULvj9APTt0yVGTZowhKaxXv8gmhaPyGsPvyVsO4mnlyGYlRglcg/4noFsar3AxRlj2diSKR5qUOF8Kbp7cnvq2fcjfPkMYwBg9hjpUuAhdpVpvCAI1eG//AEbXiFsfZGPcPkJwBkjsSO/fqRxr9AfWtSawxwVr3v6P/purASSQJ5lT4M/l/TPpjJK/ToKRnGlybXS2I9PFqbkVTUWh4Wp4/DEEYcye6jALlmx9rMWA+vp0CyzM8NoP32pyCPjeoWOpDWT8u28KE1QqYwxcFlZyfuKnJYnPp26CFVaxZFVa1dYox7ylvyY2RgWIb/mJwMn0H/DqNC5F3aVXbaVILKmvVieOdlrsTIfMlcEKcjHqw9eg8eT2gXdo7Cvds2KxMqRWCkkEfkitHHlWjHme7t6ESDA+nUkL/MB7CrvGG55HWsNrawiSOutuMiSSuy+TjykPiEQ/aPLuT9O46NRtr5lY1+P8EWptF5DJFr9s1ertq0roxlknHitiJVBKgNhXwCPEd/QHpkrWlaxQ5iNnTiE8bMK98yruquvn++Oz7ixxPkggiQjDSMD9DnHQUeDyfaA9XkF5VuV4airr66+1PIqFfJ5VYtL4r7j+JP7HLd/tBwINKT6rjdm5HqLli6iNatnXWLMbmSSlG6mQvKsQwzByPJo+4GQB1IHzZ86x3ddrtRQrxLdsXttS8HHi4QwTK3nEJDlGVsKp/wBWSvpnppUyPvbYgPsK1HJ+Nc8vyETZJ7T3rccjgKfFmDBMZwQQfE9iCB26VNvswBPVUcx+zJlkPmYfy/ARSK6hlcBBgoM5GRkdKChBoL6Qw7RrWsNdKNqOHSNaEflKjg+Zc4ABz2wPp6d+ug5NHdFx6U9WE1KE0dm5ceR4YLQCyS+TM7SnyPZVXHY98YGM9MmS+8mHrS1IVgimq2HFWwE/HmlLHsw+7y8vQlgfT6Y6WNcstShtFuxHPHPSSeeJKUUweYTKZB3XxAUD+Hf7hk5+vUHsBrx1qSkmiLDuvtVBKzFPLJDED6fvkjPQB1Wmhp+LzUJ47EUYpyeLjBiA81wncHLHGf8A7HUnazJLZ2TpXaWCsxkjCJsAjIBL7RLCRcg+MiKfUjBAwfXsAytWgKbSxwSLf12y8WsL5156cKuPEJgKE9PID0DfxPY5HQZtVnh7p21j+268Raym9vYWWE8k5VHWESHIkmZclmAz2H1/QdAr05l0rP7MduT+vLYtWz7NuyQPdKsAxkwewwDj07fToNfYhOLKpLBNFESkJZWEMeWkLoVC+bj0wR+vcHqDzPd1XllrvE7+AlVTXcJ4iPxwcqw9SGGV/cfp0AE9VZq8q0k0Ema+1MqzG1ID/R2FZcxuQ2AkbeoA7YYj06kr9GaMxEiQ33heSAxghmsa2we6yI3hJGScHJb/AI9sevXIyUrzyRSSBYmUrEsfjDH4M0ZfBADdjgn9emxdv5kWwmk08LbfLy36cbXUWyyhEiICMPuC58gPtx39R6dAq1vFSLfrZ/Es/wBpnNaT+tVtVkHsQuye54OrkEny7ZP/AB6ULIKV57Lyye4gpzV51NmFUR/yomiMrRBS3irsuDnJ6k9wdyWFa+mkahrVlrEmSxAvjkmVR4mP0CGMH7mP6/U9B45LZnpDjxlotdsNnWsWJJ6dazNXlnxI7yyBw3k4JAiVe57fr+mOjQrMJ9lCN+ydJELR2VrB3Uxkt4zzsGz7f29zkd+/bqCyESzFLstoJbOtm1ccR8cyJ4ySzFvtiOAAUQgknPXQysuNWwgSkizwTskjkrFK5Cgt2ySuMhf8eljRF+a6LEiyPG6ufBHrowdDkDLdsY8fXv0AR2Uj8FJb3YY/+5eEkIhZSST3P0xnB9egCtJUdaqxzApd2QFm7OFICwd/YqDAIaSQkEj0AyT6dBTs71KIIV43q66GFMzS2me7dCL5PJL5YdlU98A4GPQAdugs9FqJbeaCSeBVje55N5POjL4RShcNkk9j2xj1HXkMkGzqLOtgeQhhkkjF2rFEn3TO6Aylux8sDx7D9/UdegCtsLkMlW1saYe09eQU5L02IrEPtkqqTeR+5WBIUjBIPfqYPkZrJLVobRU1t11vWotrKLVShGtpaiqvhApBTxJU/c4cZJb0Hp3PTJR8l3aCn4m0qpyK7ZowNaRq0eipQtJMsMNxljeQxlR5e0GJGD+gOPXpY0uNWojPZmgpXHoOzVZoFT8QSLGsVmIM3l7JQeDtGg7ouCP368iy1ZogPV7TXz2d1MkkMNKgTNKs8iiWSaVgI3KElm8wQFyO36devHKxbJVpjtY7VT8+baxwtVtTGq9SDyaWG4sgjaSVwcBe/ioBzjv6dBaLMg63HH4NG0ZWNipf3grePkTjGc/4dz0aEM7IqPXqaC/Frp2EeksB56S2v4xkj7oZMeqNklf06ZMB7lxlG6WNfdsCVaTWWVZk/wDvdZJLpJCp8QPIEd0BAP6jB6gscZk60IwQyVFhmq2LRnmd1kmijbsPHsAcfT9ugsSpYWk0qLHCrNIshkqxuxIYeh8O3j2/iP16gXMQ3/m+0SCOT22rSbOwY1kBbxikjPjnOCyAZ7ZznHTa5iMl/wByPesuCrq4Tai8pJB7bRTD+DOB2wpHcA9LaH0NX5harcRw8gy3l4r92fIL2GFB9B1yJ6AHZ1Y7tmTXR22r1SjWdm1cd1r+fh4Ocdg+ME+uM479SV7LNGEH/iWN9s3pVYRJUptGtq6T4ROgIcR5+sYwMr6j0/XprQzOLW6TVRyr6oaPFLX5Z0YySzg+UsruS3fOAO5x/gOlS85IOgisvHACGbx8YrUNZiC8gcucL6gL6n9+mySaOLRTbetPJSiUgNFH7SFRIVJI8vHuSPUA9we/UHvyNC5+TFDbArq0bFs+cv8AJYwex8T6t+309egORoRGSlBJekVYhrtkzz7hLbfY4aP2ZGbAH9MjHmPQdAtktbJ3Hx6jB+OaezEmlSLzMMnmKkEaZHuLIT3UL6LnGe56CtWZmoFNK0TwT0ZLWePoq/jrYfCSKjYDYUBvEn7jj1P16BpbGeqEEq6WX8WF6RsxRKzfkBV9tZF+1G+0BWA9V/TpYuy1IuyWz+Wu2W5XAWClWnRRCvmnh39sZYfUsD3wP36gXEnaynYpMBA3uUgrFoWCmSuzYIZ8/wCogEeXqwA9OpGN6GlKHoYpUsLPNeSSVK9WDYTR5Mf4U4/pSp2PiYy33AHt0ELWbQ416LV5K5kDS3K4LvNCwOfE9u36knDdcjJW/BieGUzQOk88pnlL4xJnGVGP4gkY/XqT3KoglQOIKxgBb7ivi3nn/Tg918Tg9HQ9OLqSQxPJWP2xuzP5SPOgMYZRn6YOf0HQMK/qfmW2kcmFWSRiI/cwOzZOFAH1/TpcZunzx81+yI+MU5aPnci2sVjXUa49wSecapN70kjKY/s88YB+7AIAOemWVj5d74X2T//R+TG41fqaWjSfdNZRRBDBOKUZevHIpmwpYgtnyy36DrAH35X3NZIYtBtJmWNrMc6+ODcsQSxABAVQAoWBD/8A2vb69A150q222muDwW9d7Nn2/ZKs8UzSDuR4gFcH9Ae56D183ACXsT24W9rYpN5eUMSXiI53Cr9wZZfqB29Se3QW28EZJJo6M1uDaiKSZo/xDYTyAnaIQlYfPBBQej+uD+2eljzKWjpUprW92kSRnWVI30+tklMhiURkGdy4OWDkeIJJBwe/fpkzucyfwpleVrO9hr8hUvdr2Ganr9e7GNZYIW80woOS0jEsSTlQo+uegs8YtRgO9dZmr0JtKfbhsXJpUFq0rSutcN7kkrgD+RI8URvXuelR8h1tfY0KmzSztIkrTxj+tWBMokSPIx7hdVIDdx6H06AKezpybCeXZ/lFY6UNczVj4pIvjEUZn8R/HP3LjPQBLqEmeIWtdaWK3RkWOG1YPufkRzL/AAOACykDDBu+e4+nUHgaHQo6vk1d7bhtbyCoypZ8/HyibxwHQepDnsrN6jI66F1lqM5xX2BgLUrhNW1AfGSqnkbDeXZSnkB7nl/ox3z+/TIN/M7iipRSSpcjlr3okZonmZmxhvvLquQpycnP69ArrkqxYkRDA8sUkiyRoLCWKTFQxPYuSPqCB/w6VGVRVmpQ7WWytotr0gIKyTzAF5HxiT7SvZGx2Bxn19ep0GWPmUaWg18tPbwUjFsItnG8DLZOZASpZmDL6B2y3fJz+3Ui4G4zRq6lIKk+qsRybl/x92kv9Z5igKRTRr/HEQ+igdiT3x0wLZJYA8m4fZu7h71q82pfbOtiMoY/xL71o1RpF90NH7rhV81HYkdhnv0yZpbJzw2ogRT00Xuy7GTmFiba7CQzReHk4jdmKZ/qJhlXAAUeg6WGvJzjNsqnHpYdfHd2zWZm87KiTx8EnCkDCpkeRb08j/l1K4qzlJqJj3wlXoz8SuyX709eRdreiozVrKRmYRyjzlf3SMP5E+Xbv/l1BSYzNzQ7RuFLXcZebZ52zl1LRuLN9RGy5HgR45GMep6guvJTBFaOhFQ1623sbATIrCtTkNhgS2QW8CAsYwQTn06kaVZmKa1Wu7D+3wy+FbVmKSaQQ/0mmUeUcagf6UwD2wM9A1jMZ0uDXQS+DP5ze8JCEihiHtIrMMsPHBPf/E5P6dclkQSiRGjLQSAf1I4/uIAUHtnyOQCe36/p0ACTJH7ViCPykHZJ18mdS3bv5MCBgdu3f9egCyIEtVZBNP4RxOYZI1x5SD2+zFR6r279dEar6FSYQJSgKsS8jxVVhBJdy32qoU+hyPoM9R0GuIGpCvH/AGpJc2dvMFkurB2kX6JXiOOy/vnJOT6dSUjLNaalEULMomnNy5MDPMgXMfZY1A8lCd/LAx6/X69BZLK0ClC0Z+9WVmjbBknJAJYgnCjHpn0+p+vQe4c8B50vIixXjb3YZEb74WBIwT6nH06g8CeeeTzE6f8AdALLLIjR/fjtjzAwQGAyCM/v1IwBZtVUsPr7Xi8LQSLJVixhElCt4sfUhRk5A7EdAFqvK8NBXCu+wR2GriEqyTeaJ/UhAdcYcH7TnHoT6HoKbpw5hiobNLNSqACGtR+55l/ExgEEHt3z9GGPXPSpqiWfawTvaWNjLlQi0dfGWdyf9RA/0/vnqTvpRKT3PenZvxkpJD4+5+SWkLMftGUiAJBA/XH69Aq1nICWc+17zSbGRI/FftSKOOMebYw3ZiR37f5dGoMZsQdnuaMlW7VrsbNlGeKGltLUsVaX6qWlVcKB2Ic4ye3QVrOSn7RkPxSku/8AlvltT/cDwbrXQtu7MwgLRRyeaYEa/U+0is5IH079j0zx9ax8/wAa1Mm5VlPpO/otj+c7pfaGVEjjSNKKD3Q65d/6bfy75I9eg2/mzleP7iFI7UFdLrVT4vVgJrOYQP5D3hIB5juRnt/j0Fn5KEBWb08Kxxv/ANkUDYljQSKPLDeEhBb7T3GcYz9OghXIwzd88/qGUO+whatKJKjTVW83glaMFgETvkjHYgDBz1JYnW5nSsZ/yrgvmKD8pKKjwm/NbxgiSUr4+46gkKPoO56g6Z+ZOXPFNNoYawUbe2TSrMM+U9ywwZnVcgLEMdj/AO3x+vRoZH7x0X9jqbNH3akIfYmpKqx2nlYnyRwyxysCADIzebD/AE9u/fqTWBbcS2N6ENK1BTWiDEkjRuhkIQvM5YFSqAkBMZz69KHJY96zQWhDet+dqGvPTkioBCPARDDkOCWwTksv06AE+SgNYlR3tmb8mP8AJgeCTxjk8VAYKMY8e+fuHc/TqDwHPW2ZtNJ7kUX5Ogsxie9r4gHkhWVcsyK2AM4Hmnp2JH7ySytWG25pKWuiXbaOR7FOTxszQV3LiZGTPuErny8cfTHbqRZX0yE3Yr8RaPNuL7bsv4DL7Kxk+I9wthkHl/H9W9OmRbRilrdOq8esVIo6rvAZlaKaGdmYsVJJQsSS2D6kHHUEcmsV9i/twuYorFiG0v8AWpqwVXK/xIXsQQfQ+v6dLlmv8xV2Oh1diuk93YNFNZAllrealh5sXjUhiR/TcZHb16An+ZS5JxuO3Q0XjrxtKtNvwLJ1kjQvJXmUGQFj3ww9SMZ+nbrkgtxVhs9ZsdPX1pn9iNtPDTu59uejLEYvxWYHzEkWAUIJLYH79Nmcya1G6ZTJxOaoLcE3K56jT+GhvG3IiW0JI8kIRDIpYr3xgHvn9emBVbOTh/S6ejWtxVY+WSigAovvMI8F8jBBkUBQpGMH/HpcnybH9TFvnPW6yHW0b+vsy76wm2r1469yVS0vlH/T+gVo2cADxHc/4dBSe5MlNMfU2mXYzUdde2HILNXYMqRXuPXjXaavYVVEgkljBU+LAgePYqB0Fit7mdmBllfyrX5Vaw7xwTtLHVVllhHf7yT4knI7tg4Hp0cca/J5ynfa9ZW3Ym2f551cRQvGirCj2ZMiRBGMFwg7jPr6YPUrFbnMnPNDdPYCK+mZnRbG8vGO0bBZ5mi9px5q7+IwqhQwOcMfXqDW4NbhpXRq1N7ZXEhtzzNbr1mf3r92Fa/vPH4tlIwMePc4Pqfr0dBnRmfdC8T/AJM8wNjsqshhKofKZ2ypZ8fQdh9P16V6lny9Stcq+26SXAsakKDFIWKgIocrhfXJOM9B5lJeNVa++n5BrKyxbG5Ur60yXnaUyQ12aX2grnxRVZyR9f06ALKwzXrUtWL/ALK6/jJs7qr4+xCv2hyATnyz9qkd+306k7ZZJrJo6+rRowhEuRoY6slpEKokrfdPKVOSWx2XPc/sOgzay3Muylca9J2prWeVZkkYq1b7HlcE+RcHB8SPr6dBo/pyNVrO9ixbgFd0f28qSx8YySrALnxfy9T1Bzqd3q9XY66WKvY/Emnb8iGzDge0zdgoH+rPoAwOOpPHRWtCCZYNi2utVdtdWczRl0sABZJCi4dcxD1AGQfEHHbHUdA4zBR0hXVzQ2q3iK+yj9q/Xmk/+phhh8H6qe5x/pz0A0qN20H4lh9lWP5Niz/RsR2XEccs5AEfkSD4+S9gT6nH1PUlat6Zm+1sbnZTa/Yi9LpdfcsLWguTeMTVpfcIcLG3kF8kGFf657jpkYJkimt3K6RU7HII4o1rNc9x17IzEEe8AjYJ7nHfuc9BPJgh3QrS4psBV/GveENOV5LV+K7JLKY3fA8Y3dlVR4kdskDoK1rJhuPUtrSkV7aFBF5SSVvNAqxhvHxOPRiAB6/8egU85L+4sciv8cMdyGxdnj1yL7Bue9MrykydkUP2OO3fHr0LC+Syc9El49tqWxazBs+VQ6evcktXq2mspV/Ijb3GBhs+62PJPEH7T6ED9uhgPaObrQjZHJtISzVt1HcRA8X40kEDyxKmGZmZipAyMqPovbpYvGckEDyW/sYLEV25SVY2SPxKzw4EjnsvkH79sls4GegZWzkB7Lu4ZVrQ3pVeGocJbYDBQHPizIW9PUE98dBZLZKCYaS5hqwtA8ezWaMTyWIcAY9MHHr2x0saEHta+6drISSpVT8+7AFI8nVcpB/ixALYP8f8egQyTVEJ0XuWKkc80kULU/KxdZGZgZpQWZAT2xGmAcZAOQOgXwexUKdqbW3kht7aatZ0FWZquh3+nuNXnqvNCPNWYEEFyAmBnsQT26gsWfkBuPR8lr3YYbutbW8eMcltJlhhKvMVEnlKFcspCLjz/iW9cg9TP8hZZkY45xJtpakcZsmOEbSe/I0ftNHLL/Swx9PL1GBggdA+QVrT3kvRHXprNnNcEk1bYxTYnii7rIW8e+QuVI9O2fXoATeV62tUsR2prklXVwS1KQvvIpQu2ViWVFVT2b/lBDZ7nt1K5ns2sfuKb3YHax6C1cjn29djLS2DyhHnrqxbxdZsgmIA+WO7fpnqGVSsxmcDe3gR1r097LBA9yKaXSwyyFoKF5pHl/oOMHBU5YNk+mP06CzZZK+pn176uk40otUaNYa/ZRgkNcXyAaQvIPccsW8sE4Hp0yCy1EbKUNeLW2+P1L4/7ib36LbGnHGJ2jX25kCK/wBxjVfukBAOcfQ9Kl3xtAZPSijtBRMyrEyq8ciDwbxHcj6BR9QOgaBO60CbSpYqzSl/e8noT1iGEXgc4b9Vz+v16krGbpmAieOtBAIS5oTzHYwMXeRGChcgIVdlUfcAv7ZB6Z0PmzGsyk1ondNYFWbUbGHYiVBM0sL2Pax/yquQck5zn69vXqBnk5QOJfStWjrUq6RXVxZfZVJWMpjVstHIA7gDHcHxz11YGNNHvQMa97Sb/wCRq9GC3PUU07V82q590PZsTKixEyqn0V2z4+n+HViYplifydWU0OxpUpWYaWx3NiBmBsRGIxeB8grjKrghSPQnsOli71zc4UEWlVyZN8IHjwyoJlOTnGSIxknPYfr0DPk55ipbjhpqq65Z5ZdjL+PUS7ERM5YZ9yTyOQqjJGfpjA79BPGnmDGupWqEdWrWth4VJleWKH2pW828nyT5DJbJPbP6dBd6rUQtdSTxZ5IXaN43d2jY+JA/ivkSMHse/wCvbrkATPKFnR3V45GCpD4uS48V8iSqfUDt+n69AHlIB5pAGSH8pixZ8ADCn7icZHb9OgDyCrXSxLEZWZ3CszTeQZm8P1HY+v09B10M8U71tOKzVG0tkz6+q+aleUFVtTqfHyJwR4IRlQOzEd+w6BbKNUSW3s5NjT/HklAoQHvJIq+U7Kex8WwPbU+g/wBR7n6dBWL4zug2Q13sp/VIEoJ9vOPb8hljk/Ttnx/4dBdl+B5TA4ieMPGvsiIH7HUNgdjjJ/foAuL/AE6MccZEfgj+3WcAoXb/AEgnsCT3UdAFeWBNg89eSN6syqo99Ux5dvLuDkZHp+n6dBBW1letSkqVURjVjg9tYLD+EckKhi0TdiuRknB7YOPUdQU2SV7sQX1GzMMluNg5qwIpoTy+H9eBj/TYFcEhcFWJx3AJ9ely7xrNaEPzbaKKNITLHAZJfeeWbDeOfop9QT6DA9eoHwZPsA0jCKi7CdwY7OxzB3YBASCCcev06k9GclBCd+2ZIFAumJ43EZNSD7vIHvlp85bHYZHp0Cuucs2he2W31dGxGtjYWSlgMplilKkfX7gi9jgHuASfToFvJ/sfNPy3sT+Roo57iauhfv8AsatNZI87zz2gkLPP5YaMNH5GSMnsB+/RxqxgPcms8090/9L4Z0WthrxTz2N3cghh9tVuR2pGdmdfFFELtkhiCDjuB18/P0z4yD0ApDa3NUPJU5DajswFfYifFhBHj3JGT3lGApPiI+/6g/XqRfxkJZW/zNI50uw09hYmPtW4bdd4J/aCidZlk7opJGF7A9QVjPtnrtENLacdAXX7Kymn/JV44F2iBoiQ+A0E58lznuSCPr36krfBzw7RzyPiVqOstShuLEiYSw1JlSfyRX8pXhfOfMRtkKWYAdvXoLLzk0NqUt7eaCarHxTj9dbNjYpFG1KYskUdKthclkBy33BSBjAz69AtjFa09Ur15XiS7HrXk/tscps0rNSPwk9v18/tVyGBUjxIySc+h6UNGR/21F/ItyWHM4jMdGqyCSeeVgUwVRie2cYJx+46noN8XUjp6nbQxCvYKUoqBjtHWzKjzTN5ggp4d/FmH8s59R0HmeXLRlu3CtX8WzdESzUimcx+JjLICMqPIZJz2HoM9AF+rFBprGtgklVoQhaxBG4McgP2xmNjgoVY9zj6ddDBZjgfW24NjRkaRqrvj3FbFirgvJXkHYktgeBz2PcfoYPFlYLbSwmyq6/f6lhY22slM9aHYLgdvuevMAMq6A5XH8XAI7dBk2de0LUe6S9La2ql1jvKq06yN5ukffKn/wB7Nktn1PTAystRClbcWKlVZLMLf23zjgAhVogSoIwfAEYOPp3z1OhZKFnYWaNrE1qpHXqhg6q33GRfUoRgY9Mn9cdx0oMAZdnG+wicXFoorI1edWRkPie0ZyAT2Byfp3A66Bg8gFyO1eH5L7GK6jFIdg6h4sMQQsi+PkuTnuMgdBPI1Fmzudbs4NroNkPdr6+MatgIkLwSKnkrrGcgtH5AqfXppYyWbszVDPcVoPKNa6LsdafyLhr+RxOMMpHfJHcsv0GckYPUGlWZrQjBdq15IY7CaiOLYPGb1wtGsciJKwIkRQPHOFJJ9Tn9O/QLM6/Tmd/BsdOLgEmyugN+Zs7dpi8X3DykLIXB8h9xJx0Ga9tL2TfqWv09eGxLMirFrC1yZvAANG6+4gU4wV/+v0qbZf5l2rLJr6uz200Co96RECpGFYxSBfCIqoABYkDA/fpozeTanmnpFnVUzRrCCZvzZ4z+Ra+0+bs7lsgKT2+mD+3QaUYlKozye77SKPZKnAPuH7sKT+oPp0CYKMLTiRCvkj5EjF/LHicg/wDrjrk8AVfopHIVgDJG3i3mxBVmRRjuP9Rznv2/XroYOIw0VSxK8AYxI0ck6SKgXDFvuBOACMnPp0AG6FCklP8A3XsEVpa8RXSxzssYig8R5zkt/rkOO+CQMYHfpUrcmz6QKr09reks7TbKIr9wsa2uhfySpAq4Cf1AD5sBl39e+PTpklVaiDttWmLV5QgUxkBpEfxOMAAMSPp+nUllyyVK1dpAV8pZ0IEcD/YFTuCW9PQHIPQK8jQs1lhQn3ZSZa0jRxLn1ZY8eR/UEHGOuST8NgQJvzAn2h5BJIpVg5OSAU+4nHfHp9OuhlZk4TYFpoVWXuGeB5YwD9/Yr69wegaOILEv97p+3We9JbxFOKsfvPXPiVFgBDhexKn6/t0FYyr6oe2Oi1cD7LZWtr+Nr5Hjsw1ywiqt6Rv3OGd2f7ggIGASB0qK+To2wEteRGuvpawp1pEZ32cpkhLu+DlYx3Zcemex/TpoWVwU826WaXHlW+l2zctbLZzrmOdpzWgdcY/6a+gx/pP+Pr0sXiuCghCyVqxmjKQ+OJPvUnLShcqyM7+Rx39R3x0F3xju/ToNr9jSkiRo5YpHmgX+kxRFLqhdRjAI+v079LDTPzPlfg+ukl5l8kOI5NektjXfgvWkkifvUkZolkLBiGzliSQT936dWR82xmsM2Tmqm/xw/h1q61N1cjvzKs/4S3HlCr4FkdZVJIZ8YII7Z6DW+MgLD3eVrE8en3M2zjC+7NDdrRkEL90obA8gFJ7n/VjI6BZnBwHV27shIp2dKvdoVmSCtf1CmGVwWDj+lKctgu3jhjnBPp0FKz7Z9IIUE45yl/Zq7ZX2NBmLxVmFW8I1fsXR18iV/X7hjsOg5+uTBdTTmryIbDa35dlXWF4qdqxEqFbSko5m8P8AUIzhPEAZPp0Es52tCVb8ke+a1sUgV9ZrYjo9DcmGJZbSsCVZHwoUlSAc5AA/foLLGq0YagSsfmXUiErTQxSRoohhXxRvEdi6vgDBbxByck+h6ULEHWdDMEp19dHJt7KBr+xSBFEcbL2ABLBTgjsPrj9upPcIRJfr157Nr2tvJtITXMVMefsp9wBEiFQWyc5+gGB0AUKcQ25pxwlGp1Qsld5f6Zyi4ZRIFCs+QR6D9egArVkp3as9KSY/lQzF6E5OZPBftVJPAkMcg/d2/T69dHuEdRdOilmqzSPBrrjpNFIwPjQnYBpssewhmYjC4+0/oCR1AjklSDZW24/b2aVIo21fKHVEMv2NVuKCBkehjI+9V+j5I7dMmT43LtA5dgIIa0EYe1JVyQ9gLIoJUqW74Pk2fUDPXJdjBHvPCSWpfpmxdKKje6SEGVyPtI/Ttn9fTrw/UslwRYtUYZpiojjv2EPhE5JMR9XwQPuY+uMdz1B7FSCZbFKxWh28tOaT2ozVqOnnCwb7WAIOQc/cp9B27dNHjyStZ2NjV6iHZWvFzpPKeS3GqszeI8SfbyRn1zj0+nSwt1rWxK5HLrdvW1+2dAtuGOQ7CcocyU8B8mUHy8o2wyj9Cf0x1YmawbNGekAqCQTzJFFrBNS3CkTVhGrosMLB1IRvIYQZKjt4/Xt0ua8yj5ar0fxNFW1VKKlDY2dZadjXwh/d8rDO6ygkEOqgDIJU9u31IZH3frWhPrmvq9XRqQGlAhkWKFfcjjBz4xh/R84BBK4J7D9+leht1l4ISvs9NBPT16Vq0VWGxPKkrxhTCREFeVSqYdVww9QM/Q9SVmcaowlPkOx1NbWjj1YpVjJaWH3PtysYAiQmPOPKR+2Dn1/TpkyOMWrTVZSyIp4dZ7C2ZWxCKVmFvIFXjwJY8fyCfsxOfXoLxlkq6yxbLmC+Avl/VrxxOxbwYeQZvLspGCBj1H79Axyaw9V2hjlDwqsLBRInl64bHYk+p9Cc9LfqWa4Ks2Ky7LyksPaM2VMWPcRcjsxzny/Yf59QexbW1BTjlrwKL6QLHGZqsmcyN5AZbPfOBnHcDPS45ozRhJWgbSVrFuwosklT7ECys9uaRcMzFfVEGDj/AEqP36ZMlfbnBFypXllWqKkZvzSR3LNuRCQzeHl3BBUopwQPoQB1HUu6GpHakkhuO1WZ3skLDNZl+9m9tQWYgA/bggDH16k9i9LXlykkin8iVHhl/IKguF+7wI7Ht/p/fqAIKsF5oJ1sa86qzJEyqzMJE+4eAKEdiQAM/oepAinVqn23ZQbMvt/mW5goyFBH7EHOO/XJ4CuuzoQV57EzrZDGR3jYLII4SSrEgeuO3+Z6n4k8jUOaG/BuNdNR/Hazr7KmhLO6skcySJ9vhjuSo9CPRgCOpKPJWZiKlx7iPEtMRyLaSbGep7jSz7Sdj7ymT+SooYM4B+gLZGemSu1Zmm2gXY+Q1WpN/YKnt3PJVrWdlFIqPk4GVBHnkAYJYfp2zjoLLTGTzboDs7He3neGxekMAY/k6ek/jCWGOy+DD6g9snB9e3QWS2MghOKdd7oq09eoYzyM0c/gsb/0CXCSSS5wMnPcevr6joGtn+xP/bhc1G8heZ0NKSva2Vfx9sySoSYgpdeyY7EHvk5PbHQLMfZTDDxvXaf8NkSnXmoNbs/jPHXj8B4z4C4sL5DxII757/Xv0MlX7c+zD50lDYWrQWosEjx+2+wiDJIxKHH2xsoOe3boLNQv66s+vjnetccTwqVsG0wlWYYClQvqCQB9f8elmy8WWo3S3+dfqtn8CvOzlHnm1wVZZMgkfZJkMwz656W44qzpOTWrsTyyWaEZrvUiNidiAk80iN94kgIAGPXyA/bPQLaszw7pBJuoItX/AHFZJzskte3bWGF/bSZ+3uShQyqighssfQY+vQLcmtMHdffr1aC1/wAtQysa9La/ZHE8s7H2xhmP8Mguzevr0Gl5Iv8A92ddP7a8fjlsahX2+315gWeuLv8A9TtOjBSskjgEg+gIAXuD00IjRtbN3W3dTs5HkBquYdjUmMa/kmeDEalGyz+D9icdh26g9OLpDdA1ltbFxqeg9ltnX06pfm1sP9N0inkYxQSFD4snkSME4xj0x0sOFyee1Xi/vW+ilFuKWWOlUoSZg9iXEcMZ798YP3uf5H69ug41ql1kjnprJbiWud2WhrUvB3DyqvmqskgAJVVPrgHGR9OvIZ7NQyPl2iNS68v9zm/FqXKq0duazedSzYRWDGYEN7IGGLP9uew756eVMTm8ZRuxDNV1lLeVpxttuu7sahEacRszoXgkEv5VfsHwSMjIIJABwOgZsuB6klizToSbXVHXXJlk/DlmQJKY5SVjWeAEASFTlfoDjPfpY0i2taELrVqWR4AgCZWa00JbsqoAGCvjx8iMMB2znHr0D5wslb3IX8CTEMwJJ9rfaPIrg+oGfX6jryPQpQSVoQ01cAyGY+MyEMQfRk7fT6EevXqeYt72hJV20fIKFoJLad4bUAH2qXUBPubv/wC1s57dMqmV93YOtCANKkH5jwWHDWI3aWmYnZUjlT7yUK9/vUk4OcjP+PTLJW4NmtANVN54835oI69mF/yIWjVcoc+CklD9eltSyX1+J8wcn19P/wCZXrtcWbbatrVmt7jGM+1PX88kKAGy5CZwcZxnPTS20fNs7/3Rqms19GUwmZI0mfNVoUDSBW8SMeY7kZ7g+g+vUH0FdbuBuCnTt7GpWqVkmg1UnnffxA87DR+agFR9xX9PTv0roK5JqjCXIvcv7OTZWLHmIi2sjV1wrSq39RwVP3engP2HTQY3TWjVlGSDLKqqvsOGK+TKcSeJ9w/ocePQMEV2QGbMWHIX+ll+2R3wAOwBHbv1yLg2ajCK8kvtt+R5eYCFWI7EEeo66GeKCIK8qSyRHxniIB9tSAxYMD9rH/1z+nQQF6tBOQ3LGosn2qAJk28gYGRK5XyEYKkeDOPX6hcnpXQllmiSbOOfYXYdTUhiocc1OHttTl++V0TC1+2VQKDlsdyMD9emikVvXZSrZqSxw2FMXkxX+iknimAFwp8VyBgHoLHkaASjAjxLHaleJA/3lsMxKjAUMRgEd/ToGS+sKxvVif8A7eAoyZVsugVSB279yPXPQLcgtPZaEReygkjK+CRsAwkUjByW7ZAHr0ErNdCGe+p91IWXx8Xijhh8iQQAxA8+5wPQf/W6CzIr9z3KCzhwuPGxXZwMhh3x4r3bJyCMHoI4wdg1MG61unnsLPpbMBE1mskIWxFVce2Y188qASFKt3xjI9Olik5OsOtoC26Wq/IEOuSPb7Kq71UtQyNJFG2cMXnPYkY7fX9MdMizK0zhzc01namQbTYTCnE4sCjRdgUAHqZnH3Hv9fQ9HJLLX2zB3Q8KNOskUX47SRxp5xtanknPiPrlmPf9z0sXXGghLMFatDFWbA80BU2ZkVmkcZIfxjA8fH9vT16WLPVU+afmDWr/AL14KKVH3hLuqlnYFWMgb3Imdwc4VQSM5OCfUnqyWMB7v7J//9P4ThvwT0Wl/t0dbZSRRwsDGyxTRSYGY++I2UDu3pkkfp1gT9QliGvNAn/eVHjqSqkl12DF4hHMCpjV2UBoRnJz6HOD0ocjVW0lW1WobOzYN9ELXjPasSu/uQebrhR4r4jJJD5Pf/LoADV6Fa1rJ/7jrc1txZklVIyv/bxy4ZWRvqAB/AeoPQARj19/T1Kw0dn+0TEiY00gdqViDJZPOJThM4x5KQR69NHkyrDMTzbzSbexLpdpGOPbuwEENB5FWKT3B5K9SdMZZR2KnD98Ho6FGzjJ4bsQJrQ7jjlIVMOus8yZNtCpeepljCWsx5IdAMD3MeQ9GH16CyxuTrboc1M7pF+LIU91swyvVckBUJaInx7qZB3B9OldCzV+Zxs4pfyY2j1nlOYj+FeeXKmwD9qsjEeQCjv9fXHXR6FR5Irl5xCI22HstXNaV5PZBx2JKfei9j3OR6dci52K1KO9STZ0bd+6seXtxKhSuoTwCFQQGVM5Rl/z79ABDW2fyJZDKpqSBBKImfKMUPir+R7fcMZUd89SOcr9gRaj/wBuSPNGXlg3B87ySOo8ZPSNwX7AN/B8+gwT0Fbk8ZWOtzpIaQqXZ1Gs1114Vt1kIIiseGPMHsVRyPFmIwG7+h6BbGbNIkJ8tbG8gNaCU+9MY399YQcjv4Egn656joWfE1B0ZvQQw2qleCRJAYayzuEKqWxkA/8ANjIycj/PqBQqCzUl96RZIZLUwem1GyAZI3B8cqWXByM+RHof16ABVfYSat4kM8H4svm07SeZeQp5N5JnsDjClR69dddSePqAttuNTpr8W4l1/gtmWChuLDDxBSYAxs0jdgqMVB7ZHcdMlJk71saZtFW1O4/LlevJqeSQyrIGDv42IYPKOKP2+494ZHr2YDpgzeNZBMEnHD5mjbsWhLjXvMqhpBIrKng7Ad3K9v0Iyegu2WRI+Coq9Hi23pSjwh1mx2IZJUSSNPavMB/PsPt7Y749Olit9tbBqEFyfe3BqpIP6dPFuSvKCD7AOAMLhSzkgAfp0ua3XpFCEr88dvePrzbWJ6MX58iFXSH8iT7VZfQN4L9B6HBPTOpW4xbrdGCoI2L23rFinikJLEOzejMcfue3QWPUl8x/U80Hk5NaAN3BKDzDkHABOPU/ToJaAzSzMZooQqu5FhWRW8WwfIhQf8ew6Dk6k9xQ0rFYvfDrDErE9gQwBB9GA/y6AI6etfYXEoAA1oE9+8p7lgzeUaEejeXqwP0GOljtlmjCGNtIdnepU5YUXVcYkW1LLgsxtnAChT2ZUGPLH+rA9AemSiWV7oQeWQuTJGTH4EyKGw4JPbyMg+mPRf165LMU9mPzbWtYXZKqUbTXJIKTKsdlCjL4TDBJj75wMHI9euhgjWdpDLP7hUsCio+cGNQM98E5HqM9B4dgrW7c1kL7KvGijxRVBVg+MKST2JPfGPr1BB7EkJkkaeV5ZIm9qNpMKwwPInL9gcfy/UdSe4FghkuXIoqUho6i0JJId3SGGkEJ+8w+4uABk5kPZvp+vQdss0QzV2bUoLNXj9QWEYmUzSgxp7rNh/dwQzylc4Ud/qcdBRq1ptQhGHuOJ71w2r0Pk8ViQxCRRjAEcIHiuAMFu5J756WNItrDCM1cCaARt98IVJniH3SNhvuLZ7YA/T69QexxalriNrFhnkaMh6xc9uw7HKn/AOnt0AV45ZgsdaGESyr42oizt7YVjhz4IMhgPTv69SOKfqFrNeqtHYySv7EIgsPPC/2uPJSmfFv/AE/4dLfqNM/M+N+KbBYfl7mqVqn5+qatFXrxSl3RWVEjyEJz5gBlV8ADHoc9WR81wX/ZzG8SsLUlRNbTEdcobAKo/uwNM+XWXBy6gYHn9M9SbYv1K6y26sdxpdW+YqcLxSe25hErHwkmfyYtH2AyuACPXPShyX9tpYNfUtQwVElv7aSGip92SR09lQwKmY9iAe4H69AHdrQ0tjsIw2sR9hXKe0Z41ZZVP3MxVSvtuuCAx/x6kkvxbDcaudwBJvdJ7bmtrrX3WayBfcYwTTYVsAYCyev0OejUr2cZACLqabldSrsdBsS703jeSAkiSEuxXxs13K91H29z3+jdMlJfTPbNzamRUvRLTs1SkgoyhjUtxr9kkteZz5ARqD5ITkHP7HpY0i7FYbKkiWII/bUskWIYAGIV4yvkGBHqHVu2f8+pHhdhdqYsP/bBroWLrsYJJC588/0jGwOVPic4Ixj06APNbE0yVZdbOY6qNL7t5GL2UjZcjwU/ZIAD4sw7j6DrkXP0Jo1Krya3QWIfdmau0Fvx8ZIgoRvGQNkeOPIA98n9euhgLGnX3GuWrI7WEn/pSuzYJWMENlT94yP1+np36g9N4G61F2NocduUv7okCGISO4DtAiFYpCMZMmSFJxgEAn1PUGaymMozVYgYaI12xm19m0tjYxNFXLySKgMDDyEwz2cgjDY9G7Ht0FnrdLWwRRahB8hsHKCCGYHL9seXlkgYOPr1PUjjlGzat1kkjuxwx0Gb/ubUbhipcgZKAeWO5wP165AHXfB4a8UM0MhruEklgwrS5bsrsuCHKAf59dfqE5BHuBNWtUdnJFbUh0MNFWDFI4vNgwb/AFN/Efr6dMioK0TabZ3Ntw16a01SutrXRSuI8VZlK+MasSchzgfp9OmTKZzXuktmLT6nUtT5LfiqTcetvrZ7NNWGYzEntST57eE6P2AGQyk59OgscbkjHvlVNPLU4QlKGaZtdu6TNNYxBHIjTnDPnsMoP6QHdgO/c9LGb9yZKsfVWv3MMr3KUNM7V4j7sNmvEscAjkdocMxY+bKB9+O2CMdLNfM+gYxmsBtm9HXybO/CrgKieaRg+37AcoW+7v4hu4U9zj9Omlyt9ys9oSrchBeW+v8AddBsY/7zbSvGoIhikCCONnKkNGF8yP1Prjt1AzjVaUNIbNRPbigtyLhRE7V/CTLSGNmEsfuefcnxYf8A05I6BhlYnMex/HeWOZKMll0JjlUSkQM5USrg9sknA9AeuRctrWNaR4l99Zb3jJctzTFMkKfHsMgM3j6/8o66LJYAzWC16VozNsIEgVjLE0SxqFJVj5kqfQ4J7D9MdKEDRTuVlqwRQeENKskkkEwKiBECeLOSP9T92IPoB37nqSkzmT02oi9SnuXbNS3SaJUpD8URWWPi1ckAqgc4aVv5P+hwPp1Je41ajAUdnHQsT25LEls2dWwX7f6K+agODGqMWZfTsfr+3RqMt/Mip2Nbec7NLzRNLKxWbC+07r/JUGP4g9sr26g8wyYmsibwgQTQlZEmjZs+Xdh5eWR3Dfv9OgDz8eSyKzTM3i3jZrlJMhWT+mwbGMkYwQO316AE3kmws/1orilYVVWadQJBL5t4xrGFy7k/xAxnP79QeBS0nFqD+5NyK4EEca2E42G9xUijf7pbJTChkx/AHxB/kScjrormmfSJdjv7Cwpo+JWZNiY/6Me/2Efkn3r7ixVQniJCoB7thB+/TIstjK26JML2mXa7HYbQSqnkk7bX+pNM7AJGvj490Zu/2hQMemB0FmsrR2jwyCP8iCzegIhmePX1IvKZGA8ULoSPFUyRg/Qg+uOg5LglEqVaqWxK6STVmjwvtLgDMQOPBz4+mTj/AC6BsmnOwrRTSERyV9rM1iONUdp4BEqGN/NcL95Hj4foPX69ADFpWvXeLb/YTpHatlXhnnmQB6wckCJwThiG9MHIGBnqNThn7KcuauOO1qwWAWX8m6kVuAEHAm8vFR2Aj8h9R1LBS+2lfooRv0kkOsWq1+b3qlgMqIyMSnkcmUlfpnt+3r0Fnxb4w6yxrljEYZGEzv7Iqjy9rxyVXyc5cnGc+vSxdKgnX0VnzdsP4xzMFqqrBicEnyOPQZ7AHo6jXGLd1JB5+/Wa49dS7pWVjMQT45UIQxI9cA9LDPG0ArbLZa61Ctpp79SXEKRZxYb18lb2/wDqBQP9XfHbv0yZprGFSaSSsxs62tXn1FuVbogm8mgc13H9J19Vye7Y/wDxsdHUW5M8W6Hru7TYJLIGGrt7iStDsNvHJKkdd4z5KzKAxIGcBiDkEfoOgvOT+wO3X9KzQrWNy/J71WSWM0alb2/bMIMSCVmzl2z9xC9/XqTyDlMap70Oxo2rFdNjAdfNrNYoC1K9aMH2VY/axQ58Xfv3YfTPQAW0FuFdbtfwlO/TRqL1etrDXrtGgVz4eUpRJlLAlXB+nfpUuFmRlle3ShoXdfBDt6l2UULU0fuzyQB08hOgiDqyxejAZz6Z6D35OgnyaaDbSaqazea0oh9mOzPTirJMJDIqtLCvoqA5KEAAHP1I6Dw41Yx5JdhxnldyExJDBp2Ya2W15fjxrOGP4ssmF8opMlAhPcFe/bqz3YT5+z9I6aZD5JDDDEzP4oklc2XZmCtmQIC5Y4H+JxjqsPoHZLVOeGCBXkdzPaPlOULJJEVHlj+p2Ktk4/Xt1BDPyKMhEjzvI7OMfjyK38gFAOAvoDjGTnv1J7dCvBOY/twF8mAadQPESE5zgHHkPTI/xPQAXs/2+xrbqbG/FSqlR5lmCeLspOVJ+7yPbv0HbGyZUlaSBYrFJAzNK92VZAVMEsA8PONGAJWRcg5Oe+PTqyPl3F4jv+nHp7DjX1WMMCrN5SQlFJhaNzlfEE5yPXv9T0roaTk0T503Mlm38oQ7n8MyymK3Vl/D++wiCSOXzRsAAKSVwcgevr1aLbJ81zv/AHJq1veRawSvGVcRlorKwr4sZJWLgFohgv3wcdKH0FX5klnz0OhWOWQVb1iRY/y6isT705AdyR3wq9sn0I6XK5nSrMG6NWLxWkiI9dPCWMgkpHCAM4Y92YHGTn6npksA0xwFhjiKRpk+6GJZPb79v1Lfp0oMgu1YKS17AVFjVvIeK4cK48vu/wAT6dMlcVvGaZZElKuYw8ksqlk+wnyXGOxAwQfr10e5XnklV5pYVFieYitVBP2OWx4AfX6kn9ugcGVxY0Gq/BoQxWNpucxRtZyEkkcYeSRlwxRFJ7n9l9OlTMs9JpyGhXjoa6tR165jq4qq04K/1gxLH7ftLd8kn/LpgszjYTKiyKpMLWFkUuzBpYi6+PkuO2cntkY6AFemrwUKNH8ya0K0KGe/eb3J5ioI83IHiZMf8oGf066Ge+WrN11WaGMF5zgtKFLZOMDxOOxI7n9OuRYGxREnM00kcRkaKNW8vAKqg9u3p6lh10Qv8intjGrZ1ldbl6CMWXicnxhrBxiSQpnCZHZf5N3AHQNbJbhMOqsUrPuybfduC8Ke0hdUkILLAB4hAF7+Oc4/kego2WJ5prQVW1tNjI/90m/GosGij1sEipCwZfFTJN6t9vqAQpP0PbpYs1loO6H6S/if0lZWjQosbTeIjRPTAVf/ANT1yWIQZUiPtuJFRi0lkJj7gWyGIB7E/XPXR7gyOWvG/uR/9GACsURyr4LnLKT5Htn06Op6crUK1oZJY8TBa7r7hjkQP4BWwo+5u2SP5fT16WLJU+W//I2dKt7j6asu2yO0phxDL7QKrEqYRgQqkscHOc57dMqnzb3t2T//1PiCjqr0GmCiq8095K+2d0dJJI6ohySigYH3sO2ckjr5sfp8N17SQWtZuprUex2NaN02FWjG0ntV3UQJKPPOHJ/mw+vYdHU9OVqVZNlPut7saaVTUq+1JF+Mquj+2sYzI4jPaWQkdm9AQT69B5hKWzC5bXwxiSfWxxWDqpMLEVXAH3IAO/lgEHGe369NnR2Yo6DPPDspZY3bz21EPJJLZlJBCQ+eFjwTkjsMAgfp0ockW7qxPBfjsV496zv78SWQvsRxhAR4s+Cp+3sQck/p10MHQ29qhHXuWLXnrbyL+NdlJMye4MLFMQMt+iucn/m/XqCnyWM7oOLVuPXIJtTcalpdqyvs9bOjOUOPvMasCygnOFyV75U9Mk43JdqUO/kpsKNS1rbi19rM7vREzI0ZDqYlV1XOAR2DH9e3S5blPWV/xEVbYQbOIivPOAfONCfMp2x/TP0z9egC7MkdmuLcztLNKJFjeJfHNd/RSVx44/8Atc/5dci53qKkEMlaaStiOOF/ESsS0ecJlxnB8h6Z7en16kbV/UGX5qd+7a1MNSHc7OvHI7+9JmFiQUKNjHjgHBBxn1APQLM2SvJpL411fX7KZRMokgiqVpDKqe73Vj7gZ2XAx6Y/THTJk2r01op6u0fw2pwXUmsVCYdnqyfIMUwfOPywSJPUf8O2OljSKtVoStsatoyV6M0axzIy260ULqqQuq+QOAMn6jx79H6kMAG0Ksde5+RUVXpj2st5llYkAyAxkL5foP8Aj3PXIFSOOaY+1SrprKEQ/Ka1uJG8kDN2xH28vMt2BIx05xykayUMIRsaPj+kmoWDthyN4pPGWrLXacv5KCUQFvEYz2Yen1PXuUnKncntEWy3dXa6SzWMU9SepM7w6edPCat7bmWIMYcjBCkg+WCOpF+Nw5iN4RFTjvcevtVq3jHK4V1VC8gXDOuGBC5+0j6+vSpo+zdM1+G9ZNbpbnyllketuNpVpzFz4TH8p0LlQAPXscj/AAHU6lL7Z2T6E41FCmu328tTCSW60hWw6kM0VZcMQASSftJXH7dKmjZZ+Jw/JY93SSptIJEqxhGisNBmq7MgZl94r2IHY+mD2z1IZNaftEjVPzKkL1r3gZlEUlS85lriRvuCxTJ3UYAwGyP36OVqSsz0LckhqtBSvQSwTWEIiklXEchHY+En8WIGcDOcdMjBwtfDs6yiYR+kaDBAJ7AlsY/49ci/Qh2VSulZ7MhwsSEnwYk+SkYXJye7YHXQwc07iUY2ozyvR2O3Y2RZGDJM4IDBSc+PgCP8h0qUmU3isxl1MS1Ps2NNC7HZoRHLCpPizTooOWz6snr6kDpos9GoJik1yOWvTiq2Stln9y1G7tIrk/cFDYyOwGf26Bgi2X2LBDKRJZlYfip3QeJHcD0wOx9egAtHHF7EYlcBIx9jklmH6fcCcjHbB9OglQr7aTEMM1Sz5QTRgjy+weecZyT9q4OO3foIFBbkGyt+w8ymEeEbQ+bKtzv2jBPdF7AFj3Pp6dAuyzRtFiCts9pyOXUbGE6YRRiOPVx+PmqgnzhQocKMAEsB/E4A9T0AsrW3RuWrHRNeKGJYYa4aGtFB5YJ/1Z9e7fxY+pH16Cz61tP2LdbtI8jzBEY+9JMXI9nJ8UwWBZM+mPTpQ5PbWzjpMWsI8n5DZeWth19pUySSPXvjt6Hv1J7klkQWFjs1wnvfdFFJGziI4USdifQY6AFTUb6xPZkrwFGqqBE9NFJDLOfukjceLMf179SeHINC2FqWSjF4SK86o35VWCZSUyxjCgr9w9exPf6dLFpo1ZPlPR6S2nzVyvW1yktncVH2dGzSmw8ldH9kK7SKo80eFhnPYEAd+/TJ8zwmv/Mzm/j8upfpTweGuovEmuiu28vXmRIvanLFMP7nkSVH7dQb8u1tnV0ms2NapX/vVeUzXtXZlhIhmR09smWV8fapHcn6DA79HU9OVqV9LYlmoVtrZRpmqtPFGz5LgeA838XGGI7hAo747/XoPMnjSDaxCd5W/AtRGSzsUkeObxhbx8AYgPFWI+ncEYPbps6L0Rlxc177QzSiJpKM8Qk8asQb7Y2Zu7zHPkDg9ulDkoFE/vcT166a+zaU0Yd2PASyP4hysqYzKjYx9wP69jjqdT1a1+JJPNR20a6PkCMHTLmvQMrCHyUiOaJk9FBH6ZH1GO5DMMrTwzWiDW7mSrKum2ezW3IkkVSizIoYx/6y79lOBgBR9O/p0GlxuSqlvZ1prE00mnurJq4Jks34pCDIgCeHkjqPuXCkemM9Ay0XlK1I1j1yivHIyx12hAC5J8mZfVRkZz6DPbqTyKtinTNyFIK7yxpKTDESyKoYHLNlstgnv365PAI1lqUKM81hlprEzz255XB9xfcA7FseIbsMegPc9dDAsrTsbr8LZ6nWQRxLM8s1u9NIJlRSAyqY/wCRIH3Y+09jk9QI5JmAq7uolSz/AHWewLUdOX3705YH3o5RjKtEMdhg+Ix6H9+mSjxrNGYKn8y6qGlLHs4Apmo7PyDGNF+4uSPr3wCB0qaIVrKtJ+bfCfkqre1aWdlJkMa9mKkEKMH09cdx36g8ANbWnHNVVaLyTyIbCrQEiEyh/LL+ZwFUDOT3I7evTQuwzCWqumfbMjbXcxaCoyfmxCs7STOIvsU+XYqHGQQB1PHKTJZw/fmafisl40q77WwsiTLtdbUPlWVpF85JHmYllVRkgZI/QdMlastPNDdKG2m0O45DGb8n5lTfQtRjtIvihmUGeAlX8VbzBPc/X06lkWxmvaMn+U5NtFU1evt7qS/raOy1s8de5KjyQTSua6+1le6gZUZyf1+nSpPuXZPpTRmivD7rUYfGlM0qisHeRmsyOFIcuieIHkFZAMDBIJ6WN/swFGHZ19TLA9nUtYNqNvyq8AR2RVKlHUytgs3jgAfr0yfP77c5HJS4lyedf7aq656citDHEuTEpYSGKxA3pk9yhXpkYWZdUBFq7RpXZrVzTyQRQZttHqmnnkllRSocJ5EqCcYx2wT27AdLcY0i2cgmGOjcSRY7l+b28wo1qKmQ6u7u57O/qqjOMfxzgjpUugvenqbGH3IrbfhNGZYZ4ipjPjnCF079seg/wyOggHWbVCT8etFVZQkaflCE/wBRYvMABMdsux8e/wC59epPFlmiDrNOS1RSnVb24Y7njIqxqYZvCXydXbPdXYdzj98EdMmJVszVZTuLeQRXItVtePTa+1I/tS2I5PPyRiW9xGQgGNseq9+3p0txTbqswTDtJQS8zvXT8aLxWvNN5Kzyjx+18tg5K9jnuOoPUrVa0ln31aCGmK4zrROhYIQB/EDtgkEnv3Pfqeh6cXUtqLlaoUuRRwIxkBMReRfuyftIILZOcdu3p1B5mVWNvsnJMuzZ9X76TrNMWWwPaQ5SEKCD3Awp9T69+muh5aBrXVLH5w2m2cLcYfhVkAyKTOoYvGQQPMgd2B7E4GMdGpR5PJ1toRbe9PKLFjWJU/Ar1bB1M+psZilmeDLeVkdi0ar3CA4ycnJ6BpVajAGHFODY0IK0CCOzA1SCKiTMIWHivkEB8TK+PE5OGXv2x0Fke2OP7qxLsIdfcTWwq8n5sVkFhHYlDMuB2DEIQo8fXOR6HoFWwVXrbinDUsiNJ71yKSSoYQkp8D4xHD5I8j381zlT+56A5R6iLFBWeFl/7xZIqmvgikjjgaIsZGjRgS6hu5zhh0ELWTu04qGxYhZ4aMkMQirbWwpRbcxB9z+mSrpGxZvp2x+vQNh4bGrDx3b6YRrcTYmWea3lY/OVSGeYr2DAkdj6Y/w6CjZZm4U4U4SgtcerPUil2VKCezPExAgkkieQMcqpyMeniPpjoY+4I9ts/RQmiRQxxQUGt2llnljPvUXgki/EUuQa4kDH3e2D7nYD+JyRnoLIKVYopIppK0P5EdVlvRV4/EsCh8vt/iPT/j0sMr/MqSXIr+zG1rFJINh4sItcFMRkwVyTGCB6YJ9B9e/QWS36lqnbjnjr2mYwGwSKsk/2iRQ33eB+oznB6WLkMCKO5GXjkjpWa7N+PYmVZFUsPE5xjsR64I7dACjueP1NfWlvy7OxtL92wEkUxIaxwGcEQx48SqKWZwckDuD0yU7KwASapbJgrIadsR+UVixho3jRslWX1I7DOMFc9uuSsCeh2s/97ku1GdNs6yVrsVslx5yp2d8D+oi59cg4756nQbV+YS20cVbVza+3Tr174U39ds9PIVhl9ss8nuoAAXHfCDswI/fpcsWdkuvxlBxvT1NZ42JrUtXYzTWpYPNof5ySMPL7vaDePgnpkBh0BxQxXMmuvbbXcb2EUWl1ghsa3Xzlp3JnjLvAFf8AgAwHkBgfd9MdA+UN+0NfXO+w2Uc27f278NqgqPItyvIGWTwhwAsJJXDfyA+7PQeLNqES95v7GxuXbuqow3BepyU3o3JgKkorvkfkl18QzsxCMcFe3rjpnRUpGcnetHml2FqFYILtIUrmzRbclJ/FlryTZLKG8myHwTgAZI9Pp0NE41nXuljdbWDWiiHdrU8R9usioSzzu/izZbAAVWyG/Xt0touMMswQlRKNerYo7CbcTvUq1zBUTYyj+t7pYmWRx3ZvE4x/9jpklbFUrtc8G5tsVh1lcRS2T/2stzAWbDdwsQ+58Yx38ep4pWM52CEqT7jV0aL29rsDa3ksp2lCnNGjyq2CgQReDGIHJIX0HY9QUfJnc2gCbV7Yzw2TEtc2Uln1+tEo92adU/6buv8AAlc4yT9w6Z5Iv4KhAT1JrUwWKOVq/vRf3CtHOysscUhJMZ8CVJVsjt0uXZmp1t2xy6ayJSiTVrVeCnH4JMJ45EL4btmMjBP6HHTGpiMl/wBkHNBrjseR167sv4dBjtxHNnx7dkYZwMk5P+I6ln5muXNGl5PJrtjb1qRyXIfOOK1+LEZiokQufp/EKR5N+vbHS3FIWrzQkdZaFp7MVKw9IzsJIXrFcvIe5E1YhcHA9Vx+3UC6zU8NqUtrFboxz23jN2n/APdDT6gPLgD1ZlP3Dv8Ar/x6nlFlun6Ro7RjninVIrBX7seasCAFCkDBwD2HTBBN+MhhliL+AGQMnPmF/XuR9e/QTsgiu0FKzJekjeWnqi4MkpHto4A96QjIyQPtH+Y6VFMnslhnkklG6g2A2CyIVjoXQiuYSxUexIowrEt3Vxg9u4x00V6zUEO6Vo9jVEs/5TNWkiX21rl2LQSnthl7L/EZyMjHoeuSyKtb3TSkmnkEkePKaWH1b6gnyGfU9gPp10MHOpVFhMnj/Sm8lRmYOGGcr9pOVOfQ/ToIDMnsmtZWtaMdmLxniUgliCe5yf8Ahj/j0EiRsNgsMpqvIrvKy+OD4+2gPiGcISMA57DueglnSjdK+ze3R1sM1Kt7tG9Mpn5AzAi42QkpcIFZfD+QXGMdl+vQVl6YcYNIKFdpmYT2dnGPfvv9rMmPLCiMnCEdvEEjHrnoL3/CLQZiIYomP9IeUZyQpdj4ooXADAemD0AEPf8AZRXEnnDVy9iGApI8b+JyqqQPHBHoR/h0qepFBepbCtNFKg96XIsJKT7i+Kef3BexXHoc9ACttdq2uuwVYpkrzWxGI7JJZvalOVDgg+IJHr0HjyB81Oxlmq2pLckVSWwGc/csYkkyI/tEjEEEAYx0uWSzJ81f+QOvsTavTbSQxyjT3o0tR2JGEhDslWKaFfFguHOWJIAH7kdMGB97dk//1fh/Wy0djt9jcew9QCIpBHPK8ZYt4n2seTKoTvlAceXWAP1Gv8wnDqGi2Mb0qsklVEYvWrTNXCF3UjzlBLMFb7kTGP8ALpY9+L+5O+wVFpJ+FLHWrz+zZuUWBJmWT2sSSYU5f6ucg46k4O03JdpFsQzygq3s2KahvyFrSeLfYQPEAnuTjPf9Oo6nnytS7MkE8391ncSKkfmsk7CJGmjHtNESAy4Iwe48h1J2R3btL3ZIbFhr9WSLxg18ALPPOV819rA+4sML44+h/wAeuTwFs7O7r/zJ7VeGJQymOdj7lXWQTye2YgijvkjxZmAbv4qMdNcYp2snWtRFWN9mtiytpjrYZzDJqLt0o3407koqTMCQIpGHjGB2zhT9OgVZxtkYa6Twq9qKpBR1mynYGnMgT8eUyBWDZyUEjjyQHsp7D6dBeY1msc1Xth5TZiZKx92IySMokKqSyMfAnP2+pPft0sexFLvqVYVLViZLUthjDWasvnMxbGVSOPuWIKkgD06jqenK1CaybW3Sn/Kuf2aIeUhqV/H8iTxOFXPcKGGMAd/pkddcUo2s2J+s31utXuanVa9XoiSQrb9r7fclQ5DyJ5eTnu0hGWI/THTBWKrOzbp+/t8movQb2zdXY7KONWrx03PiYJVxJHEsjAZ/5GOT2z26WNL4yD+pa2FSA36+8mSPWLezqvw6TOllI48SxylQW79ypPfOTkd+mSjxjN+nKXU0W8uJJ7Ph+Oy+C7q1j3I8MT5BM4DD/T5+vr0DWTzkEJWarx7Xl1FyXcbWIefsLE0xCtGABEgwx7fXtj9emTNcp1wUb0dyyKc8tf8AFqSSGWOpa++yixgklhghO3YepB+pz0sWauLg7peXY1qGssVqdeNjdVvYo0kP9PzHgPd9GGS3o2e/boLvX+Ioce1vtbWaHYQpAbsf5MEhU/8AcS1mCMkqliD39QcfqB69BW5xatBVClx6WtuCLYV2q05LMU0MVKVolkVHEn47DDDGSfQ/x6ghZmtAZl8ebqyuo2kepiYDe7vbUKUUDoTRNu+7I3kufIJ5ZGPr6+nQV/tHZ1N227QRSaTjpmFeOxJGjwn+k0kdSMOwx+jFfXtnP79SWS16YY53VIVr1m80PfxmVQCFJycP/j3yeli65GoBt6pIGexX8a7uFaNVGI3YgYDx58PTuB2I7dSLFyps7ENP8ba1Q9KVWjuZJmhSQEkuytkjGR3Hpn165FyOLX+/AtrSbQtTsI0L62ZlsK0qknCP2ZOwwucjoGOUBaQe7ZhFivLXp13E1tHdQzTYHgMrnPjnJJAGcDoJ5cIQWv8A3TY3LFnykg1xfVa3yRcyFP8Aquue48gAg/YZ+vUjC3qFWWvehaNQz7LX1CssCyqEsKD5ECOU4WTxxjB7/uegWaxkAKj1kOwZr3Hdp+FLWb37VO9E3iit28WjIDAn+RbOc4x26gV2iT8e+kleHZBYZ/NkW1lZK9j7O3i75Ab9A2Dn06aGui5ctVGqlQs8jiqq+4K/kVBcf6/L19fu/ToGeSCpWmvtJBSrflUISLd7IAMLNhQgIx2b1Y/p0CzLMEIK1laS0JXlpvHKXjpT7GmkYMpZzl4gpxGxz/VJyQPtGM9BW4zWtdlH7WUKUjTVTEZNiXWWvEjlWUeJX3oWznHr5J6j6jB6W6h4ujdiLllbkF+PX3IxbkfzFS9Erqs0MaZJz/ok+hX6evp1yXRQehswwuCUxGQvXat4k+SFsEEZOTjJLD1HQB0aMcn5y2Lil6zIFrMgMcCeJKSPjxByMrgED6Y6k9yOS1GKUD2mYV6DPJAyhQsin0EgLdmycegwMdQeAv6qqY7Ejyy+1IrLagrxSB0xKckKwGCSD9AMevTYsFzPOE3cNSFrPsxJYnnrB2/mwymSB5sQSSM5/Tt0tqSqfO3EtzarfMfyLUspMK1ejb9p2LoYprBqkeDZBjHimD4dg575z0yZLB1/JzVT6H11ClY01RPdJmlLztXaVj7B9zyU+J/jj/V+uSD0r0PoHF1LFKu+uq/k3KbyV4XLgzzkQSRySGMJ+KfNQgLEgDuc5x10ehbOznrWLsjQWIbkhghjqSDKOGdolKKowxf1Hpj69R1PPlak9PZRzGKCVZ6rSJJQkDBGijwxhKLK2PI5OS3of8egY5X7FqrHV1+VY/jTzmSa1Gsg90vGBnxR895MEnvjPYdSeYEs2mt1vCo35+87wzbuQYWojMrIT54HuNnCISvl374GeoEWGaINbY27cP8Ab61U07bQNajSKQNZmaRzG85lbH2eQ8G8fUdk7d+mSkvNnFcz26rRbBEaaaKKDYa9IwTHNI4SvdgbOVjyv8j9cq3boIZ0nhmqjDabZV0kRzCdhU9pY1qJGoljd/vYf6TG4z9ex7eo6W6mm5WpF+Y9SOE2pEpyF/xlMzgqyePuE4xgYAGf0+nUHmQrvEaa1R1kP5VyFhJZlqd4oyzgOzyNlUfvkA5z9OpO2WaJDyot+FHb2GyXYPHh4aahPxIniIKmRH+58nv3z3GMfTplcyWSyU020Vzs9/ycQVSE0hcGUWLMbwzHyjyPFfHHm3jks3fByB2HQWSuN9Qi1LQ6qCXU1qibGOyrXA+TPEllvtkZy7B/u7sv0Hft0ahnFbNohp61NdLPqalwyz6+YrWNCQ/jzRH+oCWbAUL5eOTjGMHo0GVmYKNWUvvoLixJZ3U6aGpEJFaOifNpBjKMTjB8RkKVGMdBSZP3N6RQsS6yCNYtDXmvvO5ijuKPGNJPqJph5AfQEYY9/p0wVnGmm3RYFP2r9ptlFDNNlI4pyrrGrIvl5MT5E4HZTnAOcjpc06q0EJ3vZn3Zho1YVnEMbe/IUP48nliEBfFlyhyO4wM+ueg9ixrtYtvi7SQwRvvKZemK0gZlq2KkhZPFs5X0wf29O3TJm2deI4Yr8v7WkdVRsS05E2su30UFJUtEtBFXuralMMboCPcK9yxzgAfp0anh7n2T6LfZbbYwvDsNuskd6xHZqTmv4NLWPkuAF7sO4wxHkMdLGjzjNFIkNLZ7WG/NQrLW3jKkegv2J0ijSZIWRCUcEE5OWV1OQQfp0MC3tpWxVL1qlW2dCCO1rbA2iQIlOTbhWtTSjCsFkTBaRHHkpJ8SvfHfHQXbSwB0drcJrlszyw8nuo0nu+yqwlkViEMfYRyqfE+hDH/hkKRnBQ67Rchated5KTGtsaby17/s5iNZ8+0+VcZH8h5dj0Fb9anqDILO5qvXglsR2KeWhqrX9tQzu2CAWAXOfoSM9u3QXeMyRYHuGluJljeBp4fzfxt5mtK0VdiYGGDlTJknH6kenQVuSvWhl0eiSlpHirztXtyEJajmDu8lmVhM6yq58WUDChj4sMdj+q3KLvxsFCkXrD0ILra7Z1l108xQf9x4yUritL5jwmYgRsO4CdmX1BPTJRs4uaG7EfthUm10kcepsSQ5DZ09wGSdRLggw2W7P/hJ3/Q9A0rnfhdBdLeQ2NmtfZSfjmlivY1CsUso7DHlNG5Gc/qP/r9K9TS8rUH8h3FSOGdm2BFWurvEZZQkbwh/Fmz2PuLnAHr26DzBuiqSbSmt15vxoMMKEloNGYoIR5vK+cZY4GCD2Xv6npoz2TyfS1EBn5NLbB2tHx/2+Q9WhrbUBM80byLI88RkAEbsVzGrH/7bGegPG2SK3qbN5IN3UnWZpo2lo3vcUw2I2+54HYdwc9ipHkjdjkdugrVmeJalEGGW29pDExht0i1e3Vtukbh/RcqAMdu2B2/T1z0Gk5YwRfk26rx278xpSeybLzjzSCGN3KsBEfIMrf6fIEZHpjPQchqzrpdhE7U80aFKN4kh2UxUTvKoy0rr3Luq9yO3pn0J6CSVKGsq16m3qVLMWx1zMliVZUEc8AjEMpaRgSXbOCQvc9zkdA2WpDoXuRJqaxgh18f5FqpZljEKO32mdwysoKr9uF/l646A0I04+a2qtTwU3SIRmStfmnQO8ZAlhVVJPhGw8iqtgenQVmSX+imGfj35S6stcn9q+9mytiOJce2/kPMHGOw7Z/fPQzqeHtn7OEcaWmGygOzLYsoJNdZjkZmQKM47M2CGBySPToPdpa+UJhQoPqtVNsXiuSxieCtBPIjSIjgHKrnIPpj/ABHQWSwU09KTWvUow6yKPXqk6UhAnhHGjSeXnH4sxVfPIJYd89uw6UIDMFeXZx7Ux2lXX614INbYyJDNI0Jkk8Qy/agP2eP6fv1J7g6MJSSRJb5gEZ7p5fYVVfVe2cqB9RjpctlmQPt5rN2FDMwqxrKJKlWfCtG6A4mlVTlmwThM/b/q79umSrybQHdJjDU2FTygreUorXCpAs2X/puzhwAquAQM989z36j5i6qpz73nd0u2qq8W1pRtb10bBpJJgEPaYPgHybIwe3bt00VnJpTDw+wk2Yn2Vauk6utWzDHdAgjDs2GREKsFZAS2CAQftyOq01/JOpp60b2p3lRopbEsli6pWNVaxGFd4ypJZpAgDhT3PRQI1ZpA+s8rFzr0i1y+I/OuGMid0JzESO4DHIHqT9SB0Fb5IA1NNsL12SOU+9O5ljtvWYxRx4JKu8i58mcdiMkkfp1ZFZ4yebdG0QU1CB8bBx/RsxsiJHGjAJ4xxgeI8R/Etk/v1WmlWWoijvaOwh1YSELLf1kzVBeQ/ayBllrrM30wAPCQ9hnHTKpm8lZKuzavt5wkWum84ElN6zPKfFEOGeEkZ7eQyB0A1k4doqLqNn+a1t87uxPEK1WKFEX24wniigA+Chf9Rz3x69NcqIouK62NFTTWK8Rrm3JUldYxtLNeQy2LThB/OVseIx2+zvjtnpXlGvxuD0hL1LQ0ibMSVxHXjz7wTDFzjIZmbJOPQZPp1PKLLxoOu8ahkEW0glEV/Uss8XgqqJsSe66eJ9fcXPj+nfqBbxwyTacLuY9gt+re1MiBq+tiHjbqxWPuVZFHb2wVHi3buSOgWVVvHzZLzKvF8s7DhNyuHs6unuN2dmVALtP7PspEO2FTH3djkjHTKx82zn/Z0hy4Ozx8b3HKbrtH+VM81Z7OAUq1B4BQw9PJgzYx36WNc0zZGni0aV9PFcZ3lu3B+fKy4IZpW93sfoMEDpka2oSzNQhvL7rxqs0TBfOIBJMAH+MiHy8sHP8Al0uQQa6fZUJn/HH5CR/dWngk9qUlWHl6EBmwO5OCeoPAmki1m5nkNG0dNt/ETqkJVArhu4eFvtd8fUY9e3UnuDdk+xqWhAsJs27AD0Ly4SL3GQgv4k5HgP5dz3HXJPLhLFmDwpavR1WkMexDLtyoXyWCvgyMTIP5ShvE49M9SRuk8lKaqBJqJzBI3jTNV4jJXdJBgMVUgqFHbzX/ADB6BllesApq2tmkqayyW1WyiX2KpyDG7uxCqsuMFM5IHqPTGOgrPGUSOPW73WqYrko3NSFTG8tIGOWJ8H7niOc9j6pn/DprkErMlytTR6S2BaSVplWFHrHGc57jwwP/ALb6g+vUFmUpLMkAX2o3n2SH260Fr+Urke2FYj0we+f09egWsbov2KNqPYVqE9BZTKVYxKviY5g/kzyNkt7RwAVX0UD9epKLRnlzDZr61KE1bF8SCJ5ZHkawCoQ+54hWiXKrC2AFOPsGPpnpUs2sZBNMMtqpa1dIWYomfVhTJZ1mGkkgQLlZIic+SH/UAe3qO3UDKpTno3r7QQoprJJH5eceR9zKpyhJwo/X1z36gYPI6ds/gw275iWeUwtKiAO7KMRpnufuxjJyO/boA5Rxr7FiKAeMU8ZjsxRIqyImMgKfIffkYYn0H06k9xXuxRS3q7RT+zXqeNKzPEw82MmfNSpyR2OCSf3A6aK8LGT8UUCi/wBwmjmjqU4IGZncliqlPEYHYDJx9OlyT5+/8hbu0oQ6XxglWSXZWdcuVbxkVogpDlTh4woyfL7Q2PU9MGT921z/1vhPT7bWzrS2ljUz055LL2pK1SNJo4ppPFfF1gMje34DyJI7nuf06wHU/TK2ShHCSWLY2Wlj2cleeurPHHB4w+4e3ciRe4X9VJ6WLLeIlZPcdpolWIoUHizSQIpGF8wOzd/8xnOeoFDytL+LM3tLFJC6f2zXw0wySRKo8iGJOCCfuz/xz10exGp11e0sdqQtbvxOJ6Pgyo0ijzRgEwS57jPqR/x6ALLGHTzXt5sdYKM9YLVdYiGWmrAK5jL4DSy+QDEdwew7dQVOTan7RFX009K5JsVkjQ7CQXRr7OJIURfsViRkPMULDyOQucAZ79HK1GcZjKJJd19a8dj7dMprFIrXNQ7h/Fe6+GZBkGQ4K/8Apg9QewI1q07i3otrdW/I8Cm3HSlH5FquuUV1YHsyOoD5OcgH0J6aKbJq0ZqoqWL24uVp9aaAl8Jfbm2syK9Q4KyePirZaRVwpUkAtnP6dHHOmc5BRLdCnW1dpzUrPPsGUTM0MoksEqSFSQMf6ceOwHZR9PTpkovrXNQtV1x3BtWdrKWhsP7c+lgd41Zx9HdT5ZJ/koIHp0tqaVfGQQjLAl1miSnmCvAQGAUfyR/IZKAZYAjv9fT06WLAhnNGqRC8AjawH96KKuG80UebIQwI82XvhSMevUEBDSayLYUGeBK8W50faidihaCWHPnX+4hGJX+IPozDvkdBnsmt3QRfN+3LLJZkZGV5V29OtJiYTRH23MjjAjVWxkKB2+vTQytg4N2Us0aet1hRKiwoGw1h0k9yQF+3kzgkny9ASe/S3xLKhqV9pLfUzSWE96uqFTDCoyMEjAA7ny9D37Hv0C/jIDHr1qevHN+fCa9koY1/HdQXqBwyqw+hBGFyMjv0z0OeIEtdvYa2tpVBWSqRI8lGzAzj2/cOWRvd8iftJ7k46CWwvzv3JuOzCKrB/eIikH5VmcxQo/tACyoGfRew/wAemTDra0TDfgahdiq6xTKYoKNy/du2a3izEuwjAKNnK+RDMT3z0sdYxiikfTdKCW7yvbW3q+7roYk10cjOshMkWLLOit3AHl/L1zntjoYNHgld6UYCjGWaGGRJYn8ZmSc5CMgz9pXGcgf6h/j0uWZcr1PZjk8YUmkmH5TfkhXUsB2cgAj7Rj9OgDg1Y1Cz+0WWQOrQzDILFewJIBCn1wOgAG9Oijy3Gb+0W68fvSGqw8gkZ8vMquUPYH6Z656kcUUqfIdn+LY2dwh57yf2rS1YHVXRJZAY5mZu7O+QxJ9PTv03xjN9+lEaBqa5rRU6Uc/vwwiOOeZe7l++XIHcFzknpM1pcli8pEh9xmsyrIheJEKeP8/rgDGB6dNnQu2arXlfY1lMdmsqv7sKgymM9mCMP5Z+mcjPQQyV4rtmSCy8jg14zCHd4Vd4in8xNGhGGwf5DKg/8OlhXili7rZ5UWTS2XtpZhYy1vejWNckEe24OcMv0OQcfv0conk0Srd1Ij11DU6+20FgTqfy6+EdkKESNJ5dyMEqM+hx+nTSxR6q6NzBvX62pXrLViX2KtKMIiI5YlM4wcZyWPdj6k9QaXVchsxutx29w1GgaOaG2xEYjPie6+IyQfr+v16BvjaheKZbyvS3RMUihTH4N7XmyP4xzxZ7goPUfUHuOlihYsnMtqatJYp2pAtowkRPg+3IEXs6Lg4P/MM9j6dugs90jC/kRU19syAjxlqyALF5KPISE4ySuTgdckELaqn+Leq2ikkdr3hfq2CFDNIAuc+oHj3yD366J3ShrNbpNclarrKuLgRo4mWWVs5Ht5jLkIMKf8uoGdKEW6U97vZtDrrEUdNdbqKEUliXYbB3lcSke2ZD7AJPgCcgA5GMdSqVzGTghhPl/hW5q2/kbl+8hX+8UOTUzXnuARLLHEJq/wDXRJHGG/plgM/Xt37dCm8fPsHk4JsnNKfUur22urNsY4689S1Yf3pRZgaVDkYxE0asrYABcg9ySfXPQfUlsnAXFVGgWzX2Bviwz/0rcimKFvQBPEBvJfoGHr1BwRRqqxxuFRbVctNTlvoz4YjwDKSThRk9v+GOp6npytT9C6yVa+vdEEdRmW+6KzV5PcXyYhGLdu2cf/T1J6Hlb8OSvNHQq/3eWl7sM0tzzLpAR5q759WAbKL2J7fueoPLZJnr1lqrxGCt+NZvRPcaewysJyzhZrFgE+ZPphfT/SvboKPVWdyakWYKMeuqTwXP/vpVhQRQXp/stRmPESySOo7hVIwowFA9Og0vGowALYU5q5qzF0/KZBDDZmeIRvDKn3ROcDImIBTPbtn16ZFmVipsDTh0tDZ6yb8ywsf/AG8quPZNVT/VgIJB97zXABHZv2x0GaVZ4c1IAyR3N5Z8thQbVwKFQwWGENkeTeWXlRspGwJH292HqQOjji+T9zekEKk716LRamkBQlH48kvkfwokXIDRlcMQTjJXPf6noIWxk826HquprVGgu2Wfa7GBTX/NduwjYq3iIQCoLDuxAyfr0saVZaGHaCqR3Hjd7+JYnYJ7cyMVTxYnyY/QKDnIOfoOoPYHzWIveWWjD71uhKGr1fYKePtqGk8QEyfcQnxU/wD2369BIy3tausqm/plgOj2qA3o2CpLDCzjw8mUEe15P3IHkT6/TqTKce9SFE6xLtkJunFmFWkaEvL4VCF+whUc5fH+vyJ/UY6C7WxsEO0G68hghCU/ahEXiYDX8SjxMfHyHr2wOgZaVgmE3fybhaleKtX9/YRsZ4JfILEQe7MTgAFvTH+PTJ4aKQGaS2K62qkMEQKwMGq1rDu0UTrJ7jHETeWC38RnH7dBwaFod8u23F4xV1iijWSXY68OG8yE8W9nAX6Mvp9M59OgpM4qYD890pJ49ctKoK9Srsapv7NH95plZx94Z8IpjMniFJx2x69M9TN5O7BCfQHHHuClfnkofjJK7SUaMMpmj8R4qWjZgpYFh5EZH3dh6dAzrk60MMQ0PVmh/tKJBHLYiKTTvZYuQzESM7NlWMgxhSPT9MZ6WPoC+tGEtVlvez+RYeU3LzHZVKVn23jjl9xiSsidwpGfEfT/ABz0uLFWHbVbNiBFllq2FnsNtonBMMTphn+yXGcEZHgSuTgDrksCTZ0aW5ikpWleVpDG8UjO6AKh8lZQpPiCTk4xk+vUjfF/cG/7dtJcrV5rhlNpoabe/wByYwpZzlgyv9o+3yAPbsR0alIzjIAPe929sdNRmNiTX0pvx6NqORmfwXL4Zm8mVPJhnOf0+nTJSYy9NVNPeVatIpUUPG2IRJGwlBsMw7OWyT5Y+79PUdKGjLNzV15JYbN2ddhn/t56ihXXIAyG7gse/Y4x+v6dddSaGpmm0vbjSW2XWZ2+tiaSGfS7JnUwQEgg1pcnwH1IkypPoF6ZK1lauX1s8X+QNfDHNFGu+qloGrN/R2NJZAAFTxIcx4AOFLL+v16Cj+tT1FZ+GbT+606+wsV9tpEaST33HtzSeynaMqn2lDns49SP17dBZ+SrQl3c2HsTrxtLZh/JBbe+A/7llC+5HWVHKhY28Q7MfUdujoK4NXuyi7epo8McYVbEKRi1JTYj2VCPlkJVgCCD5Ajvn646DTHmnutoJr13xNvS7hGXdaKuFPkYyrCSN1OIrAAUj08x2b9egWaVrFvZUtfsPHe04oZZ4oEEUtkKPdgkIZVKZbxbJOO/2nse3bpgzOmS4c1KUGxhq/v/AJsUz/lCCeSm7oqyPECv34YHHcd1OSR+nS5rwzEkbiaGA+3LMtdtbVsLkTBl/iSAqeSYJY5BbGegCq2ysky11qs1iOGRgnizhm8PsiTDKGLA9lA+n656AB0NfbXJK9aHXi7WaFZfy/H/AKbYIdow2QxZmC4wMEE9HGKxrNwQjT+LyY1VkrayCvSnih11qJp5EkWMlWbMMvYGNl+3Hcd/UdBSZP3NBRLPGG2qyWqMVSYvPftV5rgRHM0kBOY1L/cH8j3OAMEH06lgjC5KzSNRGyq1PGE1bNIPJ7SAweMbMpHmDIGYd2Ug/r1Bd8jQv2K1PbI9mo9eC7BGUS68STLE/kDGuVGfHyGcA9z69A0oVprNSjKLuwrLrZJhIJqcQKrNMi+TOnfJyM4x27/oOlwK8+5gn1CmGQazWVWkt3bcoVY19s+TAn/VjPp/l69cDB+0dUXp49zNKKcZcPTjvoC0CFPMWZY5cZAwDGp9P5H9OuugcjUubB9LsL5vRQqdR7YqKtlAxvGJzIZGQ/wjGcj6ufU46WLTeEj+98ifT7DVHXvDrpPfsUtfBWjWSH2HWUHwIEhDoQT4g/cR9AcMiR+2NS1r56+5nhaN5kFK+InDwVh4faQjdvJmIVmU49SMEE9B4M4ywfp128FmSjqmRYNnDNJYsWmYiFzhHZAxHk7Z9Cf5AnoK5ZmjCT1NfDFLTq3Zns2YYTVrlkRZPaUeKhAuAuSceWBk/U9AcZ6YtR1J5IoKdh5YmDlxRpsXLl2yxmkH3EY7EDAPR0LHxWgbpJIHkKI0GT7UKouECk4LFR2BX6fr0sXmNLM9cNfVRaSKZPE31C9/ED7S47gE+vQPlLa1Ume3Xq2wlbaxf2WUqSWcxr5xuQfTv5ICPX/DoKfJdJoRWoacyTtSa3aepGsWxr1pcL3mTyZ3MGG9R/Ent0yZvB4uAc6Ef4sk9aL+h+OD7sFd1PoA2SCP0OWbpY26ywP2khjswvUi/KRjHFMqly5H/wCUyPRu/f8AQdAqy0FPxWiM0Am9xpFVbAwwChR5eZPbtj/PoHyeMzj2/GRfesr7lTGMSRqCfqCB2BxnB6g9BZedloaevb2Ch0mDpapxok0oWRQteVXw7RlmAjP7E/QdNGI0ZmmnPjLcV2b/AMleR7X2zMo1VqqF8xIY4HpMyt9cMXUE+hwP36aX+Z8/zv8A/wBAb5Z/Lo8W03H0Ctdc1o5ApCCNYwLEuT3BBwT2+px1Bpt6Yfag9qKuyAVZVPuxwjAVi2fJWUH0IOex9eguQhFU9yeOZwqiA+cYQhVXyBOf1yQT3PS5JbngEzSItVQUUskcCBV9PqoAyfqegAbfqUrmWuVo44XETpekIBWQYXuyEMCSD2HbrgYE3Z3b0exOkp32l1lcJY2di5gyx/d7qQRMwAAkHfy9f2PTZnM5pBCGdNcl2di9vFJja5ItKhXmZT4RRv4t44PpKwJx+3QXmN2RtfxSBTIzCJ0LMiIvuB2bP2/Qgfp36UPcDWo47RajaT3obIjnxZRCB7mVwygnB7djnPTZ0CI5tjrbaa8yMZ4pFKtZVQJIxk4hdickL/IMR39D0txRQtLXrXK1vNpodlVyyw11WHLA5VJI5Tkgjt5du/f/ABCdo8pa41Z7ux2pP5cnlEjFxL4whSVdXftlgcfU/ToK3JMVinpNZ+KgmtSPPdueERs3ZiZIq6uQkJJJ9FI8iPU9MlmqtRhGK/TWGOOKJWlUy+E+cZchTkEn0H0/ToGOMRa+zPUihQTGTXxHxjmBJ/DlUgAEucFR5fxOQOlugtk1u5EELBi10LS1M/2gPh1hYv8Ajv5HOCAf6TE98fx/w6gFmax4ZJXsXMTGF2CezYrKp8fFQ48T/wDQw6gYK60ELQWZUNMqrmuT4OfckGGLH/V29QfXoAFT6bjUOzvX7FNJJZ0U2BBYnBkdV8fN1hzgEHP0HUnuELE9nXJJe1+rM96WNatWSSQCCGFf6eQo+4dsgnPp6dSePKhPkj5n5BV39/X6hb0cl/Q2lvTaqFWArFEEaIWl8Q3kR5Hx+n79DR829y5KtPDEf//X/n/w5uQ6ipqU1Gqr2fcrC9sXgtWK6yQlPBFmZwXLkdsDI/Y9+sAfodbBUdo0mryFH19iPeaeKvbbKqsafkUl8f8ApmJicofAdwR69LHtxJwhU1FWV1m0WxFWaeMotC5iepJIyZADr5GInOf+X9umTw5GgmXGj1tswbhZKOxrsiTaqUASTCYmNPDx7SK5GFZe3+HQWg666hJq6sG+2zf27ZlhY1a2B7v4sPn4yYUdzJKo9tie+Ow7Z6W6EcgEO0+zmextY2WtKgj1esaIP7Lo3Zy3cmRkUD/lVfTvk9AwssX7UlfX1A8QSCBAsTQhkREDfYCQ2fEDOT/h1J6gBTWrzTM156klf27T06z4fMqMI2UN5Oy+JyS3f9MevXJ4ijsEghjF7yzaiYPQeRPFCwfxkjZlYFvPxA7Ds3r00ePwmDe2ligio73X8hejx3YyxPfqJVhWKKct/VkRnHkrMSMuQQMHHQZFZaDm3QjraAR9na1ZNapJL/Resqus7ooV3aRvuYs/YfTHSpsy3DcaS2YFgUR01bDxdlWVsl1AX0A+pYdz0AF4mtphs+0wZCHU4Up3yWHp3J7dT0PTi6k01KGOlZezfAkmV0LMyFoUzkM3kPFQMkeucE57dSdifxuz7G2gm8Bf1lqtLp3aSyyuWUmaD2o2ZsKoyoOcd/36YKDOXYSLl+uko727MStX82vBtalZHLRKoYVZkeLKhmBwcA985PU6E4LZAet09e9ObX5CQWgX17wwxrhmm+2NkXOV8e38iQGPbt26TLDUOzchgr0potnFYpv7bwiRFLPMYyI2GYyfF/Lt9xGR39OpPc81FGpSgsNaZmsze3K1a3IksCFzhCWQMcnP1OB+vTR5CZFHVfktw3YJGSQyR1I9b4FBOi4IhOVACY7tjsCcZPQKAnkcU1vX7GvYi9yrdoiXwTyZoZ43A8CFOSo8CQfp0yZPJrUpgF8G4n1u2eN0kgrn3GnrlC3nZdrLRyEY+5u3+Hp0GbW2DbuLxpYVtxcK/wBxse4GEDN4+RkzgpgDyVRjyHf9+lmDfY1aikH53NSeSKzMonmw0MYEZRlZPMDy9SwHfGT9elRwirXv60teGtKsRU1vGFl+5c/aob6+Xr10e5PS2ZsPcWOQxwVCIfGxGQE9GwfMf+oJ79c6gqCd/UntUBFUjCttZY9ctkMfaRJJP6g7D1Kqcj659eoGAJNUoybWvQoxssOvrnYtM6ZjSTvFHFG7HuBlu37ft02ZvHLX6o06t2askxjWtB5YkrCQyM6g+I7kZHof5f5dLl4R3LF0VayQRxWrFgLDZQyRxxwozMGZl7hiF9MHOew6AJDR2skYu251gn8vFpK7A+4EH2I2MYOcdj0wNAuOvJZVKqf05Q7JKcCNWV/vY5+p7Y79AFqGlr6uxiMltdZ7nnQpVZJYq4tWghsCNR2BZQp7A5P79LfqKZP9Cd1ktxtblMteR44RXRUHmK5fyXyU/wDOclifT06BlZayFak0Uf5DqyxGN0ilKt5PIg9VU/8AuyP8uo6DfF1B0zF7nvFCIml8WW1n0VMAY9BjGRj/ANeg8yobYtrJdMLIKbmaOVR/WLKO0qHsR2wR274x0El+pbTc1X1tydau2rN+RVSVyIpXcBhMniMp64K+nUlLs/3B1PZz22mWaJ49hV9zzgrKXDrGhy6H0x2GP8eoGlmYJoapS5Cx1/4Fi6JLk05RW1sK5kAfBQJ2JLE9if0z9OpK1nJzzbQaCb6WWQy1oNLDGfKosI96ZYcKuCAfEHK9sn69QMrYL1Qbu+Nx3a9j8rc2UdmjFmWP24Y0QAKwAQYAzjy8T39O/QWTOMgPljU8fgX5Y2+v9uCvLRns149fbkkWJoZlhczEVlUlGUY8s9mPp6nptb5nzbGY2CbJzRH0tq9vyuvT+zQ1xrVl/wCxM92ZWSuuFcQpjCMyglGJBz27g9QfQNcZRG+W/otvYrV7NNq+VYme4or2G8V8gWkDd8D6qT/gOlehF8/W9Hsk17HXTSb6nA7T2qohC34kZezL2xMnfP24YD6Hpo6VarCvqZDsrSa7QMNpev8AtSo0PeOrHIxAZ8+gbxwAfqMHGD0DI42pf7BCNfq3S5PdZZZo5/JmlsHySa3K48T2VvHxB9Bhew6WIvTAmjTh9yKS4PzthDHjY7OeFY5HkyWDMU7KwDYUKcAfvnoLFX9T9tJkZlpdnKxmyCXGfaxgsAhXy8QCT5fb9D0A0ALDVWpwrHfe09oradi4khEZT207BceS9vr+w6gUBWtfS1tu1C3hKu5iNe6ksRaRbuQ6uiAtjyYD1/1DJ+vTRUZNWzVO5VdbW11PId0282AhVqVa5FFAbJJKhn9kH3cMV7DsoOcdSx8xXCLQjWsU2vrQvZk92Gso9xZljUBkAA8Aox69lHShoS3SnsyxLIY8WpmMsqE+Xcj7ck5Bx2yR0AX4RYmDRJYNdCF9su48cq33EefZVGPrnqRvi/uBOTClSSgybLwevL/T9ouWnz2PgQVfGMpn6A+mOoFC7xas+y0E/GpKsUd2M2aEVprLTpBDOvuRFznPkofxBH1HTRlM5rRnMskQwwRK7iVJF8LNeeQTSxPHIYJgkhI9sjwJQkHP1B6DTDBqdcNPXWxUb85Ek90VoBGB4XAPASP5BWCkY+3Cg5PShyS7O9V3UlTW1jPFZQyNZifEawhXw+S58XxjK4zkDoA63qUotG9en4t/Qy1qZo1skM3tI0ZKYJJGFC+mc9N6i7YqcfirmnTjjjsVthJYarft4AEPuxlAv8vJ3TspxgBfQnJ6CWVaxhny3YuDglza2634lmhPDSsA5eo0YmM7FcYU4WLJBHrgep6s2dPifLmdmkfQmje5b4zxi1smSWS6teOYofsWJ1Eolw2D5EuMIf4+v06WZLrBq3h5SrJtOR66i9tK/wCaxguWZgWjqpDEzeZLHsxx64OcYHc9LL/M22U/QO7bTf7UvXdBS2sO1hqpBaeavKsqGyw91kjaMjCgY7AeuQfTqBZbTWW6ATr7cUgltwGrXZmmSusglVHkAz4H+ILE5I74/wAegvFvmFFjmWR2jjSZWQR2fFvAe8vZf59z/l26XPQpa9YjPbm11nCVY2mj/OkaT/uLrlPZj8gxzhSVXP1+g65KjNtAvWQUdXtGYWhO9gskVbGGmZch2Uf6B5E/b2Hbv36loMGtRGoQSCWL/tDZCuqp7ckSR11QE+63n3bx9MKCeli74xKzCLXWWjhPvn+oqPhQR5fcPL1Ge5A/XpkOL+4EmlqWDNWsQwyoIx/XlIR45ny2HUY7D1Jz1AmZne0tXLWbl2ZnpL5Vb1EiEwHDOBHIi+X3EY8wc98H16ZPI0jU3Nnp9AdvunF6xrYQ8MZSNPK3KQyQqoHixLNjPrgHPfqTIb09ozStG8UFzNmOzdtmW5YNpx7skszrMSkuD4Eke33OABjt0GvCNKPU7Mqy2jRt0IbFyZ6ckXtLYLD7PB/ubGB5/sR+vQBUo+cr6Seu0sN5pZ02SzRRKYWhADGRGPfyOCp7grjv0AeQTPpLM1mWKG5W8fLZ1UTwwuO7xeQJ94N6g9m7/wCPQVuSxlYLb/VVNlFqxx3YiLY7UeKCyR7U0YPuYmyCIsMPEMB2PY/XpkzONyU8U1KUWdbDvNtel1VDXSVrdEKl4wlhCt2JS3k3kc+Q7YVSQB/w6WNM1koIQmv9r0BlfbyrJvNgI2nihUyOGQkxCGFi3igySDkDPTJkNWXXNohbabd3MmopJQaygkVb5VvvAHZkgKgDxUk5Oc9LcgvFvbPqgzZruLes5PKNhabW0oze2GvjaCOSOrBEJpJH+0M/gwGFBxjqeSK5LBwQwDNxWGzyPi+j3cW/lk127cf28QxeCyySf18Av/VwWYuM/T1OB1HIF8Hg4JU6sprdeTawUF108kNp4iK4te7LFaJT7lUM2VLeQyc47fXqC64x7HHozYjWrJNqNsocW6MbTRKHBDF1jIb3B/ynJx6dLhtEe4v3aMMrbi6IqNVw77lVDwxIRgs/j5MjEDAAyCc+np1JZgCoBdiqbG15VdEkkVvX0th9iWWUGRJnQ9wM4ZFYAf62HYdQHJolu3yipurgEU6DU1PdS5OyZnuNIcMzEf8A1BWHl2/kRk9u3UAqMev01FILy04FBsSSbCYDJE6vED7gL58vID6dh+3S+ppVT2Spr9gta1cV619FUCajY9uSERS5HtMPux5euTju3bv0HQLvlba2o2jiaOyzLLjyxF5fRY8Y8XBxnoOGgNraVm1HYpWdmaLaJBFS2jOhnCTArHIA4IbC/aSRntjpkzV+G6E9bMRQWtLGkU5Jiu2lDh2mh+xiTNl8n1wf17AdLGmWahoh5q3upT90MDICDIg/qe2/fHqPQDB/ToOiQ1LyAySRiNGx4qp8SFU5AB+px0DZYmhn8/NSJ5XH5FhJ08fMgeKk/qAO2Og8mfkAF8/Y2HnTdZZYwypP4kwvGxYZ74ySP8h0HiRSXZ1exsatqONC8MSh1Ky+EozI30T+mGCr2/bog+RmOTPFtHUGxBjlaIhYbDv780EfifAYw3bvgE+JA9eg0nKJYzBDI3uojzR+Ri758ZB69h9GwM9BNolNoT/hyy1y0Mx9hphKAXBX7vqPr2/w6COSEq2xpChMsb+xGkpgrRyFXkdVAzIUAH7/APDoJ5QgbDYPpthVvye5P5+VqHXSsyJGre5G8aGLOC5IdWYkA+g6ZKJmzrVPlOsks3zbyBKuvjox24a+tpGFwPyYLEYc5D58SFBLsPXPbGemD5dkmf8Amap9C7WCa5uqOumy1aCJtgFlJjlDuQi4K/QBSCc9Sa7HXbo3vCIIq7mc/iw/ZMyqpcN49iobtjH1GP8AHpcuyOS5HEUeOAzeRDRyV8N5gYdewPbOc+vp0AWp9s/5lWFUlWxdb2195fJZsA5wyDxAHifU+o/TpggvOouOkIP5DKGMscJCyEH6YXt/j0oMmaGJaen2G4sRvNtdpN+RQhrq0y+EkvswI6kjKooXB/fB6b6mcyatacaNXS/EtQ04IkVIUHtWWf0PiFC+IJB9e316XLsOrK2W/qqyQRouWIR5W9wqcHGV/c465DigqnBvtgjNYgjggdnlavFLE7xtGfFGUr2chcE/oT00NFaWGaCSCCw/5IERrJKFBKeRJY+Zz2zn9T0AezacS1o0mcx27pJW1lF9qNf6jEydzhQvfpYhlWzdCDNXtCCGlc/P0Uor3ZNkkiTRTrIS8KpLGSp8m/ljAAHfoK3GrE9SCOGeOKz5MJZn8fyPEMoGXxjHcfoeoLgk2chmjhXyexKheRpI8ohOCB49+4H6enQAOe5H4U6AhErMv3WFGETIz5FcAZYA9vX9ugD9R2o11iGvYZqer70klGVNUsC5JXDFo3A7A+mepEGle7ER3Z21FoUS0aaicNPStVyZBGO6lWB7rnvgHoBVn1SaWG1PTtecz1KlIIivKhBd2TzAywwBj1+vQDWSo62gPp57tzWQjV6ZIqLyTf3DY3z4hwR7eYx/Jhknx7enfpnQrFcZO3uh6TV2p1h/uO1lce5kLWhiRf44IyfJiBkfy9T0sXvjYP6ny381cbra6DTTteZ/zprtC7vNk6+VZ2gJ8ZSquw8hkKVB7kAY7noPn/u5aCE//9D4Y4fHdq1tH9vhGsHspTSx7sakkMoAcFx9q+ZJbux7djjrAn6hGU0ybEjjAAjYfb5L4ksSyEH0x9D69QeDN4p1YJtbJZOtkhpWD99qEDFewWOF92P0JxgeQwegW4kA8aPca/kNyrX2dOCvLopHvxGSFPer2JV8XaJjkmNgTgA4H7HpYV7wE212XbbWaG6DEmnmFOGmEVTF458LM/j2b3B6eP8AH/Hpksl9ID9Yqz2IJ5Ktr27KnIsQtkwt2WMEnsQcYP6g9A4Kq6ym9XYotKSluIXSSeF28lErL/oL58Vcgk5+noOlTxJ0g2O3joRfjRW4K4Rda0chrWJzJGfczLgllTHqewx2z0AUbUW11wo07FNK8FVzDr57QWaGL8jJZnkUdiA2ST0ANXGY42gvaG9T9+nQi/umoldUYTJMpJU5yceeSAOwHb69SIZJYRtZXGuMcDQXjV4y8UGzdJ1ljcCYSZiWvlgjFgCB6+nTIwtpWhHWtNZvS7G5Ggoy2WmLrfTxaKAvmMIrAfd9CpOO2elT3L6zmX3ZYpAvt+Na+qMCcgd3fGe/1x10MEhgltR2ArlIvbIdo1V/KPxOYyJMjLA9AGc7KrJo4Y7P9JotakdvXNBE39T2JgUlkRV/mmSHLdvTHbrk8Bu5TWMEvF78UctyWnZ9i9P7fik0NyDwwUbJYK4XLDuc46aMng7U1IU57WuEEdCOxFV2FDMRvayRvOz7uR7ZyoYoB3H/ACkdKGkO2iGy11+tUsQPQ1TgxifMLyK2D7kmQykOR3H/AOEdACvsJ566Wa9iubdZY09yKNiB7LO4QSNEPIqrH7cjJAA7AdNnRClWV+PW9jTjM28rzFbViAYsGtlXVXV8r5FO7Ht+o6ADA3Oru62qIomltLYngkeBVBjDwiX2ic/ePJj4k+oyepXMx7mMc+B60+l+P+Z2mfLrf2awlT5eZz5IMrgE5Yf4enTKxi8b0mtH0RwuWtRra2lYndZ0iUtXkOR7rkAEqRnK4ODnH659elT62NNmOtZaJCTYMiF4z5g+L+Yx4gDtkZP7Y6BQ6gihEUNnAieLyVYpCzAsmVOe+fIntkdh0EHlnZVKNirZsRghEeVgkhAQyMMhlIKkdhjPcfTpQaAJRxfeb3vcjQyW7QT+nGXlArqAoJK+CkkEfXroXyTNGEFaxpbUnJNxsZ5bwiutWjghjJjaCtGsKqVfHj/JnYqAWP79Bzg9kOa3ZLbrxPCgapCqmvZER8mUj/p/ax9PUFvTHbv0fEa5BPClKushuxSWI44xbWhbT3PdYZIkUkknAGB/9foDkAW1yOeavFFMWNW05ISfERQMwLMQuSGBIy3/ANHTIsFbqexi5LsVnjoJ+SY0bCyD0DOcDB+hz/j0t+o0v8yluq8c+gp61rPvHY2o0tvOimMASrPK4Vg2Svh9jHuPUHplZYyLTNV0apJg0MzLiLKKHsy5jDR/6AGz3YnGc9K/E13IKdUTTAW7IRo5T4RRqGVoQ698nsDn1GOjQaV+Z5ZIew59zzmmIR8+vjGvfxz6HGOg8wHC8U7+zYV65SQwXhNHh5R3bxLt3UD6Y6AJLLQLUltSljPEwfWJET7ikggeQI7j/wDl/fqTxaoQw3T9vp7eupx2LDfnbTYw+3r9TWAiDNHg+TkHJQfyYt6enckdMmIWvbQq6IbCDd63Y2r5kknJWzcUyL7auhZY4Rhu3l2bOO3bt0GuWVo7Q9WdjfSnYkiaKRxm5LFK4VEjB8vuXOSABnv0r1LPlahW1uKFzWx2q8gtxPIgnqiNXmkJXGFQDsrfyDemB+vUjGjR8qUGf/5s5pRidprtWy9lrszmJYBI0eXRk+oU/b38DjJyO3TOp839t/8AZzn0fro7JoTQucf1TI8rsJvEOxZPuiVQRg5Jx6k/p1Jviq+sjlqNFZqxSwHL2q04Lx9my38+/ifoQcjqBfjFyltbGmWKQMNlqfH3XhkDSzQrnK+0/kGKggfaSTjPr0CzK0A9ja06+k2fK6GugsbbZMdjZi18caRTt4iEyyCIdyFx5AAHt+pPSwt+t0Sq8MUzWbL2jYmvhZZ9hL2WfPq6KM+KDuAvbpouituNa5QmRJNhReMtdqQEhvbBJSRPTuPQ/Tt+3Sx6lKWumvt6/ZawH25I/OGCfPiWePyjBK/dJ5/6gB44Ppg9cngRrrNvYMuxOrim2HuRW5DUsJFDHYCCQx+yQVOAMkAgA+nQBTCXrly0kkSw7GJ12deJo1jne2PuGG7Bh9oyR26CQ/ySOjtOP6vkra+RLEE67XYQ02ignBhQqY437AFmJ7DuMfp1JTLWZgLQsWKNe4Gp3Zbu4hhFAzMZ1WMznzdnj+zyYZBY9/06aLoaUZ6cMDvIkeqriTwjCqrMspAV5c48SP0H+Z6VPYtEyqyq82fBP+290DGPUnt+n/r1IFLcaya9HrX8lklrSGbXUr6K0HueBUq/Ythwfr265Fxc4t5Qb2TXyWzH+RVkt2pVgaR3FSQ+MGcAEKHIYegOP8minza9kgsrHT2/JInriLXm5DyGGPYk+Ijmgw0KOqk581I8W9epZDCXoSlPfo2Wnv1Z/CGRRepamBWmqrK2AseF8PEdixA7qf8AHpMsTzZ170lqvfimiksXo/yVmruAx8cd0SVQApH8gTjHr646bOhNuWZpPxDJF5D2kaKzKJPxjU8h5jxxjwOGPkMEsBjA6AL22trx/ZRGGF6nHJK/lVaFVaNJ1cTeQVu/ftnJwFPl9OgjjGYf+R9mlsNPbr62CTX09lttfPPUiZPamieMuAq5Pl97eSAfT17dRrsHy/3Jvmz0KW2gscV0morHYpWVpNwNg+FhhrxJCVbyzhmJwD6k9/Tv02yaP2mN9uvBZmS3Yn9nJeglQSfezgEsHaMEssYUn/6elTXMrVSCNnhoxX2qRe5djS00sJLo7HCM5bOSScenp9elugzxdRihmmmihhmmx4qGGQuPt7hcn6E+uP8A8PUHmAdleva91k1saWofPxsVL8jxeccjgSGN/EgYLfbnt0AdVr5fX7eQS+w9ew+whxEFCywoI4u/pgqBgD0JyemjKZFm9SA1cLUmSZ5xLLP4o0isngAw9xsFPr5A9LGkX0+Id2myMUcOsmglstsgIIJFQkxRvkgPJCOy+vc/U9+gs+US0zaaxKtplWrFWir066SOZ0kClVZixIIZeykHIIyc9QJhOztrO1ZbANSJr/tySGxAsEY8IhGuYVHiPQAj0zlvU56AE6zHbv77Va694vNSV7kkVOP/ALc1oSDknJ7+YH2j6dSIZNqwG+V27Uk+k1UE0SU6MJ5FsBSVRHNYkVoolY5wQiAtkd8kdMlbgltKNUzSaCTxjnmlCxNI1aFUH9N2GMyDI7nvjDED1PfoLwOa42IJKlZgditZZJa8+u8BPA0gx/VAIV48EAd/uJ/UdAF5tbLJflp7BVjh1Esl6+4DZUSxKWgKEFSGb0AySR1J7inbnjIrvWH4qs347TxJj3auSQJh5jt28ir9wcAYHUHgE9VDa/PstrmhrVUwm1NtXd/feMY8fE/+3Dd8d/16FijzdDpdLvItxJQhk4/rpRHtZWTY3dhH5I9ZnPYP3w5wAVQHJ/1dumSkxeM5Yt16y1Hd4P8AuLdmKW3LPKV96VfAPJ5uTkemR3wPoOljbrUYdot2dhUs2KUEcLRwyotT2qarJJHI0YWJm8TjJPr6jGT0AVr2zOn1HJL35a2rkmruhleBmEbewyr5Mf8AqA+BYKpHb1z0FFm/s5y18Gfl7L4x4hr4ZzTNNJ5555QyziNLkgRYwwOP+VR2wPp0sLe0f+shNkvy29fZrRVZc2JWEK25l7RB0wzMTgZCHt39emS7JuN3Ndyec0d1LHLDOXhguVfMNYigJw5IZfEyMuWIwB6Z6Bf+IXOVVdpprgq7S6djx7ceNSlch8GLNIwYxTD/AFA4yG9D9TnpbQVaVnhmqxAjepvtrZ1eqggjs6m3I08dOrIQ8kseFKyO+Ai/U9+57enQL43WAr0NReguij+NJasWFY0a9chklhVvuwO2B9Mfr2HTJY8fQ0fi+zEyV9cZlinqu51cEgdnKFCxjGAThcHyHbHSxpMYyGasQkIM5WYMzoYiMey5JK9u5Ge/f9eli5Ib1bygIeJfejHvLBNn3v6b+CSso+398fTsegRaFqd5IblR5njjkLDX3BIhaAJI3imcdyA2PX9emdPmUTHzIdpH/bdgsNqRo12yHxklJ+60rEMq+QGSy4I/XHQV2M+ZoFBYbkGvlPk0sKhpQ/ZiFyMgfr+vSxsCVJJK80kTeJj8fP8AFmH9VguT5A/T6Af4deZJeqTpYzM3iksi+2JYSXwcntjuB37Y69CAO8cYubCacZ9gIkZc5DSgY8SPoO//AB68BkU31wuJdRAS8M34qVbBJCug96MgnIDDIAHXuZnJ7xJUCTRx2lUKZ4/JiC2GXPo4Tt2PfP1PTB6lyGNc9nU+0WmRZI/FTkEHwzjtg+p6nqenK1KcFr3X9k1ljhX/AO5/bYNnPofEfbk9cihRvJO8rlceTN7UDThVT7vQMf17Yz9epPcB7ekdpFSqTGU+Es9KjHWTyV5FQSKjA5LIShw306DyyV6E+Zpa88XzxDrV14j8qJt/hfydAIPtVmOPIjx7k9/p00fJGbLhutCQS7W5sbM5hl8IKFWSJiD4FcnxBDDIJ+vUMm29tbJokslWejmIkxLGPagRvEPl8FWyCSCfr9OvAuyCtWq/1UWEpXkjMqSROQAqnB8ckL3+v/Dpg5JJpIFp2PPxkhrp+MoRnjLeeM4IOQQR2x0r11GuOBdlfXYwRyVWFdq/lVhDge4J3AjLGQYLePmPUdB7ga+bE224vqIrjQVVea3ahgDl2alAYo8nsME4Z0yQWx1JnlmazgSq7CGrdlqUoGnkVEr2EuxIryquQsrFCO/6Yxj/AB6jU0rfzLssYmkSZnmi9gCutsKfGMlu7FWIOSewP79+/UinIIZ93DRexFra70akClpxEixRukg8mZWzkA4AcfXpkWI6bybOhJZFxKX5D+EsClmMMmfHyUMO+fXAP79A2X9SIhZlD3XZaMb1YzESSHBBdix7q30GOlii9y5SjaKXFyiaud2jSeTY2ZdpJBXRfFGsSM6AhAoHbBYgdz36ZGsZXhgpBORblq49WOWNyp87Dr5SxspHeMZ7j+J9f8elS4LVsxyRQ+cn40SH3lgYkoCidsn/AJSox26AAVqUxzwLYhdxMpMMhTyiRzgh1CjGVGAAf/p6AJq8cHjXUTZjcLNsZ5fsVyQR6Dsrft6dAH6n/VpbJltippqLtIk91FL+3EASA7+g8u4PqAOmuNqYvJswVrQg7B9huJrcgZ62t7NSoTEh7Xl3SWc5yqhh/H1x6/p0FnjMZRuymk0tjaFXWPJaE5Wugmldvuad/twvuBB4jH2jGcdLGkWaL2l3cT2LdO9LFX2EMjO1fIMZDoGAdu48mByD/wDX6BhZk+cvn24kOs4dcYysn5tmhBHEntrNIyIDKowfUdh5Dv3I6D5v753oT//R+HeLWxX1n9SK0lKhB/Tq0IRIHb2gmAxy58AoIx2yesAfqNb5k1ffNfrWp78djTGW2NRWNoMJMsBh2MYPdvT9AO2epIPdnHtoNhYmrvXNUwlZGdT78cqN3OSceDDPr3B9Ogg8qSuLkM0OEtV18qImBJlh8fvQsPLHnnK5Gfr1B4bv9hkt7HX7OKpstZBJL5FPYjChvGEfYwck5/kpOPXyHp0sKrWZgBPNHuQ6XV9322imrJE/t+a4+3DR4JBXuP36aLE52s41Gms265Cm3NE5RpMNIcAMxkfJ8wq+S/uMd89KHIO/HZtrIY9/7NbYBZ6mwRnb3lwJAkhXtEcnyJx9egArHSusja2zOktyOVp7LTWSUtMwJHtvOFDSqDjAz279N6nRXqyW4r2jhe1JBY2DSwW4rMbCvFBZYwrhlbPipVRkH6jHSguyrWhCNnZGfdpV1/5OvrRBdncrBTHJc9oeyPJh4FUOASP19emhbGtdoNs9eQxyvOzTUgQkcDKHkLfdhV9C2B26VHwdWeY1vN6niY2aWQRsG9oSHzIIUAE/qD6d+gCK3eniqSWYjIUQrPJJB4mQohyQY2B7Y7E49OgAMiQcm1sTVS6yMnhBXm7r5FnhkUxrkDzBGMH1x+nQeO0NcNFNt8QbXY277WdrTos8M7MPegfXzqPbJQDsFiI8sZ79NGS2XTMbsUmyo6uxPPBJFPK4hFVCJI/cPgoaTPbuMknuPX9eg1x1LHDFShjWi1iRWb2UkmWOKVJAWkiCr2bIwVb1ByUznoAigtprdfsaX9pdBNUM8l5QJY0CFgWmYlmx92F/fuepPcrIK/Hq+v2d5V2+42mLMtJQy1lURqVI+3wMiqf5tj9ADnPQBYq1rdSvvFgrxS2o67byFIl8FeYRzAt4v5EjOO2e2O+AOoM57lXsHzt8WbWzX4jf0diUs22ttKsk5JEM7yhpRgZBEqZwfToMR7Z+8hPpXV/k3JKUzUvOeGLxjIK+awegJ+oyexLf5fp0H1TU0dq0tVYMR5YkReMC5Ic9s9yCAM9+ltThf5lZ3tizGZh5WI1IjmXufBvIYCZAII/bqD3JJwvi8kcKrMQXdchowxH8XX9v3+vQSK0sTT+7JFWaazSniNb7/CNmi+4+fjjyP3nAPbPTaxk/cnpFnUVo9XrrVf3msT3nZv7gVZEJeZyJCG74Hlgr64GR26gs8atRhP1WGHXVI7EcnszztiWGTyf2hjtjBwAx+0kjHfpYGPkfrluxeglikhlry1U/Ksx57RxKCAoKd2/ke64/XoI5OguRaDZWGlRKqQR0lihjtVXUrYhkXyBDAkj9T5D/AB6ZGRtq0I79ynqpY4zUhkWTZ1izIjJ4iVvInvggA9+lBkHm0kszwzTq9Kk8tSpIrIZEY+QyXUdvtX/Md+m2TOYLGb4akppdp/8AbWE9y+GlNg5Akdf4qPHIwQMgjv8Ar0FyQJtXX2q04VPN0otArHCPGAUIAJ8R+p+p6UGidI/cskvY/Elk818chlz3BbsDgnqegcjUm/AFmxGsMnm4A8ZCPMNI325YZ9MfX6dSMrLA+CtRqxXttdlaevUaOhVEeJGdhI33g+jDK5AH6dMrmT9ysdqI719aW5BYuXJWt7a0Vkd7ZUeEQJKRrj6KO5H6+vp0F5jcZRhpFZpZYbE0MVcwqM2o/tZwGRfb8jjyx+pJ9elD3O5UsbDKWtXJLJKyo5Z/Lx8yq+SoMK/iQGAb/HoAj2VabX6tfwoTcEH5McXcxOiygiRUWLHiCM+TZwPp69SMHzTrWD/OnLLhUGKWlDdqAGQyeU0VYEoe3YE4wchfTprQ+de2P+zmPpnZ7+zrdXHN/b796/P5yS1vZCRRqSAY39vthO3buelj6IWY54Z7Fustp1lpwRtbrzhu3vjy8sN9v29h6npo6AER3MEcSX1hlmHutFHrwwSR1P8ATIDHH8O7DOB36jUXYDuj2tTWyq0x86+wkNSP2/KP2r8gKfdnt4tjt9A2P16BVpUnvXYakllqUTiOz4rXkaMBWJBLCME59FJAOMkHoGlmgZJWrXnMzIZprSJHKwmcRhSOwCA49AD/AJdSMEO0svNtX039zSm89PxqyiRUDWF+8xMoGQoVfJXP17dKHJV19O5ZpSrBtgWqEx39IXnrgxRt5e2GAf3Qf8Ow7dAF+avdt+F2pKPGxJFWSRWRrdaM4+2SHy8gfEEA/Qd+mzovae3HMu5WZp7tGrM/4lP2ytiQXVKsMt5ABWQ+Rx64Ax9VSlySx5x/YTXIpLtm9I8c3iK9d18Iq0cBKGONclct3Yn1PfpkvN4v2/GJQlcGy1qT8iULKvjCVHnli4bxJx9o/XpU8zt7DRv/ANJoZJiPGRD5CQHuf5dlGTnHQACv7xKN+nHdhlapbaOvD4eDRhhkNJ5nv5ZbBGfQDt1Op6N/MqmtZp7fju2r7GatF+VBr7l5G9xofywakh8nXBVsDOfrn9emSsyezSGH5LoR6recRfWzxwnaVZ9dLJIzewZYrKyrIF9GHhJgE+h6Cj9ufOYzl6ONreeZlEzTCRzRUpGA+GHgrnvgr379s5z49BptD25HBYvoF1fuQGX8iSGWwrvG4X70IBACMe6p/Ef6c9AEWwlfc/2GgtddQsom11l7kf8ASkjRQHaIr5ZXsPEHB8u5OOpGCKR6Mr2uMUqiz00dRNf2auZnEbD+kSxGcEjGMoowvfPQQZn85Utha4l8ebNwteGbaVKextoEYFq9dh4+GA3cjPiO/b6DqOp8u92rUZjZau5kq7izYpt+RuL/AOJUSOBHfxi82cyt27Kw7eR9COmmTS+0dLNU0GSMF4Ugdo2B978ggMPtYl0YNgsX9O3VabIINViaMzvE0Ks7WWCFQnjjOFXGQRkdu3UdR3jFCWOBHjWUeahjI0TkhRgdiQvcYzn9OpERdo8hr3b+82NbZx3qFP29XXqOHVI1ijZ+3iPuDNnB79QeAFieaHSamhO4WexYaHYufJH9suZH8VHYeJxnPr+/TPUweNvO1SerTnj/AD7ElCulCZ1i1FSGH2pFJcnJVcD7j93Yfv0qb0aayUpXi/qR3TQZrruJQx99UIVQIDgAZOfM/wCWeggGypFV2ck1XXCOzskVmtWQiC0R9xEQ8slgTj6Y9T0AVdjNtK8evmq66xXr7J4bgAT23KF/F4LSOSF8h3UDuf8APoAM8IWDbbGzt7bPA1WQaTXPKqxxxD7ppS3icZP8Qf8AIdNGezfpCRa2a7He7CzFEs0e4ntWtVQeQQ/j1VlEUSMD9v3KucZAP16CyWVow0gtXpsii28xm91pfepsEVlkUeA9xRn7QQO3rnv6dA0STx1dVWqzMTWaOX8NahVnIZ8OCq+jMR96/r6dvXqT3OdgsQpwxVrxJnWPXwpPNK8xKsX9p5fFvv7E+OftP7dQeAl7Ck1dEQK800riCCBCiJN+QD/L3Dh3LjJAIzjPQA5n2uI8WRqdyOzuZ7ArSzfiv4SyYEbkK5+6Pt/Ltkjt26ZPny2nkXRJ18VKO3I8Vj3TEvvYvMJXmPmcvIUHqTjyH69gMdLaH0HjUTirdhMUivC0cckUkUngYxD7quzePm/iQcdx4kgehx0AMWl1QmlpVjthra1etJsJJRIkciCVR5orRgkEt375GB9M9AAy5q5NhqtxJBrvy6kVC2l6axlfClJUda9iCEt5/wBTwJDgdiTnoKvNfZTFT4Cls2eE8af23kSBJotjY/8AqmZ7DugXJ827/TP7k56WK72h/wBYbLybV07evjsXLBqyauT86BqbuZPdAwQf/Z4k+XTJYsfIUNtXmp3oNxrpJH1rkNJZm+1wmB2wmMDI7Dt29fXpkrWPkaLx2eTbu2k28CjX+x7/AI7CMLl3fxCnxJCr3/xHr0sWarWoBraG9rbNjTpNixWIfXSW2X+tXLsGACn7mhbt9pJYYP69LaFazjO7EOfHmhtVYgTJ/c42k11yCrEpl/IhIbsqZKqf5L+3cnPUF3yiOjr11O9XawSObI9yu4dfFUMvcntgqzenU6Fmp8y7T2SRJLCkGbj2CXSBfJmJP649fEHOfX/HpYtAdsvce1HbWu8P4b+xW/HkBkZe5LEnI8T+h/Tv01xQBvJawuRzmlI8Fm3GAwsLgNMAHDfb29QO4/z6gTZKm12ljacc1/ILDm3NBJDYntyv7jMxcV5jkhiuPLP+A7dBk1rUw4aOD2ofAWfGJ18oQGJPkSGDZPoD/wDg6W1NqqANvMLF8rIrwqgYOkRbshOW+uT3+nr1ImWNTJJHr5ZI52AYqa6yofANnA8iMnP656kC1X8ms2oplVJYwrK3kQhkyGP/ANt/gT+/XI5ytQJqbqy7zZRrEZorbxTxY8UHvqTXJdjgghe2T6j06kpMlQ7oLryGjJf1kU5Vq1iWgBCv2+IlOCSfp36Y+Icg42Ng1Um/ImWaQJ74R38Qrr2P6Elv09OpFgTQ2MUta1aWR42n8fA+JCeCv5eAA75Yr69RqCpNst6xkhAjklhmR2mR1AH2Dxfx9APT+X6enUgAdyX1VSlfOZ5aU9e5SaN2CDxf2wQFLEqoc5HocdMAy0fOu421yL58luFXeapRqpAYfsEoeMk4yfvLLnOT69+g+WssX6ps2tkeerbeRRLDYlbJdguFDkIvie+T6YHfoZPoGDWsmoamlYNISSxfjSRjCIw9MAHJA7474A9egsCaQ2Gr59v3KkvikkE59vOCR+vp9R36UGjxGEkSiWMP4f042fMcrN4j7QAe+PoepPcDWT53qyeHl5v45RQHVIVL9+38s9SeOS2NAZrNUsWzqzTqyQ6xJa1emvlM4jM3nG7OSclv4nJzgZPTLBkfbKvdL5hgvbOW9O4g9pC6Mzg+HiT/AE2ZcAjIz2yDnpU0jWp3/dpYYsujGKQCJpYcHMiHKRkMPJSpI9c9u/Ui3J0Fu1q7kk6wpWW6JZo6M/uHvFJ3cH7iPs/THY46ZOuwFKVGXUwuLhUTzOYPfkZmbyZSWUf4qp/fpYsFy/chOth1leuyLd2kDttAWVzJK5OT4v3LFGHY/pnplYpcpjKzsJaorVsxv7To4qr+TEjsT4FgB3K4IHiAR9O3fpUs2rJAsk+okkQyRst52tw2vJvuITIBwRkD6gDHfqRhcn98Xq0Mi4gglJn95W7o2csgB/f6fp26g9gg9RZY/EW/fkl8GhwPALn7c/djuR9D1B4FGfTrLbpUPf8A/ux43kRsjEET4yR3I8iD3PqOuickzxISsslfZbOKvWkkXQ0HIanL7Zjmte4T5H/mUfy/xx+nTLOpmsGr3SbYCek8dmOv5yQOXMynzLL4lc/TJ+7PShpCHzvBFrfjO9ZWVYjHlSGZADn0IK+uR6eo6AJqWsWOOzOtb8WW3HYVqDeKK6FvAqZRklWOfXv9ep6DfF1Pmn54sWbWh0ymL8OxR20GfJ5SgryUygIVs4ysahTkY9e2emj5t763oT//0vibi92OJNbC1tYa6VopUhQsniXHj4+IB8sls9vr36wDB+mcbeCmvt2LElmzJcmihhnsa2Wre9spGxZTEsTK7j2wrYPfJcnPft0uPFeGjO1iW7VuCeBppVWtYiWNxGMYVWkJYlWBOCMFemTxAdut4Sw3KNtYLDTRNMsUayRz1yxifBZh44B7EHt0AHnfT67aNAZ3qf3P+pUjrSZkdw39U+YRiGIVWAxj1I6VF8nR/QS7jQvLPrvP+2SS2FfVRSKzR+zMrSwrLKndVY+S+QwVxj16Z6kqtVoahBuoqsmoEku0lbYJEbFerWZ54YGJAfDhAFAK4Rm747j9epPct63b1qFMzx1qtuQhPZriSYl1OfKTywPEDLYI7/T6HoAjt3o4odEl2jNvihU6fX2g0UT13JaMeSYw30bP09egC3ta9ynV5Df19eLZQ0bMcU+qjcK8E8BS4SBkKDCVIyD3GO3Shyadyu3Sv6zXbinM08ssscM9pgYn9u3BlD3GcAFSV9Ae3UrfM8RL1U9Ua6xM9jxqQ4kFkYyfv8PInII7n6H0GOmhgIiezTiDtcjvQzTLXSUEBo0Zft8/Dt9x9D+/bpQ5PboSSOxGy++simvJI69o0df6mMHOcdACQ2rbXyRy0bjtUMcktejqZithJQoA9zBAVO+S3fA+nTWog2ajxl4LvD+S1oxFJUrNsKonqg+0YXjEgHmxPZvPsSO+OgyLS14zPR0XrQaaEW466XFSxGMBY47ITwBl8sgj9ST39PToNwcHWvXjbcXGCtAUjgpIv2zkZPtxuhAXsSQT2x6fTqRgle0dTKbUdmutTZrGi1KmHij81YGRnKgeKDBYEf49+ggUBCarHUxzWNjTvp5NNRaNIEMq+bPYBLmRWUf0/Iduw9B0AMWtuOdttKMVkSRz8d29WKW2RgAVh3+w4DBc+fftnqDJ+5NfojDvibXVZ+H6/Z1o4l2MezMH4tyceTRQRlvNEb/Q5OGJPYgY+vQZr2itePorTNWr2rbq6TTMyicRDxB8f4hvHuw8+5IGPToPoCo5NasShZ4HNiVCfcrg4x5DsR5YyelBg8lMWIjNEZZCpL+WVcsh8GbIPY9/8P26AOakteuBHOcxTSAmwjANIT6Kc4I9PXqdBtT5geGstyHbXnttTbV3LlqcoR/2/tIxTyHqQ36gZ7g9NGIzmtaYv07CLQ100qe6ghiEgg8XZSy481Ax5D07nHr0qbVayR6yzJBQ5BDaZRHsoItbJZnXEjpXtrbCIxA8Y3KL5/rgD09WtCuZvTEMdqtXs1YtaLM2vtecyNeA/rYOe4X9B6YH/D06WFeNoXaE8UlmenVBjcoGCkH2x4/cqHIHbB+nUErM6l+7d1lW3SrbQhI3gkCSMnkY2JAUqFHk5HfH6dT0GWWYYRTirRV/yda0SS0SXrS2JQsb2TJgJ4KCv8QMH6n/AA6YFtmAZdXc4pC8WxvSk17TiOAxeKwo8cYPgntggO4bIwPUeJxnoKxmttFSStrrsUtqncNKwWDLJY8S58v4xlW9SAe2B2PS5pV9PiU1WWnsXEhZ5PI/ke0OyrgORk9vXPboPYKWthNWj2VqJP6lhUSp4hQQScKB4+uQxz0HejVGEAWK0K/2XR1ZpY9fUH94CShfFJYiSit4gDDNISMdNGIwi1V0bIC3u2g9YpPGUhFkDKvjDZjHplh2OelDaHI/+98y2FCYIZJADkKpGPUfcQf/AKep+J48fUvVlks1JGYmv7XgCkff3WBz3yPXB+nft0HsLXKW/L1MlKp5q1uN4Py4keQwphfIpEe2WwBnuF9T1HU9OVqfN3GdjJJ88cxqNdWZII0b+qA3488dSsPuA7glWDdierI+Z4T/ALQ+jJdsItDNYF2YzkpJK+vKmeKP3RGzosrIoJAPipPkSQcHrwPpepcvxyChbqS3iLCnNKy0Zk9v3ZB7JdFOTjsGyfUEnoIKk9CSKGepYnjlimk8KxdEjceQ7RssZ/kMkkg919egAdq9fBLY2NGe1+XqZ4o2rQyIIhC4b2mAcHLgFfIdugCSa3Ut6aytF5L25psAIAcJHbhYyOxUKARhSEGe4JH16gpWWYIZxaqmG/bitUr4iqsIYZzOxrNW92IMkkGRhw47N5fx/UHqS6B9tadfewT07j3TYRzM+x80WafIYBWIBOD2X6Y9PXqDwGb+6vM2sp6uKIXI5I7NTYUPcYNMgOUxJ/NQmcsf8ulT1KMdvXzvyB49cVSKFr9nkGx8laIqQUQpnH3M3iWByBj6esHgNfG57Gk5TVp7RR+Fe1b1021VjKkvskW/YP8ArHgrtgkDJH1BHXTXzJI+UJXrbi5Vgk8K4nhtVov4pK08YBXwHj44K98/4dQexLMVmjghivLStSQmyGcR/eEYxg4Y4PiRnJGcdNnRdS47yz1XmTNQK3uxghJFZAfIAkjuQfQ4+nShyL23oQXxWgsxrX9lmarakHgolKAFnAODgY/y6bOhe/qaiuzW7jXHqu1mGR5Gan7kM0XtiFe3m/iGJyPtHUGcZvGk/JtFNgvEwyRos1mwgkZfICN4D5Oq5wwPbvn6eg6joKe2d8RzWszVLESTranimjhs4KeYXwaOOSEOoJGAfLA/X6DqTTleLXQ0JG1MjRWJbcWJzfzEareHYHy8gzY9PH6D16k9wPbc361fSXdiBPTUTtcRFHvYjJeJEfxDKnj95+o7HoAHU52kkTYzNYqz0DJBHatvFJWnZwCTASftiIHYKThu2CO/UHgJHyzaTYfDHx3dmZbNfW832esFXMizyPZManupBLRqRkL6E+vQfNfd33htepMun5BZ18nsCQCPUW7w8XmMUcfhArHt7ahxk+XdicD69DBrvaP2ZoETCEvRmgKSKuUhmADBMgsRn9yOlzUn4qIbHm5VJgFqzrIx8CQ4YJjJz29WAz1B6bJV2lFr0Yhr+ylpXhlrpZ8yMI/kwYxFW9MlD6emeghr9AJZ1GooGxapUwqzDylWMY855pFxhV7Z/wCVf8h1Gp4NfMg389Urr6MtQw3Z5GtS3Js5lj9tkEbFRkN92GHr9fp00Y/Cbota23Hrawh/Knv27DrrakMh7xyFvL7C3/IMkEnsPXqTXD7LoqARUg16NgCSSnW/7aGw7IVUyRxePnjBYZPr0qNcX9yGzZkpVat1a72n92MCkcIxWYeIij7HwCgeWe5BPr1AmRbLZ7CrJoWsyLVnssLds2kDV68ZcwLE6qfM4A8yxwQxGCB0AUdftZaGh3G2Nfxnkaxs6FfzQmsk3kEaRiAvkxHkF+gwM5z00ZVrStkhe4q9JtQ8VtzNtYUejUthPF7LBPP0YBft9B+uOpNaOMMdmqWdmRtg333YWlj8GlaNSzznxwFxk4GPTpQ4P2u3cdSMmVYo68c6mWS5kh5AhLe2wGC2ewx6qegCh5a7Ys88yvWltn+jtdbCYqphUlfJ4znLIxA8/EZ9D00eQNpVf7hyQRVcypqoH21elGuBJKcxxtgZBBYFxjoKzNs2SLcw2tjubNe3f9yTTp+LM1ZgoktSL/WAYfaAg+xMD/DoFsGtRhFqemlUir4LJTWVbBqx+4jMy5UuzJ6gntGuRg/T69Bd8YJJdsX2j0+3uK1Jpqv9ttQVK8HsvGPIKDDiNYiwP1z5H69BW+MvVYiktfV2pLOtsQTAVml2LGgmQ/47vIxRvAr5+I+vbP7Y6CzCF6u8bw27cqme7RsV9OrOXufjLVfyMuT2lYkDB7/T0HQK5H7KcD/AxSt8c8TtLkTSyXddEj+4uDHZfzPf1znGWwc/v0sUns/7I3J1ismX3IXZXX8eb3VbPb+TNj1A/TpkuQc9Va6zezqZdlYUt5PZlHtxxyfeV8AQuGGD5EZHp1yeAI9rY/01jRo1U+E8NLxEak/fGrMSSSD6j6j/AB66I4+h7yW2dfr4I4JGn3Wv/wDvhSipsY3VlUPIgH3EFwTgN2PSoyyW/irni6TnUG8C+dC3GNtQqyfbJgqySkDy7qgPj44znOPTppayUvStaNJuco0/JuR2xqVsxU70ZukbBFVy7I7ze8xJARS+Ec4/09vr0syXeMWowA9NfGIC1a152k8RHASwYq5OVbx75UDOM4I7565GD9YDzyKntiUJCPKtBnvj0wfXAx6dAAGYz3a08dqmZshpYYoXwcrnCoTg5JH7dupPcBcbhkk4/wAq1rq2IDYg/GC94xJGbKI7fVgW9fTA6kzuS1pTHPEt7t44Ks0Qe5TtYLi4qK0QghXwVWyMnzJLAg5zn6Do4ppuTqPf5MUmZrNX3p5JFmhrQD+LBSGUyDsyg9yx7/QdTxRnknT25TPVSeBKEVVve8lJdXDDDJgHIJBzn6Hsejikcor2rNb+5XYpHarWEInVrDARSZkKgBie0oxk9sY+vSo6LyzV6/LtVYiKmpdqWZJpfILGzxyKFEjnt2GWA/z6ZMtkmRL5Hu7Oo5hvaXsSvDYnhtZVVD+UtdSPDPYgYyQP3PQL8nQrz2vfhjt3QIBGq+TOnliIPgr2/kR2Ib0HQRyFwVGYffScuYpogvsQySyLgvJg4GPuIPc/THcfp1B0SPclnkkmRBNHGEki92OQmV8lWPick9vQADI9Omjlf5BDc66T/bFq9YlWoUBigp+Te4OwkAKk91Ax6919PXqCTGI9dr7PPdHvb8Rj2WxBqzXNlZKI6tSaKIKqghSAnl2+4A9NHy3k3zS9FLClSpFbKKYZ2zIxUyMPMlOx7qoJAGfXt0sfU1lqMJple97kArJYMayD+k7EqzO3r3I9Se/+PUFkfveJWQ24iPZGI0IHjlcDyXx/x+vS/TUjkanMMsCSx2EgB/H8k9tmyqk/b5AN3+v/AB6NQX+ZBamq3drpq0bt4Tw3GE7spEkuFHiO4IJ/x6FSt9ytWKRW18a07F3XpZ/KWlHTre7OctEWj8jE37Dy9fqc46Z0D20tZO3lYbKi8Vb3IonjlkoX0/7dJK8okIkX/Uh8SP3HY46WLLK/Ik2tunLf222SW1a3NmefbWpIvARoJ5fe9zA9GLEjxPYDH07dBW8bQie5EorWJYm95/bIYfym7+aMT6dhnPQHJojDdc06F6xLIDGyhk8QCTlQe5dSARn+XXJY6CvsF1styDY6RkstZjaqIjF4RV5goIfyf1T7jnv9c+nXRXLUJpqsRNVbUTWW92FopGJ29qKiEEkyohyi5JPiwTt/p7d/XpkW6T7oZtT8W2jUq+qn92BY1CTI5WF5HyF9suF8WVR9w+hJHfoZGcb8wNbqtDGvlb/Nr+48FeaNR5MVUdsL27Eev16VLgIRWJJoaYCF5YpFkkWXxJznODk5+h9ejQ9VPmULF8QttuQQtIt5AaNJosASQIx8FBxk/cTjppb5mG9ys1pqURY1dD8Crq6gha7Er+3lVCtG/j7re4R+rEgkH/PpY1y61G0GLUBnUs0KEoXlAdQSACftx3AUeg/XqD2JatmxYsIQgEjLHEZIiw8fAjJHkMenY9AH60YKXvJIWtMUdgSxQuoyCPIdgp+np0AfJPzddt62lorLXClm9v2u16EieyrH8IhoUU5yCvfJ/l656a49k+de7t+A/9P+fvGOQ0BShWMPa2FWtFXi9wNEkYMbeLfcCSjjBU/Udx2PWJP0NhMlBNCELG3r3tZSll2r6XYU/CeSnr2jWOdl+543SVcrL5HIcDHj+57Ll50P1XkexvyW/dRa8NBPOkkaZdovD+TkkYOPT6/T9OgCWxvbmGkaqWR3WU+/EkawQsv8XzjCf6j9T1AtyBSbdlbkUhkjBglJqzUQURY7KFD5KScZ7EHPcenQL5PZPORb0XZ9HZaoTNZgkFq1Eiu0awTeSBo3wGDJIT6Yzgj06Ct9tM2Satf2l69tY6YnV9mIYYYYPb8Ehw2GckYITOAfX19R1Jowtaimr6mWGmq06xb8mwlweZntRkLHHGoJKj1bC4ye/wCvUC5wtsvQsSbWZ9lXuln21dj7T2EcqHiBxhVjGMdgxOegjkFTZ23hal41K9e21aWCxJG07rFXCH8Z3AY+UwUlCxySvb1HQHIGLY7eaxwOnbh3MdyLWrrrFqhHGFHnUZI44q/1lfyLu3fsOx+nQL8oXVnG3oqFpNXgWfArWSiM9hPRfHsThzlcfy9OgY5I/wBbXe9Q20lqBvyEEWxaGPusiGLyjAUdlyowR6j9j36VPfoDptyb2sNiqkWtS5G1Zq8an367qApA88+bg/cCcdvXPTZ10E+FJaUdUigDHY9+KWzUdTGjt/XUhZSTlgncHt64x1yVvKGb49mtHU8m18cq1J7dyKWu5V5WUPGuQS4GfHOAR26nQzeZM9azI71kraprUEimktB7MrkmJ3X3MqcHDDPj6Af59Brwsmxuf2zX66Wf8OSnLLI4vShz7R/RY/tIDZBGOy+nQc8goV4KE0NiWSNdlG/uV1BnmjaeSYjKBQPFofoATkfX69SM9CnRtRaxRdvbY7nb242oFKJjVYAhZ4skgKApPi31HoOo6i3IL8mts1uP2FjaOsm11mzWKWUBZVjlgAZMN9Cowv6dMmTzWyYt8XTTxbxo7GnhuQaaRLlOrdiEsE7yAOyyoGGY/tIb0xnpYzXtHStMfSlU+7YsTzxosN+X24LC5RcE/fGjdvFiT4jH06D6kuWXncbAVYYrMc5HhE0x8gw9Sqr2JIx657dAp0CUURntpe/uUzx1SZjVrs6r4vCARKi5D5H3IG7qe4we3QdNaFeza2NWoZvaMTCz+NXjsqUEaj+MgYr9wOR64PQMcgz7U/J2g1cm34Q1GZNpaisjZ7JkEixXbjvHHGwP3MMuPvJ7KcDoPm7OT/5M0jQXhVj11eawPfmMixSxoRGWRQcEEDxAwcDo1N+2XtnDCksFPFq5BtGlZrVaAWKtacAvmWSPukXbsSDn0z0C/YKkOxsVKk2gfjxDvOtqTYQ1cX4JI4TF7Kyu2VhkVhM64wWAYY9DIrye6EJHutFX9xBQUKssSIvhKQO+Ps/kQe5C9c9BivoLuziW5yA6ivMs12rUW3RWw65kiDFnEYJAZge/bv29D1K5nPcrGstEVNltJWqNsLYmxE8gVvaeVkRZiPdVI1y7gjHbv9fp1LHzNNjdLMB3qNNYg2sswyzJJJPrJ5AUjcSH2/JYyP5DyYMCO3rjqDltnXUf9bJ/bbNLaRNHaaCZ67CNW8VeKM5ZMKS5OcH0x0p0LLoEYJ45lvBzLYkWXyFdIz7kayMEXyCj0JOEHqR39Ouuo3ydQLv54KsVOC0DBHasmO+8hKiL2wxbLEAFQQPIdux6ZWKPOMawplmC3Vq7+WxL4vqY9bXnk28AaWGGYOf6R9jzBUIPMt38R9e3Usld7QYhoTSjnT2mqnFi1DK2yprH5PYoCP2jIQ7h0kR5PNMKfFwMP6jpU1azAsW9+talUHs/mzzyNAssSTLEilPNXUBWIJz9cDPR1OuTqSR8joGC3Z/IdxIxwLKGHDFvb+7xyAV+nj69HF1FK+oPe3NapbSOqLF8bEQxxQzIyPXimTwdfNSB4jBI/TP1Pfprjai/k/2Pl/X2aWq+c+WbR5VMeZlrmonk7okVaAFXB8pCFQse2ABk9h0xqfLFWaLtWU+h6vIaor6pqMMctHz/AO6tbAMYnDRlvc8PHIHljP8AxGOlj64uzBNCVre8bV3bV/V7Sfa2rER/H1l+SGVacqBgQxQDIALeJJ7DAP69A0zp8S3Hurv4FeVP5bKNvGaGHzEcgUFiPM+gHoT2x29epOegN2e9nZJY5IIqzgA15djGSp+pKKpDfTJJ7ft1AuU9NyR6193Riy2p1sFZO6hZVAdgAPuC+3kdMmZzjN6AWq21MFjdQ06DV2859dTdUSRGEchXzVnJJ8kwPEDAOT0saVZmyH6ay36Ot/KFmbUU0FYlsKA8gH3RPlWAjx2Pl2Hp1IyXNpJsl2SB9glX8tBr3SmitLXrKw9qMsPtJbHqR9cg/TqBcv8A5MjbCk4pwW9lX8mqyXywqQReR/IiePOXBUYHnnuf26A5MQH023hob3VmC1FpqK254KNudZLEzRS12hjfDnBZCwAU9iAB0AyzRC/L9zNQ36TW3fbDZUq/47V0RpYoK0zwxe/+jktkjGQD39OgVWaIqtCefZWJRXDXbkTRXBHInlHCsfkIgR2GQrYbtn6dAzyBq2EtHTSafYNTFqG/GtMTShpIq6MgZJMdi3r9wPrg4HUjGou8kefYSQwzGGZIpvGSvF5hXw4byYjBD4GUXOO/3dQLss9BN35s/wBo2NeSk1c05JVVpZAVkRl9+OQmLLH18fEdsd+3QL9IDSeW3Xn0+ivnxsxQJr6ya+MtDGJ5VKBjJ6hF75X1P69BnMH94ZdTsXswywa+SzLQkjZdnDO3l5Z8liPuHAwSey/TOfXoNb0Cm3nXZT32tbBVrTyB44YHLTDOCFDN28u2CPTx9O56OpzyCpsKrQx1XpWotVaWUzW9r70rwwpO/wB0aiwPKNpMAeOO5GP49BJTeOGwNbxPVPLOIphHBbOGR2wXQgEEjxywY+mO36dAq3oI/wA0a/ZV+Ga5YnjMui2+5lr1agTDWpYIJAVz6lhGox36GWaR829ys3viabwzl223HE9rT2PAtHIeaw6jZWuQbatP/cddLTcyzV61yOUeCWi3hYWRJBhVK+LLkjJrvb32UA5VuQGtr2RClU1MVopbVk2EDk+CtIyqWZMg9/Xvk9TxzYcnU5u8rjjrxRTQfk3ZfaJasqpH4gebhTI2cDGAT9ejjkcnUuHk2sXU240khm/JYwV47mXWYysP6bBfu8QuSe/Y9K9SOVqVX5drb81fVwTis08kaw2pAyxDxdf+bOCMYyM9AqyzYCDXpJ9jqK1gRNJDBYvTB5/TyRIx4s2cEEAkgfU9NMGa9s6EdirWhkGzkijcRs0siq4Vl9xQX8f2bPr1BpugeG91KuwMpBrEgKpDgp6HAHcYIwf+P16VPUDLzPWtHII4ZW9z+jXaAhopmD/cC47hR+gwf06kc5P7C5Y2+jpnaPYk9+3fryGW3NXkEzvL3ZHEqyI6dh49hjHfpoW6BafYxLwWGW3JKYzUrwwVR7DQexJKnhIPZC+Bkw32t6Z7dQZFX70Hf7p1UZgqV4WvWHf8pJcLCY2dCjAE5IGAAxHqOpNd0LD7ipHeNmRz7skarUr+95Rqn3YJ8MZ8icYye2DjPQHQq7TchdEFsBoq9uVpI44zH5V1RfEhAT2x3YnoDoUk5HTk1Ums1Oxl2AuvHJalmCuleqrZHiAACPtHuH1x+/QHQI8A2i2NluNiqzBWkSnLZChRGIU90qPAgqgL5Ge5HY9QZvN6CvptxotmsrLeMc8tqfZyWgjv9iTthSrgYVvXOM/T69BeK6a0gtZua+VbKalTZKL+dU2ZVVileVwfIkYIUYIWPHY4PboPfpAUYP7PXaH8kitUgkexHrpYmEUlZwMgAq+Az4wAR6dB4dPhdDUXuP2GqtV7UXu/2yxbskwrIwCh5IFkIyoOEOfHB79NcbUW5WoCo09jr79SOy4XXaOSa7Nu7TebPHPIHZHQ5KgH+T59B27dQVmSZ+imBHw38h8Vpa3WcCnutByF7uxs6irFGGr3UMz3ECTAFQQGOE7Ht+3VeppZKP2jm4PtT6Fi3EkSwWImjW14LYs1FOVjVjgN5LkEMe59D15m36EZvRq7tYLJOvuxs8IIRFGAGWQZJPbGD10LcX9i/HJBZqWXGvSBFRGqG2XRZCw+6TK/cRj/AFYz1yMFKnp9U1yxb83szCBqcSEq0ZSSPxHgW7s4HbP69dE8bUxPh1evBsNDLNAYlac6SzJdQiVCxkQ+P6+JAJI+p6Y7BiVmdYcmalslj01iOGe6Px74TXT/AGFUdvd8vORl+4Z/kv0ycHtjrwNbroMKezVtqY4muRqY8gSPFCyNjIjIOWwMfaT0qWnF1GO3/wDdtSOt7Usvn5JLTUlpCuFEeCQEA6Z6BxNReM1to43kgWN3WSVZa+GXCv4KvY/ofr9cjqDz6CNDco663tase2hCSKJ5aqKTIzxocABSCVOWB/Tv26aX0Mp7k6wjbx5KtiDSW2b2Q1aMr7gUQhljC9vP+Wc9ug0quloZnlqJXtWXZCK4E1iD3Mq7HCYHjgrg4I+melRVvQRqdjWW1uV12E0wleaKparr5vFLH2LOD6eJIyO4z2PTXXUnlalyExRWZBJfSGZ4zYmkkAeKQxx+JQZ/0Sn+JzkH6dLDDGnxIt4mvgOu3Gtmj2u0pynUbHVSv4Rxraj8WjIXChS+Dkdz+vUFbktKMItbLis+w322O0jmSwiVKaTQO06CMRA+OCcZUDABOQMdNC+E0rBWTS6G20T2tlPFNAyQQQn/AKUjZJC/aACcHIx6dK9BjjH5dLRtWGFKrLMkf3lu5aNE/iUPZSBnOD011DjDBR0X9tDiOp4zylpZWYPIxY4UM3kcgkDJ7/8ADoGOgschp1krbF4ZfemuRiYwLmRVlZSoVVGSWGCcYz36Z0FmNPgfJzbFbfN9Zq7yIjUS0TWYZIZYI7EtbLO5Q5UKB4nBPf7e3frnvHy3in0BVHuVqsVOBljryJJLUng8ZjEqlSxX/SDkdn7kenXgfXFlS/PKkdU2Pbls++x8318v9NsHx7AdlA9D0ajTOhfAntV1ia/JA05KqYyYneKVGUCKQd/IDJUr3yB9R0CvQvKlhZqlaFppFigMNzYzozszRKCokZh3LL/r9SfXv0AqyZrtOd0eKXqO93Wte7IIn1mloVXHaeScCRfJlUKUxkkDyI7dGpnPeDNGEadbyCLc39nyKpK0euvKHihaEpIjRQpBIPrnDIQo+g/To6ljg2NZkh3knhs0P7hVnmtNWhaSpTookk8kb9yGjkH3MfVACMntnoGeRfAlO4+mt67e1uODZVpj+XX1nJKUjpJI0JDwW4XZRkBvcKEkggEHt0C3x2y7TsXFhlkgoSrE4XM+0RWYDPgCGGRgnBJ9OgivCCt9PDQ089i9ZJjeWKpcJkYK0byjuXH08j6jt+nQdZFizMA9klvXzR6qd3MEsLXvyaGGjCu6BChTPZvQknv000VntnSjWFc15toqTQxyAVmmrXK0cckJrqQoXxdhhkJbuVz+vSppWtDQKlTy9qkZoohHERUhUhmWOtGQvkWHZfH1Y9z69Aqvp8A8NsbP9jhdmqpAn4BjjRmjcqo+0HALOC3bHqM9LFz01LMjxxGSaSF68db3ShtAgMYiY3BGASB6H/Po6B0E8XIJuOLZoolzZyWaskmoSRWlZpJgHU4OVCKC3cDGAAc9WR84WZhmc+BoUW200sq1qd/3bcDJAKMcX9eHyOQZlleMqGH8Ox9wHI9COq3in0HyMP8AQ8u7inDckMUckECQjNPxYzK4X3QGZQOzenj379AwywL1Hk1W4td5hJTdGNiOqqOVjVsJ9rEA+QPqpHr0dNRavqS/3mK7dhaCzJXjiljinjjX3YrEZ8oirKoGCCobt6Ho4oaZKA+bf/IZZJtbx+a1EK1qztLO1mqzgPIiCsK0TqkhPijZPfPTJ8392s1pj//U/j/xqxz7jkfsV9GvKdXZjarq7KTpCsAAAiDSsH8ip7mNlwAMBvTrALaTw7ptMGq7DraG2Oz8pXdj7sPEtar+0EhSztlWVUQlnIIi+7OO4IOCMA9LcuY0v/N1iwk3zNFBVVNDrLg8o22UsewVISGb7okdY+8gA8g3j29Dnqx6DX/NB2HXcoswTPu9NIJJ3CstDawSwyKVBRh7sSknx+4g9v8APt1Ix/yYvwv8ixRNFa0Gop1JXi/syx7R7MhcOBiXxqocg/cFGAQCOgXY8pRulvkPGfkqnYre9ttbV3ln3bVM6uvPZpywZCss3k6urEAd1GBnHf16CrxvN7QEg1HzhUeaFpdHFrbHkvurFaMrSBT4+TO4wvf09e/QXfFzZNLpvmkwGa2+nMYRQlOlJPE62CT9vnImPH0YMMnGQOljw4ubClSL5Ygr2JLG01csshStBZpRyGqrKG9wO8iFmLgjwx+/l9OjkHvxc2Bbtf58e3mzY44lCurtYQrYSSMKT4x9sEYGO+CRn0PQTxc2Ml/j3zg/D23EfHeNVdMkcEkFunsbjPPHLKoULDJH4s/kMNg5Hrjpkzf1tamD6UXzTOIJK1vS67+0lrE9ixF7q+HmRke5GD5Z7BfU+vp0t0LvxmaCtHW/P8ccKz7XjkNVvdnp654bCPZjrp5MwjUN9vl9f8h9egOLm4YapFdrfNOukr7S7JorP9xUpW10X5AjwXVSFaCMEM57KwB7jB6iuwHGze6QNrflCTS3rTw6B4PLwm2gkvJkn0UR+JQt5A/aT9DjHS/LmFvF5sh4px3/AMhNkdp/tPkPHqNiWxU27xXfFxO3gUXz9xZRHGETuqgHyAyD1YdJyta5vcF6pq/ltL+6hfacekigmkegbSTiTwgdvfLOh+1FbyKqf5AYOPp0WKyuUCr8a+WJpIq4i0IdfCxLBFNLDJN9gZpBIoIRQMHCjv2z0rfGuJm64Mv8Z+YaAt+1DqooMtKj0ZZ3ndA4LlCVkXEasCfqc9/2nkjHjc0VaHH/AJJrNtKppajcS24o5dZsrVuzUs0Jlk95bCV6x9mw0yN7brP2QYZMt36ZK5rykRLvk5lDqV/ucK0dtCI5E29MiSJssI5UKSDxDYxkD1Hfv0uwZvONO0ARrOM8h39+3T1m2TjvtQvau7Y+6rNIz+BVDJ4iTyc9zkgY+h6hYPbSs801oZ4vjv5G10FmqnytJLZuZmMccDsPGHuXgDOxByMOe316g13gXPXK1fiHyLRkFmf5KnsI4JmZ4JDWVAuSQ0rt4s3/ADLjv6+nQHgXfXLNb48+Rsx2I/kG3VYowEjzThTEcSY+yTBLE4yO31XA6kVZxbvrlH/Y/wAl2LULzfME1KLzZZazJceN/PuwDe4O/wCrHPb9OgPBO+uK1nju312+l1D2ZtpJs5mh/wByRrIA/wB6lnlKAvmMgdifoDnv0GcZxk1YbZvjj5cjniuazmB2uvSRIZt7K0y1gJ4z7MBWbxDTeSsG+7Pj3GMZIXfEd9cC1vj/AOYbd5tlBzOzPTpxrUksTTW4WrRgFGhNbyBMcj5IxggYJ7nPQMeCdrb4Tf4j5/r2WC58lbOrG8UatHSuTr/SmT3Iwhue4DjzBGTkL2PTJPgZvXCr/GvMbc00ms+TtrVp+WY9XYuS2XpBe3jFLK7OVJwQXJPcgnHR1DwbvrgmPhXyFurG2s8c5j/drnGRFMmz37LFJBad2R2rWYFwAfEnwwMHP06WK3J4uaHvhkcV+SLB2tuXcVdzYkRNfFahkv0a1O3K33W4jAcmzIQfLyBUrkFcHPTOowti55tN8VH+LvmmNaqP8ttWsH/tbT0FtokiYCsCMlQCO7AD1A7/AE6Bnwjvrh8/GPyWoawPlB3nrZSCOJrqExspBkYj/Ucd2H7dVrKs3ri/g8pW3yw/A/kvYRyxX+cy7axLGatcw2buViYDIPiR4g/8vfH69K+Mm9crPw/KTd8Bch+PuXV6Five5FXve3JDEKVm1d9iaSQALG/ukhc5IBYevqOulcaLMe2J07ss5FrOA8lkin18E2vq6+kPftCvbneuZJG+4qsQBPbuxxjHbqPGzlat7Zdb75b13xfyizY/G1u2gofhwSW1uUpbMcQEkmT4+wy+uMjAPb9+p8XqWn4K764P2XHub8fiEuz2273PHpq1r/vOHSiVoLkg9uEWK9x0ZK5YgyFPJ/E5XuMdHFn9cU0weUh753Z4d8o6wU2ocnvvHZg/Pc/m2EDSRgYRSyjyHYAkqBkepz1C6s/rjP4dlN2uKFPS/KCTIlrYWNaIQYmtXdnYkVUlbsT+P/pyTkHv0z4v+cW8E73SjBothFs5NRrJjU32lWPY1p5S8MQ/JPgAWYZjYYIbyyGzjHc9LcWYrfGT1qRrGt5B8jxVodYODxm3TEkT3bluKkJhIAsZMXhKE7g4VWYEEZA79WRtsZ5SjaL1Bflk1aqRaLT04mkxbuPskkGUBaQmMxH7iSPsDDv2GPXoWZm7o0t5oviT5imkmTYcZopXlRTTjG19izGBkyK2YpASR9y98rjBz0ye/wDyhf22u5QqLJq9GLO4Qxqn982kMVdAUbHmYoJDk9jgKMg9yD26ga65M41+v+Td1MaVSnotds1rr/chZtz2YFw5UIhhiiKg92B759DjqSjyOrvdFaxoPkmSe6uh2dG1GjuhpbmtOntTq2HMcsEmGVz+v0z0Fmv5SjaLdbX/ADmy1xbs6JLsWY7MdeKyiJD44VkU+ZZhn/l/cdLE8XNng1HzFUkie3Z00NgKrXpQ8zRlewEcUZQM7gZYFsdgQOjkBxc2F5o/mFa8MWtt6oXKqILv90imHix8RJLH4oD7ZB+zy+nY/r0ck9+LmwVqNd85zX68d6vxjZ3rsrR6zXTTT10DKDjLR5yT3Ur28T6Z6YPBlbKQ7oQ5Bpfm3Rb6mmy1GhoyvAt4VqV2zbKrJP4oJGmiBQ+WRgj6dSVi3lJtokXXfOzQiShc0LS3nFvW65qzO7hMxqfsAZfEt2J7Ed/TpbkMFl47NBsaz53cNUl2nG9lZsSNRE0aTEwSQqPJQzRsvkC2ML+4Hp0Az5uGakLsq/LNaSXTSHSXZ67kS25zbUs7OT4Eovj4yN/Byc/sfoty5iPG5oi5RpvlItFUKaXXNbiZPb960WeORexZrHh7fkMgEHB+nTK+k4uzjM1CW9xxz/yIXicm4u8k4/Jo3r0V19Wuih4LZCpWiQhVcr9w9xnPqT/LIwyVqzTta0BNfqvlW1XqF5+PXy8TJYipCeLzkgUmUIT6AAhjIBk5wMY6VL3i5slXifyrdisTNFpJXYBY2qWZUSNkYM0QRvUgerkk59fXt0tW7pCy3uEBXuO/Lxf8a9/baxCssVKkJGqmSJiZK7/kLnKKP5eWc/TvnqOSHFzYUp1vmCBdJPr6ejpx0Y/wN7sKVu5afaMrMwtTJaP/AGbEMEaKv/THiGHcnpkq2WsnCJG/5DyTaAVeQAwUY2k2dikkaq0E8ZMLM2cuG/c4DDBXPWbyTOm1KYHN5Oaaa6aPR4h8y7rR6e9oJ9bUq3q0bbKW/P7Np/PAWXwCOpLoADGQMAZPc9XauzdNvhObRJYuD/LE9GF5N3rS8ZarX2UTwGuwQBQsSFAX8WyXyR2A9MHpkuuJlAi3C/lSSSeum90kU0KLL4hbkk8kSL7bWCHQqjSMvkyA+Iz9oA7dK3xfxWc9c8k+P/lNarWrPItBerv7dlK3haUOpUthzXRWVh+hxgdF8Z8XmvXFaHiHy1X2Fb8zY8cShceKHSSbI3R7NmRvKMgBT4yYJAJ7EEd+mtBZnF5Puzhx+GfOH91sJZ5HoUhrxh6SqtuM14JZCoHl4ZbB+3ybt6n9OoFcbjMpNtFJ+F/Ok8Twzcj0KWHleOKKsZ/B1ceEaKPb8hlsn9x9B0uWXEzXrhdvjf50SrR8eQ6OG6iAXrDSzKkkqvhwg8JMR48Rj19RjHfo5BZeLzXrndn47+YpoZxT5LpKU0DH8hVW2tVvv8w6FYgVJH0C4z+3Uk+LynrgS7wn5WrGdpuY6IUjF7UmuSvsVsIRGcyRswyxPqA3Y/Xt17i3jMp65d3nHf8AyDv8T0epTlOhfTl6X4kUlWz+VdlkCiMTsighFUdnzjtjHUma4zs0xXl+JvmgLBK3PtVqHtyeMkEledRLGp+7wwjAdhgoDn69+l+SXfhM365cv/D3y0aQ9n5A1estD3RFspksSO/iSF97EDL7fiT29c9+3UcgPxnN+uQXfh/5qs1KlujzbVQyVJK9d5q8LTNKJY1VmxOngX8h37eAB/XPRyAZwWU9cX4Piz5og915/kHUSpEGGzjm1MiuZlfyYqyr4MP+Xvj6dTyA8HmvXDOn+GvnTeQbOPW/J9TjFOpJ7G0sQfn0pY51YTZeusZZ8oezg/cB4fp1Bm8iq7tSzgzj/wAfc7sQQ+18g1kszyBUDVJ4iREwfKCTPZif457kevUXy8ZwWb9cYLPxl8qtP7y/IsaVomYK0NaZ0VHwHZo4wCXz2wewxnovgtgsp657Z+IflCaCKw/y5SqjYJ70Lz17gMb5CqcoP6ayfRTnH06Ok5Hg8n65+m+LPmHW6+tNY+SoWosHR5dPWmEsRLFv6kuT5g4xn9D26liuLNYLKdqcUeYcW+SdJxmxNZ5mNxq9LE1rkUNOaQPHUZGm92wJB5yxgZQr6qPUHHS2qj3rldk8FlId2cT+GcZ5tbGn5ZxLYUOObqFjX0OxxJZmre3B7RREELxgFXOFJJwT6Y6Z47AstjJ4do1y5w//AMirccEac81urrTqW2sTQhHGQA5g9iHyDkYIyQFbsOx6g0v/AKcp65Zn4d/5D6+OCgnyjralan7qKlqCGRwXUD75FhdXJyCe575x3HUjCyub9cIUuL/+RqVjIny1qy0U6wRzW6pMfsLGD4H/ALcnz8iWDZK4wuOlhnRTNza75FLxf/yLFmCef5p1gjWUMs704vNlUePjlamB65wQcnt2HTIf8p65j+v4N8u1eS298fkpv7uLP9pHnE81UykmAf0ShVAPLKhR69+mTI6Ku17U5qcXEPm1atmbbfIVSaditKiliCSSMYcq5ZWgB8gT2x2Hoeluhe8bKeuXrvHPnO3rrs2v5ppVpkRU4b1oX/e1yqyRSMwWLwld3B+1k7eRwQB0HtxM164ry8T+edbrp65+TdLN/cIpTTvf27Ye54Ixd/ARMgySviT3OOw/XqCfGZT1yknGfnSCzJLtvlHV261pk/tD1dVcC1g2G9tvKVvu7e5nOcDuc9SLeKznrlqjx/5QpbizLJ8oV7cNaq0mw2NCjOfaiZAIvH+mD5Etk9/HxLHOcdMldksa9DdlC0Wn+Vb9CCeh8inaMH/tt6DWVjHCr+PtrF7VgEKGwQCn3H6dVvFnr75C2Byk27OBBx35pghsSp8nJHr6i52clasqiaFHC+2xXBcq32v4AEnsP16Z1LvwTsPfGOPh3yJY3tHajklWPV7CCP8AJ0eotXIajMqESSV5mzJG7nxAUZwcn1PZnoLeBm9cC6niXyxqop60nyg2yZZGetPcadZ08UbJhjBACKMj7snPcA9Lalp4Gb1z8OOfJ29uaam3yJJq/wAmeLV0p4Uk7T+BaOcpF45ZwCQfRe7Dv26BRjGTh7cfH3yy/Ia+ppfLezMEImn3F/ZpNNFLIzrEnn9yscKuVkVR2PcHpkWWWmi75Qg+KPlalJTM/wAxbGa7rzJckntJPVTylzjwjLkMrgA+4D9y4xjqWRrxjHrnM/xv8pVrNeKb5c2EVh1EjRUrk9YzVUJkZRLEWwJCe7sCQFIznHRyRrwM/rnEXxB8lI9OKD5s21ezVjEVvdQ2JvG7EGaZBYjeUB5o1cRB0VfNACw8snrkT8JN64C3PwtzYVrc1z5c2VirVE9eKrcF5mmhmyiqWieDxVgD4SEMx79+gXZwX84qV+NbXilWTgnHpYKtribjkOw31mhG0livcjheItgl4/Hz8CoPjgBh3PUmb4vaNGv8U5bds0dhQ5xLp/xIU/PlgNi770yJl5naUoiI/YiNVPiPqeltTb/j73rgWbhHyO888snyRbQriwI6MEsZIYGRVUGQJ4MO33Ag/p36Bb8Ze9cuPw35E27yStz6wQIljsrTDxHzXLhfCFvswcA4Az6jo0FWsE765zd4T8n+PsD5XsQHxw1uJrTufJR5Af1Pt7YBx9R0B4J31xd33D+T66jrr+25hJz+eLz92H25Q8SLhTJGJmcjHYHHfHqTjoKXJY2fuhPV8E+QeQ0qVrjW/sw3Ns5Nfh6/li688pYRsuF7gMAXCgEqfUeogZWVdoVa5QucE+Yb0FbWJzYy25xEWoVpZ4athYWKMrWomClg+Ap/QeRXPfqRnxjs3fCEnxV8n2a0l+/zy9TmgMOtszVLl4S+cYMyK5LspI8ThwvoDnOcdAz4yf1whH8c8qk8QPkzc1b08hmtXpL5khlCIsZhMaeK+PYspCgjywSQAAyQzgp/XK17hPNNc+u0j/IFrYX91MlWvqb6ixU8JWVJFljf72QnHhg/aRkdLC7OLdo75f8A9j/LFV4+OW+U1Yo4bRh1ur0RmnsrWBUtDDMviEjlYYZcHAz6evQL4xWfaBmy+Ovlfa3r1qjy6txbW2u9HRaqXZTR1mjLKypJK3n7bHuELNj9SBjpksPBu+uc674z+VZK8SbP5bmsCc+Vuaf8z3QuMAgrgDP+rt3HSzOlYWZwTvanCa8H+T44X19r5Ee5rGCiSpLZvJ5KoAUYXuQcegIx/n1W8WabvizPtnKeuet8bc/idrEvJyo2EhaE27N8yMwjwMYbt2HYDPUeL09cX/BnfXErVcF5DBZ/LpyULNq7K1CvsK92SKzKjSAMXBXzA+0ghjk47dSytNNoUfjJ5Z6UQWt/Gu+isTst2pPfl8acjU2sCbyaQeOGbDYPqATj9fp1Pi9S0/BXfXL+0+O/knTpdXW8ke7drQmapq6Vy7CWDjBjVp2IY4yQnln989K6YueHvif4flIdqcGx8e5ntU3O10W15BQTXtDDFQ5VKIL/AL6Qok/vCmTCqBywR0cll8Tjy8umuLP640t7Zyk3fF7aaL5bjuTRTbS5sPdiWsNjJtJB3f8Aq4Kdm+0k4x/n178af1xb8XdA231u1ox1tryO288tmSPUJIj2LE0Jmb2kBklB8hG2fNRg4YY68GcbRK5nCTwn/9X4N4pDBrdfSMClJY4I3ovKI2JcfeSMdizdiB9fTrAsH6I9tLa0KoY1VGvfubKzsLEcusgiev8A3KoPCrEqMGU4YApJnuUJ7jsf06gullivd10NHV3HaikMUYWesb0YaSzI7B41jghLAkHI8gw+7AIHp1IHW5p/jGqswhv05o0v1r8cUiJL+TCC3uRyMfHxwf8Ajn6dgCvUjqSTeEc0E2zRls0KneV2hRTI0kYHoFfAyTj6YHr1Au1raC2w1Uk22rvOZLs1WI00MGGaOSVg+CE9D49wcd/ToFcasXLmvir+H5Uome1KlZZlOSrx/bGrpGSQy98g/U+hHSo+SxvSpA154pJKlpJV1F+kECMyyKrgPKVUlScA4/y9OgD9Ixmevr9TBXtUaZe3XlrBpHmmsAjyb3ckFSgYlFIXxH3DqQAn41utrYNlsqjWv70k3jYzJ5SGBHdlnIPmMoM+S4OPXqALG49xuOVIVElvXSR6ulXrCRFjE/uJIYlD+Q7+Bck57AY79NGeW1+sDD1LSQ3I5JCIdgq7GWWukIeZjIWjTyPn4hQCW7Z8iAMZ6VNEfo1qWIZUg2E8FuErLLNNGvlL4swHtu33IYwMt+uP36A6haC1Xo2ot+J3lnr+5APy2MdslVEgeSN8sFHooyB3z36CWtawj77+8bXZO+whTTxbJjsLSw+EKtOq/d3GB5AZ+g7n9fWBbQPfFqjVXd+ten5VDbikNWMeOWEIPvF3wwPbufr6dWq3zMT7l3hD0NqG7prOvq147+z3dy3O5gUpmWed8P4lQT2Hbv6d+lTb43YP1OJE3SyXFb8OrC1V3jLFQPFVHuByAgZ++cnHbPShA1PRlmgebcO6V7aRNNrJPshkUDxRZPDxLOD3HfJz9epGADs+H2tsbe40DvHSoQLcnq14yqhDMkAkDuR28mVCADn/AInpor2VhH2sFi9Rucf2Uiu0C2NuViciRRViaVvbZ++P4jv6fTPQZL3IvZBfx3cj3HG4ILjySR2trHpIprZLw068cElr2VYEYVmmLYAHk3c5PoCvtDeNjnqcfRpNRJtnu7dIFij/AA/agsRQK6zSf9xk5Xt/HPf06UN+Bpvd2LGs0aJHG7K3iHaMKDglUx2GcHt29T04MliavJYIStP5wVAEkIDL5P8ARwuOwwP0A6grSjJUNxPFljmMX9IgqVQqpySP2BOTj/PoABVPepane01kYw3Z7Ka4AeRchRI/i31IHft9O36dBk8kt9aF2muWK9avPIbNLJswwzN5JHIwDHxRjgFyvc/y7dBrVlgxqprQRbL2FF1CxeScMCBJ6BfInuew6AZWOLEKzuFsxCwyHzhuRs0akEEEEenkc9ALqekBtuleGrK9Oy0FqEv+KIkMb+BHkoVyMeJGQxP746DkocRNylubK0UOJYfyq0UEapJI0LkzSgnIyoJx+v6d+gpPcpqUG3S7x5tVJRh/7SWzV0ktlVeSnDNYM8ojUeOZC7dpJMlR2X9mCcWrZqld1lStGA5gSvEHAjCFSclclvXuME56WLsr1/CRYy02XeP8eFcM3gB+vj3H+fYdQLnEEdWjaeZIXgfyWV5vtKMo7jJz2ye3QAm8xnWzUnFeKNnWaK65lDBWKyA4ZsEntkAn0/XpsrMlpWhJ2176/dtH+D+PU2NKL8QmP+IhZhIpTt2AODjoK3238pgg1XM8PlE0EEqslVa7D2z3Le4REAA3+nHpgdKGlPZ/dkjj/BkWvYjkHhbGDEXAz4NkdiPIEEfr110IY+RzcSPxSe6zhSxRJJuxSViB4gjvgkZyD0BouDJJqVmtarqrm3Gfa/GLdk9w92PlgdsZA9SOmRdhcxvWSUr/AMsQUpU8rskFyQjKCSWOu0YQYJyUBZmORnvjoMRx/wDkz6Fkljh1bRV7depIn32FvrlGnQ+Kl2GSpw5Kknv/AB9elj67qvqWYuP1BqdZXmgmG0dnlra10jlsWx/1AzK7JgHsAy9zlR69ScnkdJLe4r0K81WjauVpZQXjmtBWTykhhkmj9sBmGfUdiCD3HQHUCye2sssrV4q1uRmn9tvIFSVVvGIliSDj6+v+fQAxaeKFjNPq70T0/EPdvVF7BokBkR3IGfF2IIUD/Lueo10K3J61piPTaWRUdYmNOd3ee3fm/wDucPM+fvYkAghgVcHGex+vSxZLLFs06TWZ4HUQTUzFBCrDzZnc4jUeP2t5d17Y/UHHUHBdksauwkcVyu1a9XMkVuhsSVhlsLP2XER90ZwfHt+x6AB1ttxtHW1hUn3VhfzpYoyImSUfwbwOSML5srH7T2wOgCOrCNbu9ZXmgFC3rHkqpO5b/t5Y6xOYyD4sGVlLE5YDsMdNHlktbB+aret8jWhYSSO81COtLZuSwl1ied7Kh/1LAe52OB2z9ehgq8HshCZWJqWLzTQRLCIDBBEsawwI4VI/BBnJQ92LeIORjPSpclqJq8bR2odlY/DsQrElGtF7TYzgiT2z37fc0nY98dBPUttbl1+rvcf10EOyGxMn5qp7ckIjI8uxVRjwZlUY75+uep1OmVu6ZFttdPe12xsbkJbnjR4RrrDElTGgUAIv0VRj6jP6dNEdTQuZ2Q/xzq9feVTBPa1EEtuVCwsRqRIY/BBnKhc/4dMHzfB/fC9s5JtmZNlRqD2NYrVvyMt7TSzRkRjMYAVR45UY9B+vbqsPo5FxmKaGlHBWRlv2p5mjMgyq15UP9T+pnzQtkDIwG9fXqdRdcOPr9W0kEGzV71+SJKNRrnuvLHGwwI1RDjx7HGBk/r1yAjbDh+/0MNS9JZZ6FlZtjWe15Qe7BHYaFj4pkkhkK5OPLH6dN9Dw0V1Mf+Tbeplgo8gva9r9lZloMac8MXlDEiSSt4N3lzIMFWx2Jw3SzS0E0x8j9y42DmG+aLYQbHWfm68fk0rntT6SEowMcFlFIRkBAUsGPgnfA/XqyPoGE1g4V0MQMy046+tgipxasyatKgjUI5GFyCO4J+pH09e/SppepTlrXooJ7Ec5P5ioLkEBBBHr5RO3Yn6ZP06kBiq/jJVjsQVw1yUN/ViIMp+wDLGUev8Apz6HpU9ShutfZ9vRbLYVozPBsKkjyQYnmgkntLGoDsACAG+5CuB9D26k7ZWsjXsKLR8hp2JJWnMtKSouvVkkX3I5lZpApA8v5AAD0/xPTOpS+2N+cq26VFJlvPrmmvK3updg82OQCv8AD+IIB/4d/XpcvwvZoptK8SR2xK0SGA+aqIVX0wp9fX989RoOsl8UI4o5J6iKn40SxirLlgT44+0H6Z9OlzsB3dbF7UMUtt3t2g0KPGAxVHyPuLg5GTjx9MDpkriSnqDT+O4ZorLrNrVpyO9jD49m2okUse2MHtjqCgWWvBCfW0NsFe9D4wQzm5SgmkkAjkOQc47jyH/18fp0Gk4v7hBsw1MrEksUnjFc9knxRf8A6owVvI9+2B37dLDPaPDFr/xZovIx15iTYjGWJyAVKue4H69dCYC3EMR1sGvsDOhgZJK1WA+LBq7CRW8s91yc9e521+hLwitSba8g1R2Mwm2csW0eCw/uNloRAwJ7lfTJOc4PQZHNq3gJUp1KkdfUNWSC5qLE0E/jD4SJ7LuoYM47gqcDvgjqC8W2izcEdNFFVhEj5++mvtyCNWBPjgYC4/kAM9QQe3I0khWxJIrwKv2xuAWVSufuC9mHf6enQAMqzRTVIo7TxIzxmGzWJLwNChPioIAAPp9vb9AemyVRL22uWTi/LZlsGezdpbCCrXhjUqhED+IUrkswI/kfuJ7dM6mazmzMY/8AALCLhXH6loSewnvT0VJWGL86aUrMJM5H2rgKexz27HpfdhKT21k6x9SXKsjFJqlhp6LgQzWXyqCVu3t+RJwO+RjvnqDW8fQok7R5UrThBURwCSxeSNwv2/1MEZJHoeuSQDm+Nn7bo7u4ezJAs8EfsxZxKxT0Yt4hQ3oPT16kXvhqpXqRauf8Yyfiz+fuPdAmEavmQqhlIKMSM/d3ycDHXQdBF4zqmp2dEfcjtWLLPuhU8XUZXKeQL9iyoQO7d/Xt0wUXGvGxO0Ijw0jLHIy9pQclwpOMLnuAOy57fXqsNORan3BNTim96KnY9zYW29oyeSRqxEMjAFssSG/Q4+p7dNHC/wAgTtuS1wIGi1pnmmkaCI7lXhWGL7VT3gRhGk8uwT9898jpU7KkmvegjysrrtmjS1/Y2gRUkjZjHGqKhHtmMnyEjdx3LenTByBNIYJ7PLJJo54LuqtRVbEFiWKCGNIMyecUjliWX3Dnz+xjjHYDEirJX47w8zVrNi1DJXs34PckoLZZEMksnn5YiDoXKjOV/j+/UDQ0VoOP+wpcw7KtBENZWe1XBM/3r5dhjyKMMZxnJP0HUijITh00toMlWIUjI/jCk7IjK0WFQRgBQuVwRnsB+/QNiBDHro9sseqga1LUnkSxub4CwvP/ANOaJZA3kACcehVj29OpIY+QVuaOvsNtpafvvK/lEYJKQQufwKxlQsIgFXPkQQv7Y7Z6CuZ0rQhGHVvrtxuGqwC5OhrGZJ5mkl9t1IZCPcB8vHODkYI7dAsst0CsdhTJajMCVPy8yyJABLIVdiqqVPonj2J/5h26ksya7BBNZh/IsFYKwaWzOyxhJML5eMpOfDBAKt9PT69cDAH3yS1JJ7cSKa6lC10S5Mnl2ATB+5fu7Fc59D6dSKsi7vLxajNM/uUKOtpvDYr2WMnuQeOWAJOWQF+2e49Pp10dGMW5GqfLnyNG8LSS3eLcUSzXQ4TzizKMegMZOMZB/f06YPni28bnqrWjloxP7qVqV9RG62FV1kOclQrZbzJU47ft1WH2MH3Jkr2bEcKOUstJMRdm8nIfuAGUY8MEFQfTpo9VvmVIIZIKwEcixXbx8AI08fBg2Mk9j3Hp6noKkqtWdSKsrqFfuVZWJXDHBdiB9uTjoACtUlobvVWYWMMypa/K9hchYhGGZz+hIGT9MDoK/NrWS5VuXvyNlPTneIW2Y+KMw92GxGq+2GTuUYeuMDGM9AYNaCiXqgmMxjIC1nBcqq+UZkcg5PgfHtj1/wCPUF4HLkkkkZaaRL0IBierACD4KMHxKn0z+306kUWVgAi0qEcaDsiSL/UkZGlQAjCBvqq9u3b16BrjCPZDra/LS08klKSOaKzaT3DHXVlZm7egycAH6dBWMrWTa9TtZqGxhq36Oa9+pLrtnVsFUWxr2eO0EV1XKDIDeSEMRkA+vTJnMYtWmPyCSWa/ahiirLek9+P+3QiOGIElBFFESSqKo/xPr0sa1ZbQHS+Puz1DMzKvgZWZgTIsbZGF7jI65FiSxUqymG2yPadG8k9lfFsYAA8XwfXoAr7C7HHXrqxWSSAeCyOpOHJycL38SO47dAGa1tbJ/Y796PXLJJrdkrzTRZXzrQz+ZDMQDlQ/fPbpsxDNl0dZoGswTe1Eys+JbssQRJUiYggAENksowe+MemOljbME8amMoEi97zUSxxMW97BQscCTvhQM4J6gkrVq9o1Xid2sglo4fbA9pox2ZHBwAw9T26kjjlFLGqiljiJaOnJmBZombIYkjxXI/U+g+memSWVtTHfle5XqameSzAFqOJ7YjkZfbWRAojdmDDuDhgR3HoegxPuVewf/9b4i4NHYuHxpwyyzat4WoWo5R4+2E9qQSKQPKNexY+g9e/WAZ+Z+hsbtBu4tau9ytOssEezX88DWqsXuLBKTD7bHAYqzeJJ9R9B69KlyC9K24nsNfqo1mrq1WCM6iMSoI5BnxAkeMOrsR7jscj+QHbPU6Hop8wg0Vw8hOy2Mq6mzSMV2evdhaeSwhARo4gvnliDgeXfH0GeoPMXNht7dCvyE6XU1bSbt20lGpQkMRiEEYmeAuwId0x4sq4APZvTPTXHKbN5OiGKUMrPNY/uPnFYlils0a7yO7KsZZH8ftY+3g+QHb9D9Ogu1lqJYuQXdjtwr2Px7UjuKUOobMcbLD7iyliSiA+QPf1/Xv0HbPzI69l9HsdTWWZ71iIXNXY1VlC0btJjzXuFU+nl5DsAB69ALfMtpOkj1dfDaWpDWSaxC0pKiITeaHweEZT3VIywypH1HSp5FO60slOnPNcE8pM9Gt5f1LMdaUY8UiYkIDgs8o7kevcnoAmsPYi1mromw1aWeY71LgVfGIwKUXKKBhSAQuO4z00Z7Cb9Uv1KDUqrzCyLdaKV4IZYfdMUJYI5LEHyQyE/YmMn646VNCVrTxoUttZMjXJJFalVRnniZmH2uO5LuVwF/bv69AE8HvWHrzXbxkrXpIhb2tZzLIksYMyVpXKhmm8V8fD9/T69AHVuLV7LW7ueGnG2xkH5f50saoyzxtmVvJySO3YsfTBwCcddDBS4TdOq1e5vmdo4pGsbZ0hBZ/OOD7V8JB3Bxk+gI746slj537l+9FjS6e29LUzVrAqx0443kkprJgvd7urMq+JJV/v/AOU4x2z0qbcIRo92yYI7kkEOunWzHVuECMr4kMqOFKhyqjv3yTk9/RQ56BJdlDamXV3PyLCTNH7MkkbPEfqcF+/2AdzjB7kddDH05+2M7eDIzEyRriODJCBFOcYBAJGe3TRJmdUpsdxyKaQNBY/su0MFghTh2gVEYHvgAAjB/fPUaGU9y7IqfFtihL8UyWkw8kvJBDFXsZJaM1kQOq47YZv1x1Bm/aG8anWa6Yo6tdIa6a+J4ErywK6O58suGILhfux64H6HPSp9GD2nievVisWo1rMv/aIuR90bgIkpJ9Bn1XpvUXbLrVX8poAqi4p8p/JvFHEfZhlO4A746UGCuabM1ZvAw+MjISqyFZZMeQYjv3C9hgenr36k9xZmo2qs+51859n3ALlcGOTxLPERj7CfE5GSPT0z00uYz3LrfLkYd44fOr7LRxxsoiwDlkAY4xkAjuT0GuPKleRKosnylklOImlbJZQcevZcADHpnoAKx0rcZgnQgzqD7izKvtrkHso+gwAP8elDkg/27A4R2AMcH3SySBn9wkeqoTggk+hHXQcb1SpHBX02019n8gqrJNSBcEqC5EiPg+IAYgjwyOmSlzitksNaSW3an/pRTV/C0RF9wYsPEg+I7d1yf1PcdQThNgIs5tq5gX3SY/Fm9crjywv0x9PTqR89rx5/HLKomiiPvey4XDKO+D6HA7Y/yPp0AVLkMccsk4ZWQZdsszeQ7L/E57egyR69SIFC9rJDVnqKknsWfKo7TKuW8kyfp27/AMT6DHQSJ2w5BYFfR370XtS6eX8XZe75eXgi+y7KW7d1AJ/Ud+mDCrfRujZsN+8UUaVCZ40KlBH/AKwwLM6H6qBjA+vSh9C1B9q9NYn16RZQSqZLiEEqr4JbyOAB2A6kghsTvLa8HWM0a3iCzt5keYKuWV+3lj0P75Hfpo6JDGkEk1m5GCAixtFDgiR3yyEeXdSBgE5+megDKa4ji5oLzeEdhItktUIAJlkd6oZSyrkg9z4j9M9MdkyKv/Zn03rqNi1qHkSu6VdqtdzDa8ZYxYXIdYU7Y7Ahk+hIOT1XG/F3ZXYo4a81Gy6WKQbXwR3AvtJHCze2hiyC0qkFR2Cjx/bPSp6hfXx8jqa167a+zYTYRNemJSMARPGcv5PIp82bPkhAT6+px10MApJK2s0GzNi1VlNqNbVRbkUiClMgZC8spGfN/IJGoI8s4GD1yLg+fY7Oaelozq4qlTTVZ9WbcUrKqzzeErIU8fJPJWwM5JI79NFMqzy3aQz1WtVIJ4YbEezday14LM7lkWCOMSBFYHCvEv07k9+lS6KEessyRy35r85rUrEct+w38HKqgjYKQS3iW+4r6jt+vTR4ktHZrNHb18zG7HR2Ml+DZSRlZUdmV/EFvuBIBcKO4H0PSp6nSXLEq/n1dj7VuxNmqkXkW83VU958EJI32gl/oO+M9ugCtJF7+0lp1ZVKPM0glp+Myk2APcZrDAtJIceUjH0H29NLFNnNksW5pNpstpaF38FHMcQrynCytTjCq4dfQAHH3dhg/XoZGsbsBmzWem89CaTH5LgS2bImWKTydf8AuGBJ/pMR/MnyJ+g6VHwWkzrYmqwbUxrIWjbaP5RU/amyzmSQDsso7IpPc9v06ALyPUrx3l3IaDwSPUW9Q8Z8Pxz/AFlbw+0KHJULnGf8+gBb5rQhMGuFSqlNLcLa6yirj+sjDLnwOW8V/wAABg5J6lQ9GdgL8ptrPruLax5VdpLv5Jjs+JrJHRrFs+YAby75UD1OOrNr5nz723vAVtbbpUrVyzLOEnVdgKyKY2jaYePniRezFF7qM4OCPXqqNsT1TOgn2pvSy2NmI3PiHWwsvhlkaMJlj3HiP17nqT3ClC7HdL7KBJK92n4RST3IwHXPfHqfIrjvj6HqSfpwDvr/AOPSmeNDYeWN45Imx5tjJIVmyoHfIGO/+PTRJ89fILU63D+OSohU/wBwuRbCq6JiVpELQsD3K+EYPb657joZ+Z8l9yfemucPq6jVattRp9q241mvjrT6m6PLNhJoVZbC+AyysGJUnGMeIxjoYNd7a+yG5YrFdpUM8hV28f8A7YjLsRn0YsSWJGP36VNGuMNGvlIm8gUYGV4wgKeSnA7HvkD6Yx0FmqsSiuqyq8ZIlWUxTN5ZDIp8mTCdwMgEnOOpPIM7P2zQUoi2rVKQbFI3k9ryEbJMoL9/0yCf8OlSyC/J7MyHQX5HM9j351e5Eq+5GJovyB4dsY+3t/hnpkx2N3hBm293Z1/e14jmMcma16zKyw2MHwkJMQ/TIHbue46k0A1LOKwsojKiAKZIn7xhcD/lzhvu79cj561kHyiLebV/BVllJTAUAkDOM/t0AV445Lc4tRCRsH2oJguQqZOWAOO3kcZI6AGjSpa2fB9/qRUSVz+XStvaKeVdFEk6upzgkHxIAHfqTM5KtDMBNXs3uaqlcGT7qJXnaU+DNIVDBu/bt3JA/wAujQs1fmECHinijjk/IhIWYxnsA5/1fbjPb0z1J2V2ihtbF7AsiCwa3tHXRfaTEkxVHCjI+128fL/I9K8c9GtPkX7Qrz1gjQxlAFK/6kRVHc+R7kk9+mBQA/hnTbKjtzQM8coOr2BqeJdYpE+1nbKk4bAH7HrpUQzi1aEsbHVpavHZCVY4bEUcMzsxlAlix9zEE5BQZz6HpgWwjNaCkQ1tfOpE1pl808hHCMlD4t3U49GC4P79KFiD7NWjaFmKaNmiPmErxDOARhsH16kneAMemPvxxS3cUociKqqFXZmX/UGyPEdiMd8/ToIVWEfcre1uxeitsLq76TUZNG6JIS5bCSiRCGDuJACg7Zw30INosUubWszCX/49XIIuD8Qg2caz3KUWxq7CCWKOH/u/zTBMLCyEBJFEWWz3YnOOlOwZv2yfQEP4czPUrHvlZHlL/wBEJ4lvBAThsdj5Dro0oYcWXrwWXiiiWZlWwWTy8lT78sQVJOM+GfQ4yMdQWKhzPBBr55rTa8KtlErybCdVMhRWDLGXGcA+XkwxjPc9LCzLOon8ts62GtWqzmT8i+wX8OqnkWjjbLEY9G+mW79+3bpkrWS3xZIdpsbu1FUV9drwdTRrwyCQnzjAkXB9GAX6ZPr36P1BYZbdPWvLFPBWjsWLQMISyVhEgB8g7MB3CsuPLHf69KloC9PcsXb20YUJba+3PTaGSeMwHJHgkbxkgq4H3K3de3oPRsVB1PZ6+29zWz65Yop/GSvFeDSojBgGVUGfEo3cd8/XOeuTlYmpvsnxqXJvbWwGj2BlJlr14AjR+EhYp4swHmue3pn16gaFuSnRGu2Ou/ts1/a2UTX1bbg4gR3MUPkpALKMFwW9O37ddFY1QmmNHqaGvrqNOnbQT/iSfnxuJHD+8o/nIx8nLt39Pp2OB1I2eRrUtQUZYlZorMjSsZ4vBjJhgDJjBHlgZIxk4HSg0QNfrSV118kSiUHuJU+4skfkpjc5AZf5f+nUkCvSWcXNdXAjeETMLvvSLkQ+fjPP7fp5jyGO/wC/6dMEDrM0i7HXR0YRcnhgkkh9r24wsh8UVT3yD4t5En/16XFWRcgTYT2t0yKkrWnSKRoSr2EsRRgOkZIUOASTn/Hpk8hSu6jc/hrdn2T24q6zS3blFJIZPfJIQAkZaJCRlW+o7dQLjfV/KWNA91bzlY45djYCATSRJkuoOAVBIOR9e3QOrGfcrlguSwQpEJqxWWxspZ1k/HjEKlkJERXx+457Any7A9QNENqW3HpFm20X5IsVgiy7JPB4nsYUvGAzf0h5nyAHrj69dCs+yIVKxY2fy7yyvPkirxzXze55eTH3UkUO5AGAVVBjHoO/TBiVjX6dOLUV4bKRwQSzBJkuTQlgFjPk3iMMAGJ9WGeq0+sHscU9jYSrLWQV5QieSrj2WUYTyUjJJz3I9O3UHgE7IR/xZGdTCW9sxp4sUkjPgx+09jnuAemyViD+3yebxFcyOrGKwnkzR4y4bsezY7EHI7/rjpX4hx9QJsqlmuut2EQJhryCs2UcMVlBU+uMgep+nTQtnPsyGvC8ct4JGksLvGYrQBXKtHhxiTB9R2x/l0FZ7br0Tv8AClktLGHZo40WTxfKgAHAyq4I7Htjo6F5xi8laxa95T9sWSi+IAyQTguwx2A7dBJOdSbqMbSh7RQRAR5RFXxOHbwI9c4PSxzx9QTf47AtK/Gkng0cYhf2lOPJT5hsYy/kVAGfTpk64sQQsbWK5W10itG6SvGK0jMBIoce2UHf7gpwx9CTjtjoMRjFaLpcjtKkUlX3hYaNggB9HBJZWYDGCPpjH79BreIerDIJLpkjVWnWOSPywr+mWIAHYYODnt0DRLchX2o0ceRiBIzIfs+0DxLD9jj/AB6CrY+QKSn391PN542MEjxp4jA75BYZ8jnxyfr1J4C5PZmpS7OhPBirv4zcRmDeJmRfadSo7qGTBOfXuemDMe5Ve6Scc5Csmkij91fz6zHV3wuCImjUEFwR/Epjx/x6lkvMYxWhPf7vLY19yWWI154v/ufILefchgigdhjpMszz8iaOjBGqqZ7RVJC7sh9thk4A7Bu/cdAHKVvfhgj9uPKusWIvtMcpHbIOVICqAc9++c56bOjO/kj8axrbMUUCCJa1weFpR4ygxAN9hBAJOcHP6H166XMj7l2D/9f4Y4gad+FVgu/2xLit+BtiRJKtmvKJArOxwCVJVlIwfTrAH6awbNaEZW49Faubi3BZcbDaB2WBVY1jOh8vJYwSULAeBUHH16WPUE6/Z/gym2J4q1aV6kHIF1cjwiOWwwhSbwfyUFCcHC4IHUAStVi1xtUkZXkuTRza9kSQz2FjVonmXuPHy9TkdySB6dSdss0SGDXxwbuOuhLHURpA0COAtStIxcLJ5ZAkOexXJIJHr0yZpZas7VDrVLFugHoe1cteKyVfxBFWjgj97yMRz4hlLEh0I792znpY13F/cu0rFmrC9v8AB/DqpK9adqieNeWDy90rGJPvMa+XbuQGz0FYx8y9Yzb18MQA/CjH9xqbWrAiSpHE3uGJPcGPNhjIGMjPfvjoFlskDYJE3mlkpW0mrrfE0k1xJGzZilbyLERZYwhzkp9M4GcjoGVslWJo9Zq/ZhaDZ++F9uKKKMq5hrxDP3kjL5Y48f0P7dANNWDp5Kt7a3ZtqqQqzLJSo7N5EPjVdQM+GA48sZXOMY79BW4PZDMDYXW1VoWb67o+xFDUdIlRWBwXlDfeF/XJIAz37dLGxK8tWvob2o2Oqt1KVb2J79qCwzNDYr+BSQIRmV7D4bAGSCuQB36ZE+KFdjPx64Jtxpfxtmt9fe3TwSf1Qsn8ZJIZQp8jk+TFO+PXPQKs2RY21O6dVuI9fZrrUpxGzsEEkNb3ahRfMD3RgPgAKc/XH6dAvye1Ec0KkVfjkF+dBUr3Yh71SdSA63JAcfb28st4nv8AX/PpkxG7ky/BFCtiarHK8dIuHEbKQEAHj7b4GfJT3yCM9LH0Hi0doDW9VcnsVW1l6OrWou4uNZh9xZ4GyoUBiGRge/YY+nQK8jUltaWWzJAUibxjVZI5opWYJhSjgK33dx2798duoDlQgnao8Fd4mx764cu4IfHqf2GB00FmYQONpV2e75RXLe2kWukqx0CgjkL2Vk85VzjPiMfb+/QYr3MZf8OxuvxLsobdYyyU9jYnElYEKjQ+1KF/wwpz+hPRqUXtvehN31aLIliQzPUs21FipM4OJEGYkHtnAdmGVIwCOx6XPpWoR0iPep5mhUqPcfwLFxjxyQ3uqucMPp/n1zoWSvzDL2UjhlEaiQzr4h/Ri3ln7MH9CcD06nQFfmdXNgKcYb3vHuKdUyIWDqwGey9x+/6ep6BjlAWWtDZvTmeUyfkRQqa8bHH9ZimT4EZ7gZ7+nUGSznqlaexBUrxQzxpDdhkZbDv4qokRu4yM9vE5x1JdraVoQ3Xs03rV2dcpJ2sQVsgAO2AT6+pP+B9cdSPFSBV/In9pn9gEQyqhIERCnPmSpwFAGf0J656nnytS/RYtFblMxsTtGDBGpJLFScqMgZ8fUle36fXqfiKcgWd7f1lmhsq0qe3PR/rXqeWzIIRnAJyW8gfUdMnWSvQgGSUa9NXuagzBtmXVyefuePnIoeDt6gj+Pb69MmH9os3glW2E8f5kU4e0Kp9tI66KI0yArv55zgeh/wDQdLGtGGhakASaMl5D5Fg6KPd+71HpgehyO56CWWjtZ7K33sNE0kSlUjWZEU5J8nUgfdksM5PbrkXIL1w2WV7ae1HYLFkjZkmaMuDl8lQhI74/ToIM75TBSopZ2jUpthEY4/sLsv2+Pt+6UP2ssgI8vTGM/r00UecWgmhqgLjF4LDHot7VkgkhjF/VXJ5V9mxGSSY1OAR4Hsp/yHYddMk4NmtDSlHixJdPulaiWPFfH8lYhIhRR3yA3qAcnpU0RBHboPFYr1ylZpY1ZjK4U+YUglMg9sd8Hv0ARQSUlqxxzySSQMGUKjBZPJhgZcBiDn9RjHTIvP8AIyfV7aGr8gf2e6kTrHTvbVbX9QSl7FuvGkJbODG3tsWA75x3GcdLMs3qZilmqOZun0vVq1bemdGtLHmGTR7bSBfEFhIDHKrq4YORhfNfX0+mOlj6tqVbWnioUaMgsi9r4xJQ2Mu7Vy5Uqz/zjzh2H2Z9fr+vUC5zEW2dGbST3GtWY4YttrKUUrTLcgmZ4EVs+RLQnDZ8vu7dsdAHHspdK2Ymjj/tUcU09qFH/Hhs14yrM7eR8wFyCR+uQO3TQhkme2ftNCsFKu8FiOitmaKeldt+M2SS0nmhYEjJACSOPTH1HQwRhMZRhCk9S1TcWKmtW3QMaskRwWM4mz5V442JjlcBlJyQwGTjpYu+KHktvHPHRkH4kkbp/a4bMayKncs64UfavfJwMhujoUjLJQ280tWxXtrTlq2r0kdH+0VUSIzNXcyM7scMru3iQTn7exwOgnzpPsKms2F2lsZp31z0lkiorK7rFE0nfwRR9i+LZLr9ewHUDHIO/bg1te7Lq3bYl4BRrsqx+LEgK0n2AeK+TEHHr69BSZvfpEWtra3FUpLFPsLLClLYRiZlaJnDAxOwQAny8lAOT3+nUmkWtB+ClR3cv4FvXPjXzRVatrbzFa1h2XKIsasCCMdg3bOPXOOlhpkj1N/V0JdjqN3t6kum29ixHSr2g0k32BCwsrCroquAGRWAwRkdNHmRX6lMe3XhihSmscr6a4rrbSWEArkSeTkkjPcEgDGOoPLk+qLO3r7KzuOOLcjit1NoZBp4K80EhhWNhLN5IFUlAUAQn0Ofr0yuVuSZshu9WrV5mpWJvOzHWM1WcoxNcTP4kygjIB8Qox3JH06GCk9oLWZj9Inv1DLYkYTwMoqRWQfofHAK+oJ75PfpU0bNnQG09RsUsWZLl6J6dpnajU9v2ZK4A8WzJGcOQx+uP36knlQkMGlnheecRPCJCDOsjeYLKmCSe2f4jJ/TpkGWYRO5FN4Qyye0ZYkj93xrgklo/u7gDtjGQfToF2j5++QtbBc4Jwq3VsC5PLsls7K9D4lFWVXaaKSInKlAcDGPL19ehk+R5xm8fQev1NfX7+PXaXXHUU4NdXi1lCAFIfGJnj8VDHufv7AnPqT1BuPaOyNcazLPNC9Uo6gVwZPu8QPuI9f4hvU9LGyL9VWRRJFGZ3DIBL6EMBkDDYyMnuB10MHkF6qXs678mF7siNb/AA45CshgjcGRsqSwI8/tI9O3UdB3lBKbxlDVIL/sUwEFSkUV5XPtyIfelJJdGDghAB9wBJPQNcr9jvY7C+mpqWvNZoIGpy+26rI4Rv6D5z/EEE5BHb/DqewfP+VPDk6QJNSGlNLXrJDBnwll8DkgKQEWJM+Pio7ZA6g1rRKGSFHleQI7usAgYN4e35k5yBgnvn/6eo6i/K1IpC6IttS/izM7G0uEGG8WXDDAPb1H+XQcB7X34ML5xMghJQwTgpJ4j7Sn2khgD/q+vQWwx6HY/h7u9ACIYdmq2YXIDq0iDwJAB/QjPU6Gaze8Klqr4TXKmu+2bXTNAyMPtKEe8mU9O6vgAd+3QWHYtAwbKxHQgs3onml914LVGsjAqcYWTzXAK5OB6gHOe3R0FuRqUG5xp6+2GkiFpdtagW9/b/ZLB65m9jy95B4YRyC/3dgc46BlZmsNmr2RWURgQx1lYzKQzMoVMFfPyycnvlfQj/HqDkMXGDQGnOUA2H2WZEPZEJ8gF7YVVX0H6fXqDwBVRFuU7mtKst2kPd+xUBnrxt/S8M4x4n0/4enXRm2VuHNaI6snuwGu8R95/ImMlSoDDIbOckfofpjHQaZZmsXItYCpaG57Q8CSkpAZvrkEE5LDuo/T9+uTkE7WrN+MHSZIkb7j5grnI+5hj7gQB/69dE6L6mbc1qzNV1gQxNJqvLaTWoWcSN9nint57H/P06ZX+ZWZr7KYxP8A8edbc3nxzqrN1lpSfm7S94WP6zxGfYu/ix+4uzAsWbOR6fTqDJe0Vp6FQ+pI5grmq8C12jUWYwxWNXT+Sj7RkN3znt1Bri7dEY9r2nVnj8M5ySx+jMGJGe/p9fp10Qx8j0PXhovVDrHZeX8hfFw/uPKTlMP3+mCD9OpPATNguzghDRSxreYI2IfHyhILSe55EEqAM4JDd+oKxrSsPNDXwa+CvTqziWssaRO8RYMzOfI/dgZZic+oJB6WLJY/SJZZrCwKktqRM0awbw9tMkgjzAwx7gE9SWXQAamUamePVNAK9IyyzyVKrs+Z2fJjiU/cZD5L7in7VHcY65PAYJKkt2zDNXI1y0ZvFhEgbCsvh9gbsQQTnGe/+HUnvulPcxVRBb9tGoT14/yjbZQcs7+K+WVAbuMdSBBT1S6qvRqLF78tuxJcvXpZ/cnnIb3GaT6dwMDHb0HUFYqrRuBf3ppGVrkR8pMwyxo7KEZgGADZJ8gMAY7Hv36gbJbkcp1skH54qe85nszwNlvArgKGYHxyPX9M9TqQssDpaa/kM0NaBLCxLXS3bkZ4WRxghsNhiTnPbP8Ax6gZ4oqnWUIt6LLVDFdnUPDDaB9p2ZwrCNXIBzgFVx6Y/fpoWZrjTo5o47W72pdK71yKIP2H2krZmmJLA/f5E59e3bPSzQqyVkqsutbbGPP9wlNwPG3kW/Jc+DHyyAvp3A7A+o6ZPLQXaktqvyGCvJ77wMvjZXyzC33EuBg+DAZGD6/XoOOMMWzq4C043aSJCqMCxQAM5ZnwMliM5x0sMbRn+2gMPlYkkZkhIkSasCZEVWyChI8vLIwCRgHue3TAz0rArkMMVGjTuWJoYYZpa9eCNAksoid/JEl7n7izH7z6n6dSLT7ItcXkjb5l5rr2TxtUdDqYBK6ECYy1yZCZCVDGNnXxjx9oOQTnpkxPeNGpO1+GvNK00tSui+xaBCEfYVEbdgB9wPoT26rT6itpWhC3iU2KhXRfciUgBnP9NoyhAyCM9gM59e565AIIErSgqASpEwACj7iAQX8T3JP+fXR7niSIY55ySqzu6zlPT2lB8XVvLBH7ft1IwCL1kbSqrmzhHmhrmVPJCQz+12Vu/fGM+h9eoEGb1o/EVtfO9iev/wBtZWR4vPv/AFoSFk7ucnt3H0/ToKXCfIl1NynK0ykxoyALBNGPKRsv9oJye5Hrkd/X06jQ0qnzO7RqvJVWuGhtSydlcHLOmQ4A9DgevU9Q0a1J41DSwK0zRBzHJJBMcuGzghgF+3A79/p2HfoFORqTX70FGwRdX268smddcYkqSF+oOfFTkkk5/Tt0dRvlamew6+rek3GvqoDe17NYSUj7XnKmeJu3bxA7HH06sj5rkmaLtU6q7eaxDRve7+PFfZkKQx+TfZ/NWDHPY9sj6+nSx9AZGGGwGndjHJAI1OI5UB9vBHkWIzgkDIX07dAoXLc1yeOvGiOWYgSBY4/B0z3OX+0ZbBIX9OgX5GhcnvTvAIGhWGCNWNm1MHABcgZTAyzkg5Gew9SOuSRP2tKltKbSD3ZZVkQ2leQhCcsMB1JIWRTjH0AHbPXRPGgmMtr7eTWbq5sYdPYbUQmLS7eCNx7kOH8TM/bLFc+vby/w6ZMMszw5qRpSyRx1QNUq26jt7ywxskrSAAEyAggDse49OljflZrEFaQnYwCG6siAEo0S4wMefdh3U+QK/ToJJmlhjvWrBsl5GUBBEyuuCuVCg9vLB+voOmDkyr5NvV9br7F6siW68lebXy0dgZJI5J7ZSt/o8CFBwR3GMfvjpdpmjCYz3bZhP//Q+EuPtDFr6Kx1PyJRajikUw+cjI8fulPAAHzAB7gZJI/x6wB+kcbsjJMur9nYUZdjdNeRTZ0tQPMwECZaSKQqGdJmI8nySe/cgDpUePypJX9iWhHH+fZVPftQsHrRIqnEWJAWLMuM5Pr5d+g7ZZghBT7iX+46mOyFoPsffNOCzH7luUxL5s3jj/pgAhCcAD0BPVpxjEM5PRwPa6d450S9W8WsiK5SsOhk/KDJj23EXYlFYEZODnt3B6rGjX4PWCaAaZogVmaOMxu6CGaYYJRfEr9oPkApycj0PSxq+PoKm1u1dLsYalxpIeL34YK8txrCx1q0j+cmfE4BeZl8HVDhVAODnpkpWdIBpk1VKSKGJthJPSaOeT85biywQJEquxbA+9yQDkkDt3Hp0conXGQA+4bEVOGWql+xupVgrzUYGjitTSRjD2DKQUC4w2F+3GMAd+gjiwQgmptkpwbXcRKVlsL+FUmsRwRC3KF9sPJ7faMBgW+39fXoMjm8npNaJYo6cWw1Wutym3ZmLbKzJVkZxDJHHgBwyt7fkxOM47j6noNKstRhpFfW3YJpdxSimve/eeaWJ3m/qIsCqq5eNVby8Qewx3XuD1yKnuuk1Wg5XWSpPNsvxpZbGjQW6wVp7CYYzSunkoQYIdfVsZx11oNq/MarcUux9vk26qf2jkMPuWdZdj8fyqdFIGVYHKefu5BJkDA5PZe3SxaC3t7tyTTNJBDXqS7l6cMcliIPUMTnyLMUBCB/tYAjsQB0yVTOlGGoMOz2Cfh1dO7ktUEKWYlzDKYli9sMjEFVky3kT9R0yYj21v1SKJ7TwrTtqkwljWIyUyyJn6Y8cnJUD69K9DXLXizQmeKK5akHvNWVascTqe4JwBg+vp69T0GuLqR7F7PsYoxATPJHJPFPJ4B+xBw7dj+47d+ml/mUeTxk/aMg3mz3UOLMFRnmqt/9zzF/NiwJzGCcY9cFic56YM1xp6wnUp9pW3/IN1+KYtbVgKRmZF8nllhMLr5qD/A9sfXpYpfcjNWYh+JKVe7wldbWmkSvJsb1iJLBPu4yqff6AgkDt3J/fppYrcctsmnNsY7Oq1kE496aCMv7Mf2gB2HuMuO4dcZxn9j+nSp9kL1Kd789RDVkjqtFJWirO5byXBP5MxPePyP+n09OljnvF69PHBWiqxy+UqoIY7Kqvl4Rt5ITjP8A9k56Oo3ytRctChMkGwsX0VrTNHELyyIx8EYyAMjKMjGVPbPp1JWEHF4ZfzkqrajszCRpYapVSQpXBkLKfEoCML6YJ65JyWyS2bde1yO/rmqy15JXikoPM/twyqUIZ5UOf+kyYJB9MdNFZg2e0X5ixihhXYCEQhW95exkQn0K4GSAAP0A6CyZrh9p51180bHFWSM1/wAohUlsSAggxnP3En+X69hnPSwNAuG3Uowp2eK8UDwyVULMc+RATsfXvgY/UdMkAeZR7E9adkYzRquuW3H7JCtITMXY5Hl4keILZPfrkXF2jSu7HUTauLtf14khhhRvdRJIT7kTBmIB8wAQc/U9dFJx6Lh+01b8tI9tFspLMVlvyqeqgRikDBh7gLdiHXBHgfToNJyhrqGOOQJIRGLpb2vclJJVfvPgD/JsDPb+K/8AHrkWLdKWpda8fyv+5Cxr7yMX8VIPipyR5A4/Xt12LkViWEPPCfGwkrD8d3TLp5fccNk/rk/TrgYAdlprtuTS0k/NsbJUlEr960MBHtgv9MYU+2BjP+HUizLNEGbPV6jSWaGn22NntVDJXkjUhYWKGONpMnHiRnAU/wCA6kpFtZ92gW9Xqrde7W1U99Trb0gir3XdA0eV88MvfzXyHj5Dv+ucdBdrZuyU2s1NmjbBIY51Mc2tlikY1rbSI/siSOJwCVjxgN2z3+nQXfIOr8ZggiZYPYlmV5DJcKGN17BTmPB9B9qjvn16Y0FmTOdcGTmFgWa4QCvM5uPGrlCtiJvakwv8XH3qPQYJyD69tGKV/wCzPoCNIJGvpCpoSwpWl1l1Y2EdewVDKZ5F7eHfI8wR5Adieqo+iEoXVXpKkyXZ5pir0b024eUGuQoMzA48GkbOVJz9PTt0EnElu5VjEdOixpJIlWvQj8TK+VAD5jVSI3x+vp+memuOV2TzkEIP1tyW4LsFaaCearbk1lqvrkArAqhlZA/cEADGEz+g9D0GbxjN+6OWklrW4A4pitIy+3dpeLBqr4Ce2sn8QB2I8ex6WPpK9GYIGhDZlrQuitGvm1aFgqxlwuASzfcDkZLA5P79LFjxtBT43sKu0lWjt78lDkOuCtX/ALraRZbUTAETyIcfczNgxkfQdz0yUnGGuWnXrWK1kG2z+7Yo2qBnE09msqlZZHb7SqBnDFEPljGT9Ojlk+DhFzczSUHlrR/l29YIkpRv/wBuadmzKDGIFjkUe2yk+XuAZGO2c9AM0ISeSRpl1+gWWKnXhiaxs2mYQpD5ACOP7O5VSf5H/PoMjjdOY6DbFjXvp9xcqPaWeex/bTLTfAlSMeysiyMn3RsC2MNgH656NTTN/Muyx63faoSTbCzWq1VlihnkmMcUstbwKZjAKvkZZUPfvnPbqDzL/F99fg1d2lxqCSxt9naD7O7ZnrNFXnlVgcJGF9yNEDHuf5kZGM9S0OLNFqzVoaSZ6WmqpWpbSZvPSE/9u08dcecq+IxDIFXyJQ4cjAHSw4VaVi1JyZJPGNKmnpK6Qy1/CZ2ZWZ27D7o8ktlT2b9emVTDe5dmkTvbfY7T8yrOGYsDHJNkAxBPCQMhx/U7ZVj28fp0yM4yykTyu7QJYMXt3KoMfvAlg3mfQqe3cd8/QdLFkqqEldYErUpEaSKSL8uV4fJTh8uqjPr3Of36BllYVN9Y2Ay8UbS0wIUjNQkyjCk+PgcNnI75z39emTI5PGTmTX9ttI/7lVkhaWteryvBLWHdJPDEaP7p79yFwBj69MlctpNCZNbhv1tFo9VyKu1eS/Mu2kiqYhkitNJGsKSKFOYc+Xme5+vSnfMBvH1lszYq7jW8iChTZjmrWYI3LBjhHCrn6kqSPqSR6dOMm+9o2Zw3ZljlkaNYfeiKAQyFT59suwx9pZmI7ZPr1WH0lX9SBdWrNEbEYttWmXZUyxK+zPEhVCcH1Hkcg9uoGytHJPXi2JjjjrsfGCy4VBJKIRgdvEkoAwAx9epFFv1Pz268Elf/ALuCAsXhpRWwuJJ5SD4qXKkkfRR2bP06gbCdLV12obiCa8kEU0kmpgEnhCQ9ge7Egzn7Q5OB69sZ7dN8kx+SWoz8kF2HXY0fskC3UjSSb2x4Ocjx/wAR3U/p6Z6VNLvFCCXYY/tkiRtDkSCxO0RkVlI+3xbHmWI7kHt1AoFJJ1ciJYGniVDHB7KlVSXx8CGz2/w/bv1AuLpBg2WvYyJBVmy0plALMvh3UkE5BbpslZkaqG29mxBYhCH8PvGuDgrL/wBSI5/buP06WGGdKsIz8i9iJl3UHiY9sEqzGPGGlRcwu47H0BTP7AdQVyvyFD3EtKJPyWr0pImhnMi4Vm8u5AxkjBH2j69dEaF+vptWsciT1AwKmSCzZQEKpIJxnBAfxGe4yAP065PA6r1a8VeKeshCyhgsEuSCoOPIk9yvUlj/ACk4kcI0Df8ATgPiJlB8WQr3yrnHgPTqNBpX5n7W6y5ekfYvalMOvV7M8jACWeOXv4L2AMSgYU9BR5FrtlOG/Tu2JK11pq1zXrI1VjD97xRr7hkAbHnGQ4DH9iMenTRWLfSEdy+1eam+wievCF8pJ42/oSFft7nAKkenifTpUvFslBMWZLlxXsbCt52qYULFUBQ+YfA7uchcevR0LTiamb838NeEk839y09NxblZHjeNLCiVSPEYznLfr+nTSxQ5nZmM5/8AHJP7FxSaAk2LcW02lO/JUCxCOcbOePMYHogXAX1znHQz8yl9tbFM+hFrrsFg2FxfxbEbGJqVpCrsrH0xjv447/oegumPkVeQXtNqpakM9lXe+whqQQe48pBwiqyjuuG9T6L26BdpmECXTDRarttzMn5Vgka/T0mV5vc7/wApD3J8Rnv6en16OhWss1hh11GNL3+4Gshlt146ssjmIvSiZmVGWNl7hifEE4bP7dQegdghqTTrs688vtLH/wDctOT/ALZ0bGZWjA8cuw7En7fT69A6sQzxayujP+OTNG3nWkcsHUuceLtKSfEgnA7Y+nS5Z8op1Y69itOiTKAH8Y7bfyYHv29HPie2Qe/pnoIa0gCayWVERisYZSsRaBQqn3MqcgAYUE+v06gnigy4kVjYVtYW81hT8uz7RLBhGfJFAAwAxyf39fr0C2S+ZWW7UW5fZ8VtXrvKOu1VvFTI/jI0aR4I/l6ZP69+pFS6tozWLEEp8VCF1JwWWNsN5+I/1HOO/bqBw/C6pWCNoGMcaysz4bwfyGZB5E58gvcj6fTo6Hvyia68E9uGOEf9xKFd1dlVZFVPt8CvfAGO575Hr1AwLu4dalhfCGadJvKzJMzByue2GDZ8lb0OceI9D03qLtFL268/F9qLZjgkllMFGHXSu8o/LVFaNjj+TeWMDsF6WKwbhDXlhStWjSE0YhUIjfxQrAoCr4/cO4XxH79NHRQFhK09aKGMF2DFQQCOyF2T3O6llH6H17dKDREwjKV7UcbRRRe7JIKjeZWQDyVVDHIQ575zg+nbpsVBU8cU348l2VGhaMvLbZW93yVvIggHxIwcfU5/bt1yMCNtVobKzr9TS1wuo4mmvCSQe0iSJ7cMskY7sA7fxGOpK7JNGNcX3NTa/L3LrVOz7z16MegZ2DGP86h/MjtlsLgs36+vTJiFtN83nRTS0BZ11mysdEmTzlgHksLTMfOQKvYjv9uPTJ6WPpGDa+iLaTSw1LVVFFYOzWZ7CAMkDNlfBCx+73QASvoM5HQWYaV460X5MkbJ+XFGZas4AdHXxKF85Kt2JwPXHSvUZ5WovusN8zwTWWSGIvceKWMlRGc+SYTxGc/p2Pp1IpX1FmVK626lmHa1xXKiOezEXdQxj7EKW8lJ8gFx2Hft1yAy8jtrT1WgazUcQzSxR2ZYvsavDIpQS+Yz6Me4I/x6bX+Zm9p0/UwtaqJoGCR24kAhkce6glY4ckAgORkkHGB0F42EtU1qASCCwNjZ8XdHlVTFE+QfJmPcKQR5emcfv0sCmycu9YXrV6wzTwh1k9xiWDHP+kDuVLAgZ9D2PUC4Kt2felN1Hf8ACiEcMr2K7N5Vy4dvbYdz4g9u307k9MkCyzyV93L7PtittQ0NeWlKW7wu3tjC9gWQnHpkj06krc4tWhqFJtXMm0k1q7B9SYvLbxmCMGWWnYP3IEyQfBwcnsVz++OgssY1YGqNCg8EicR1g0ru5dQyAllOSewwMl/p365AKCzUd6SzzK8d0x2WijkJVy5wpXHbGPRhjoAluvDE8Zim91V8/KKZQ6tHjOCAzDvjufT9OuxcD7C9BWghvL5e3E62JKdRfuLuDCoVQCc9/tHfBPXAwDLGg/Dp3uS7opTq7BCE1kSsxLqDHGpZP5SEHv5D1zjHXXUzTTNacEU6IMUO042oq0olWFdZZZYyIkjHZiSfGQMP5AkEHBHQWi2So7oXutWMVXVi5HJb3NUbhJLJCRQMZCj+U+PbDqewUEls9ugu1WaxAsMNiS/Yh17V44Q2FgaORI38BGpCt9xBOSP0P7dAdgzXm4tPQZxTjuHxZVpQj3BOcp4p9+Q0uPu9QAR2xjpkyXufZP/R/nj8c7+hzqrtf7VsJNZY43aNKavv45FllZ63uRzRiJsAFQSCzZQ9j1gVrx9sxvuaCiaAJV17yNfvT7RC6hJrRWrF5hQuS7HuPH+QLfcf26jqMecnmmtHsSNIhm0lGWWCQvHG84xDHGx8gyR/aZVH+k9s59cdTyBlbBzS7oek1eut1rcG0qpIk5gSTbXwsNiSWFVlVfcz5AQucoQRhvoelTSrKwUKQPQzGx+EyPcMUclGtcJPjOkD+bSKMAowyW8SBk/cO2cMlG0rR2i7WvSvJHTkvCRJShrmuysGCkhlPbvIpHpnuO4HS7Kxd43J1gihWVZYJ6wmgbyeetMEYshH3EeasuQPQqBjpU0R7rKcVKsusjhjhoqJIYEQqZXVy33EeICs6n1P6d+oPFb5Aa/aks16+qoTL+RZlbXWJKhKtAkPj70jg5OQoC/uSOpK/JM0YSvt4LYipxVozLXqZna//RDBmJJKRzdvt+uex9B6dWR8+xu9VlCGrmq1rkC/lQCa8ywX7EqCGazOFPi8wyD93opPYH0PfpY362nzO46a27lmza0fta3ZQfh31tMFeS+ls+TH7R5EIoKso8FBKnJJ6WDjHs8/GtWkGs5JDDeWKN5dXXnHk1ZYpfdjjz9hVcgEAnDH9R0BYh1CAvQ2tQ+xfefjV7kTWYdzeRGjVrHYtFE5yoB/0nshB/w6C4As1a7YsLUuWXHm9erPVnlUxSCph3IESISXwCx8Qv8AyjsemVTGZtmxSIPytiH2FmKNr+rqEa1kHiZY5Yz7jxsCcAHy+89wBgAn06ZZK3Bq0YSTXzqtVrFpHaxOXYwSOPdjy324Khc5Ge5GR6Ho6jXRgv6uWYpbT+pYqTMJKrEeMqqpYFWH6g/+nSpYLaTnZSOxBJF7jPKAhl9s48M5wfuxn07npoY6MCNuIJYYLkUmQoTMcvll8L3BX9wM46j4i+lcU7FVtZxW1VdIq7N43mmkLf1pZAZcuPQ5CgHHfPUny3J7xHwMV045r6sRNO8Kg2MkltfNVdLJZhhQCAfLHkT2I6BvHLfRDfTqiSSc++35q2J469eNUKmB1/KZY0xk+Qx5E5P6dBv1Wa0IwUXFSw9wFpLBRpJnjCyvIcjKlg2AwB7KelR8llXV2HEauawAdI4Y0ACEr9rMRjxCkHuT69AFa7HJ7X40dOK34v79eu3/AFDgYbwJ9M/r+vQVAIhcVNdPCskEYZZqlaOsgreULsHAftn7WUnI7nufToGOMU7VyW+9O1TorUxDmw0p/IBkmj9tSPT+m2B2Pf8AX9emikWycFakWisqpXkt6zy8vJytbxKsidmKjswAAySe30HfrksiW3ampz03oxfkyWTJFSpRpHExnYK5bzk9QBhv3P06XOgauxs2IbVilKYbMJFe7ZXxyrEt5sHP8Suf8u/TRV8koV4KOoqRViSkMvtTW791C0mGkwjhfuyXJ7faT44z69Ax0qkOk1Wzrbe40JOvr3i0r62fLzv7TFo5WC/bH5En7O5AP0xjoK5lqHaKG3jh1W5baw2mTX7+Q3LfuOSsN2JAXXxHj5eZ+7OM5z26CyxrNkY6fIrGv1nKdNr7sUNLkFerT3vvQ1Z5Ghpzi9HHHJMjyV2E2Gb2GUyAeDeSdupJLC7HWew9MsjTRQobEsHtK4kZPBX+7vggen+XQAGiuXJ7MNOgSfeEgWzGiTCH7SyOVb/E4XuW9B2HUHLLNG6MdxqGi11PXadHsbiz5SO6yeRlklXD2JcEssYPbGO4IAxg9BXLfWCqdRPXhtwXJ1vTSoI9jctuXLNgB4z5k5UAA/8A0dug1y1kGR62TQ7WnYqudvr7Z/Hmps3uPEsfd0QuwyO/2r2OPqfToKNrBd2IKS1uK72X3YZJTPXrJcuNeeKpegtxqTMIQcF65GDF5fce6kZxkFeU9CLVuHdFaUNHYVtjLcl91Ymd0dVZvtYHw7EdsjuQfXt0yMsZwybYcxr8Y5ltNles2b9Pi1W7pdnrtNGfce9JKs1hJEk8ce0FB75z/px5dVvK+sPnHnf+TPrCtUazQj29LkamltokuRvShnNhkmrpJGG91gv8X+qnB6aPpH5LBoSS3aHg9a97819MeFjyV52lyB9kAGSwUfc3j3/Xt1ApyXnAnXgviRhJTnqUoo5XLDM0kgILeLHP2AtgeGScn1A9TklpjMHR3Szc1lSrPX2dOjDq9rrYY6v4GseOLyiSX7YAsY7KpbyUsPtbJyQSCsXbS0ExVr+6kMUqSrQZJJKgt3GIUSBz9kgU9yCRgjsc5GR0yUizPD3QlVuPdhWSSZ5ZF8Y7Ef2/03Gc+RAHb9MfyHVaa5Zk6vVa2yNWezro7k9V1t05ZVRVLIQHR/tJP2+gJ7HBHcdAxvFy5YjjrR3rzwqarA2mYeUHjIPBy5ABKt27/r69B6gaMTbLa2JXmZaFDwrR+yqutqYn3HKjuMJhV8s/t00qY33K124gOY5xsZ32QNWpZDfmVgsMyTrj+EgUeY8fLLN3UkdMM6C2D1g2hhq3appzVWiTa0omgp2aVA5VK0h8VYLFnMWcAqgzkY7evVeaE8o6ecVNYlyqus3+qLFLVaRf6ObDSDHhlQqqcKvqoPi2cZ65O+MfodxxeWeCvR9ulu7ch1Vm3rECyWFRjJ4RtnxXzIz7uPuIx36A5UBd2UsxlgNa/merHNbs6lQnvTKyhBI7ort9hIIRPE5x3AzmCyZFwLJTht7GxsS8mvihoi/ZfyZGQkuzmH7fEsw7L6/4Hq0XPm+dvTnM8m0qpVo3akqzv4qbVcxBBhhIWPl5ebEd3HYDAAP06gvXNgIWpoUhFevKY7LeMVe1XyUL+X2l+5OCP2/x6k5+oCAmmnr1GsoYZU8YJWySgKD7lA/f6DpUsOk5R2NR5UWSqGMgUyqA3Yqe+T++O+D0x0PDjsGa7jXtflpVpYUsR5b3qchLLJBF/UIbP+A9Ogpc59kJnOFeTa6mxOBmb2RfigYlokVVYEdiSpLeIH6+npnqeOfLVN42aO5Qr8Vh2SzCGhRlFuXWM39fEDhJJElbALeOSVJzj079ummTf42y7dGMut8xyxMLUJHvrZOP6mPRiM4x+w756q9Dbq/MkisMgWCN/fesZa9kKGVklABZO49QCMY9euj0BliwlcFZ2zESsqPKre6gcKgU9sgnzGQfTrkXCmg5L8gcO5PZ2fDubNx3jG41Fjh3NOOmpTurslndvF0/PgmFeWFW/pWYGWZDnB79ur54sqwTEujgrHawRooeG0gSvBJk+E1Y+cbZcsWYLnu2c46gZya0ExUkgr6vYbug8Rhi987ON2+6T8e1/UyzH1+/y+vb0GOgZxvyObUcAM0giNiFgje0e+Qw8QQPp64z9OgGVfSK4eL2ninUmVFKKZWKEg4IDqvYle+G9cdQJ6FC7Ugmr0JmuGOUM0DIR2EgAI8F9ceIwDjpopmt4u62GS5cmpVY2vzyKZJKsZDMin+mS7nCoM5Bz3x6A9K6lmv8w9s62yrUGqyulsNH/br/APaT76s0QLxK/udi0K91fIGfXrpUpGmr1WIDV5JJac1NY3gs05E/KiRMtCVAbP3MMDv3/YjoLIL+SMskmWdkBVHyxPk4LeQYfb4579ci5XgaWPX1PyWd44mzanmOEXJJ8wTjt/8AqR10MBbV06d5bGxuy/i6arE1pYLDMJrUidwAoPdBn7fTJ/bqCMnkqJL/AHFNpHCawdalcSvKZgVadnwSFxjCBQO/+o+nb1ZK7GK6bsp+2VKOzTZ4kFizOy2Y/Bwjq+PH1+igH/PH69LF2xrD3RJlbfqrwRa+vbpVpHoW1eSxJMWXBVslPsdQe/j5D079NcgzbPtr0i5L/ZFgvzxTNRNZEkgjgnMXuYwPBkP258j+nbpUY0Znh1umM7Ubhjq4hYSWc2likl2RRIHfzE0SzDwwEGMFlzkHqzWKXJZytDSF74Q1G+0+o3t6h7Bsw8m3Gt2+vtiYNHYn2DTvJD7ZbEKgg9jlR6gHpTQrMHk+GbrsZbq154t3yGGqXYRImqAE2VGftb73wMgZC5PTI15yabU4rVoodtUk1+okWsf+6ubDcq0c0xz45Eb+cjgsBnIGcdSCqs8s10aK+lpVbqywMs9idWuSSEMwMjnDJ4SD7UYdu/cEdLF2suRbDWF3Oy0boZQv4+2qyIk0ewiAYGDLkBXX08j0AyuUdZPbWpPsI608etV1juK0KmWGWRfFY4o4wFdYjgenp6nt0agtXL9hBt7FmzYBmkeH8WRCSsbRYySvjnv2K4xnPr0qWSyxa0b1EppAsccZGEgWSIPJCI8+ShlGR5A/cB26kFlire20laQXKhaZVDqtZgU8pZD7cftswGG9Rg5znrksS5V0t2nSNOWSN93eRthfsXmYQQ9seJ8SGKJ2Aycfr10UrIsTx7fUVK+mvxxxmYGM76aT3Kj4bywSvaM/XByB6Z6ZI3Qu8lf3IEkDVxgJFZixHJI4QmPyDE5yB3J9PT0PSoEleKUV7FeGwtiJAvuysrpHG0p9worTYXOAfID6HpkFgXa20utdluQg1UKpSRPvdPBgT2QZHZvt+n0PS5Z6tC/u97Pes2IaCkw3WSu0Cj25SSQHBjJDYC9zg/TAPTIsy0GtwaF7Ya2nScyQ6j3ZJ2jjEQqeI9tV+xgfuY5A9f8ALpZUVsTBWPdR2JLLLae1DBH+JYawF82YhY0VQsYVhg4GP0x+/TR0VnuxVYhZ+wsMe3FMrKq+OR3TAZC3dfT/AB65OeSeVtpJsGUe1HBBGWkghEQKzqydzlDk4HbBwf8A06A5INszRuxWdESOkv5NQP3VJ2yWH0UEAfQf49+lhwzeOfx2Gw2jlootRTnjoGCPxrwlLAkAkD9zl2J8s5HoO3TRQ5Izfh+qg1nyDy15/wD74W3s1+Q2HrCSJDFsovyGUB28srnxOOx6CuxeMo1ojW9Q3nsZ69yz5VZvdhR41HjJG493H3Dt/HB7A9Sz8y79s96IafxD7STPJ7kQAmiyBhy5B9xVH8sDA/8Ar9QaUK25q9sGO0zCYKYhYZVVWVVPhgsSCMnvjvnpbqM8rUhSOOspnqENCxxNHcUq3iYwpSQDPiCe/wDj0FYwzeF9apFxzJBBQDI8MxeEM5ibBjkjlGcfd2C/U9SB5Y2f5h2kBqLbsWnWxXuPKpHnJH7bLIncdxkjBx/6Hr30KTJNQQlaIXSkjT1EnrQRqJWhCpKpwIz7nllTgg985I9OpLveLjMGqT+zC1eeJHZvdiVm8Cnm/Zjjug8hn646WF+8Vm2s1qTXJPXMf5YX+zqxjdigP3SBUOPoDg5wT36YFGQcsU0+wbb7IvZvVwlStXcj8eLxchY8xlfEsCTjOCO56A5IIv1pbr0bmrl9iShI877Zv6UFaykuFiVUGZmJGB6gD1PUi/JhhDPJKM9ilSn83/vGnZtzRhibwaaORMzQk4z9PoTkqPTPQGNaKOl3UNV9PtK92Oa1r7Fa5VEixyrJJXZbcYaOfzWVfMAsrAqw+0gjI6NCxY+Qbn3QtbTdbjbW4Lew3t59jbkWKCJFtWnaSX244VjjUO0jeKIoRf4qAB1J4FDaX4q8s0utJBmGYoS6yOWGPEBU9ckdl+vQSG9VBSrxy8g3reEqQCLXpKUVdfEU7jxQ4kc5/wBGSe6jqCr8lWtC7Zg2OymXa2FeGmGWHV6i1IzdkHi8jqCEDgH1A7DGPQno6l3jFoIQPtdD+R72xrXUi2UZNg10JdLCwgN4yIGwWAIww7/Xv6dAy1jYXC8t7R3NZHX3kDVtmRWelXtxxnXToXf3xNPkYdoypi8cd8ggZB6CkZXnh2ijd1n9qnsw6nax1a+vh9xa+wk94FpcMoRo/LKY+me3+o9Az5Iyrmtnb1tFSqbG0lO7yZpKmur1WfLQxSCS1IknbBVcHxHfvlSB2K+SZowGJ93Zyeif/9L4K4+0Gz1VGLTbmzFx2uqTasaExxTPDCQhC+Sf1CMeLgnyAzjt36wB91wiyU0NUcKmv0NirKtjXyWqVeOxDsdpeEk6IPAMyWGHuORIDlWwMEf8VjWrLQDDGt6CKsJJ47SFTEhVHiDQ+kYIGO6qAGxjA7dAzxSV/YE9SC1Glh2MhSOxL5ucoWyEOT45wAcdhnqBsiaMStJBZRgsL+RFZz5IBJ5CQHt4t5E+K9+wH0OOpOeMUZFns2IfzDXQVXZm/NysNmu38pUZAGisIPp+3r4noKNpWjMXvx2UjzsNdrSfdQvoFBJx2Vs9hIexIH8vUdLFmtpWO7BNdJLM6qxhjeXykYBmdV+wFvuPj9CMH9uoLJk8rJ4RTbmeTxlnT27LvhyFbHsrG36K3cqP1GPTpo+f5zJcuelEC46u0ZJTLc857sqz2zfYeMHn/S+3xVgPQKUA8S3ft0covPxmCiXYotOnsV3101K5Ub27Fyv4flRGUlmkcdy0RbHbBAP6evQLaacQGbHZrxtCsaLtaNciUS61GaZGeXJBjkJwe5LYyPX09OjijK3uaAn9mvNY/O/NWehsDPflFKKKQWXkiCMXMzfafLv5j/T2AHr1B7FevW1YRaSa8RSaaR4qt5YYw2tn9syLPCTjyMgOFfvhu5HUjipWIkmuRr77V4L0iyG3YJdvcmX/AKZzgd8A+vqe2c9MrGAzjNackOi21S0HS/Z2r1Veo60VjgkmqvjKzx5USk9x5j/6R0FkrnfVLFOhr0rLJET7kpdrNNso8IGWMfjnywvkMk+vSxpNVYJSyKtmCxTkWMNHEgKQrIR3b1IGQB9vofU56ghlYOWIhZ85RaEcYBjHkPEKFPp3wf8A06kaa/QTttcrzA6tWjktTyJURSwPiWGW9cDGB69MlayzRhMx54Ns1VdA5UFIJrF32wFK4AC+JJyMeoI9OmdD5ti8bWr1Rb4ZK50fF7N0zLYLvrGSo4NcxMWj8mJ+4jP074P0x36WLPCXkjTDXnFywVhcRbL2a+rEuW/7qmfMLCO7EhHP3D6DJOOhku8Js0gpYuXqtKJo6Tp/bWMc9a8iBY5Sct7qR/rnI/To1LtkUUEqXo2vXZWoQh7MtGDxYljn7HKd/Ej9CSPr0AyMUPIK1iqJjDH+XTjTxgBZJ2WQ+KlVGPLICgADH17Hv0FdfP1alyGwblqONdek32QT2As12OEt7ZURMPBftz3c4HfoFWWQdWQa6HZca10xsKsTuIJXDPDkHByD/wAB/wABjpkzbFetVPdHYtWQj2Z1i2FVE1yvM6+CLFJ4ME8yRGyZPkpOCDkZ6WNbxqwUvRV5veszlY4dNLLHX/F7e7+Mys7AqceZByD6/UHHQLcakBfzneeivH4jDI8ssi37Kn2I2P3+So+PcbuSXIx69+gW40NakF97X0dY0lmE2x3zlLs7eRmtRRSgoJT4/aiZI8VGO3foKPizzAbkdaxPp6tOxYdkiQV7a1HkSd3ZgAxkyDhfVwD/ACxjPp0F2tjLwOzY5JRra/YSom9ggjM/ugQvKoBjisYIxk4wVA7sDk46DppajOea6ejXuMLfuaq9U9uxtK347RVEyhVZkR28mSQDAbOMkj6dBYb39wPd1O0tbka7RV3a5e9uzbFQKYKkLsxWXDY8yzA+CHv2z2HchOSZowXQ7tIIOP1qOi00rtuvE2nWAFsAtn3ZCO4LrkFx3z9qjt0yZr7wiplYJGnswxWbMmWmsMGknn8m/wCoT2yAP4ePZe4x3PSxplqHQspS2sibG3rbA2FOrA2x2MEjwxlIfc8GZffKN9vrnPQWHJBFuvLUnirTTw/iucxWacjSLJHNCHUYQ5Dk9vuwQO3+IdEjxNdRFlrL+PB7VeBrQDAMSS3Z+3kCO2OghYES8Xf3UlqPJEyuzqtd3RSMefkfJsAkdx9T9egGVYDOuOVaGp+Yt5Y2ITXWbFVZ9DN9rxz7RnSmWkaXKvLjIJI7jGejj3j5dZhyZ9OxRFnh2W52uxvxsFL0IpPCqfbY+YaNTEUcZH2E4IX6dujofSFsbDD2Bii1FKOepYo1U0m1Mk70nvxPL7kDeAlaJgpUpKpBA8sj9e56WLvi/uGFSdZHiky/izsGjZ1kVAcgA5OfTBB+nbo6jPG/YhBrzjYT1K0T260gSSeKX+eArEF/HC5I9O+F7dAcb9iGdXCvcoRmzc8VSOOwfCG0gcnwkOCFIGfBsdvQ9As0tWIK1dHkmmfZwwSWT71A2g0djz9HhtKMhlXsVYdx2x26ZYKxXSeHdCCmTydXhkisIQluJiq5IHb0IyT6g/UdVhpFitYlau0VRPGvNsPNZ5YmKNHGmMeIXOWx/IfXt27nDR4ZFmGE/bCo0dOPT0pzVWYMsf4/jFIlN27AkfxYnsD2JY/p0GHxivLmqkK1395LF+H86jUWOUqhAlkQHBkceP2qrJhiD9x+mOjlFmzhPSJ4q+osiWas6atiY9hApU/2+WUHy8k9ruh8v0759V6CNMnR3QK28jvSz8fuwpVfZQH25rC+daYGQqq+RKszEgEjIyM9TxSzWycE20TWalXwe1sPLYWaE8m0C+xCzRCJQhCFQGcg/cowO2MDt1Bz0gPZ4aPlYMNf+3ttMpfnrBYxsCI1kjsSMnr4AYUYGDnOT0HbLNkrVaN/YxWnTZijbp+3ZXXyw/kI3mpwJFYgsrY9B9R69Mnz5XJ0Z6pCNTLXSOK8bMusM/lBs3xPBUyfJyhUqUU+IADDAPcdBrsZk4Zg0tGsjxRwBbAUGKJg/b+P3YI9SPXpUs+LCWNb79QyxWyAzkubnkWHkxCfxbJOFPqf+PUnKyxPbh/DVp5bA8VDSe0xAKgds/59ByKM7TbS89mh7ft6pEewyBRkt9zEZOcegOP8D0yZX3cz0hPnTlQ22232k3HuvB53JoqAqEIHi95PoP5H7e2fQZ9OmDE5PG0aMp9CUNLR2EnI9HsKksaTsttiT5qzvXZYvBI8klQD2xgnB6k0bPqjTpKR/sOnkb3BfijajbEqggyRkozjxwAMrkj1BJB6rWj6Etr8QnI0LAn3yjSZhjZn+58AfxGTgH9PXqCyBlq3Gix/jRghsuUyH8u+M5X1Dd8jo1Kxr5isNgjSrWEkm0uQF5lgiTM4A9C3jhVC5wckdNBydRrOvtQCtsX2Nerta5G0o6OtKs7Ad4w1mQdliyfv8B+2elisayVHaC1zXrFx3j22MxtsY3rbqx5+6hjsuWV1OSfBJP3OAegZxtm1KVfKaF3aNBHYkHg0chJYlft+0fv6gf8AHqC9AthEbxmnBjSY+BVlZn8/QBVUFvuHqAPXroQLdLjGxuWJJNpI1NlhYVVwPylAOQS4BWMN6dsvj9OoEWPmEW32g12tXWcdo/kWZG85IKqPDCHTOVd8+bF8HOCSfUnHQLdNJoQXLtL9K1DuGtm5ciVvzqKTBBNFIA7eCEBQy+ICN69sdAdmkW9zELFePktWVrcG2CxXXRC8iI/3ISkWcpGWKnGT+uR0Cq3yOIfehUSxOY1k8nJP2xMgIBB8T2BHp1I0Xq1eTcrXkkyutgX3oGjOI5Tkkkxtn+mP8O/+HUBkmT1KFzk3lDr50evJXkuWc+Ky2o4G85BEz4PiV/jH2ZgDjsOmStVxfdlOapb3XSJjWjz5rNkeMXgCCAT6Bs4H06V6llxQlTnRR4qRJXRiUDH7HwuCcLhs9+pGF/mXEtw2Y4olcfYwcr5YK4HljGR2PUj5VvUYjNGdnWP5Dj8mpFeh8WaCUYR1Vx90bjurDIbvjqD0VMc+SNPo6dc7BKpN32Gg9mA+UTRg588A49wHsvb9umVikzSsFGYA8Vs7BLNgpZQ6u3dvbYUYQa0LNPJH7juqlGJZPHOTjPpn06DAe2qE26bZpa1ShDMa0EWvlVj7ir7b+bKTlmkX7ycEdic/r1BrOMU5N8mqsQQwTtL7xaaPsX8ZFXDOSMsfPOCucY7jv1IvqzR0DTgpJ7xmFc2kVURj5CNGXLHLZIxntnGT1I0Bh/a0hM8Mzqyl5IlYGMiQ4jZsBCpzkeo7+p6AIoYrK2RarWLEKV/aM8NMgRyRhvNkKuGwe2XVfVfTv0oNHd2yrRRX9XD+VTm9yteipF2EUgGfL3XA+5iQB9foe/QezLQf1FiKWs8yD2ICB5WJnjQxyY+7IbGDkdwc/wDHqBkEamw29u29jJ5NqtZK9zUwW1LGaYf0zIAvcqucgfqCR266K7JNUbZm215Pc5Fu5Z69yaOPQqKussLJ4ecsnkZZHIGArYxhvtAGSMnoFh1r7nZQ/jafZNDspK6+B2mogIRY1GWikjOFDAkFvHsf8+joM8bQatdx/Y7ily6/xTSzXtfxXXpzHmtqtHFNT1eqS7HQW1OxfzhRZ5kjyvlhmHbHoDHKgh3QO91vH8a7M9evH7l8VpfIqZJfHDqFJDHCqv2t3+uOoJ4pxPoJLevt24riybGrD78FH/pTy+GH8o3wc49CmMnPf06aKxmuKejotsdl/cWYm2tdorJuosaQkf1JFOR2woCljg5I6lgFb1w7k11CarXsVNj+Lt9hMRKZpgqSSn7fvVslm7Yz+vcY6gXZ1on6xe2OtaKPbwwVbOsl/GobaGUzQJITlI5fEHwL5P3gf5jv1I0H7VSzT2FdbEVmpWKo1qOUEe5K6CVUJPp5A+mMgf456g8CGv5VhNHaiM2xslJiKjhIVDDt4hwCuAO+fX6dSe4Du3qhr/noDWgwrTRSt5o5I8WPj9cnIABxj9D1yc8kVxqTFHQ1mzLyz37f9wuTS4/+5jklGAI8vAL6ZOAc989SdaLayi1HLLY+Q9vUgkhsx05IdnFPXw1rCxEgSeHcAFftDdh0C2M+9nGGaxatzVNrUjMn5Ei7AfjqsKyJCQZCcZUEEEMR69e/ZFFdaOTHGOzMa8U9eOYR7GMrq5Io1WOSEvllVj6H69hj6jquNqKG3n2VlSVcUJIF/Dj8P5SAvggqcnz8T2bsB00eJfpbfW0V/tL4sQSJFHNf2eQGmc+AZmHbJXsTnHbPr0FYzXJ7H9y21uOrQ1wepXlMdiS5MY6sgHYBGGXcrk+mP2z69QSQXqlnT3I99sNkf7jIwpKEWOGJok+2OJVX7mIHZS2WI/bqSjyWlYpWLF07ezXsSmvS2ohmYQtjBjCnuoYq4XILLjOCT9OgZwetaGkMsi+cMdRpYJEtizFJLCAzVYa3oqe2fIBvUKTnHr0dCy8XqAJ5NdQE1GrE9m5TilrKKncjyzKD59lRGB9FP+HR1K1n1JQtTWtY0xu8tt4oQqlelRQla0funxRAqjylcnsvnnt9D0FazZ0tA/WI60rIpMdcssIpV4tihxDJExV8IO2MdycDP0HQQrg/VFfW2p9bJtILcsi6nZzJItraBnaG87mBSsmT2mA8SoIAbBwO/QWbONsHrUY9DMsVyF4ac0i/27Y6uP3THNLlRFJKcIqv4kgY7nKg+nQMremd7v8AGfWQW4pD7utaOuWpRE2XnZsLXPrlvLCqUOf8PXoLEsavTvodba5Dyotr7csZSvAz5asJDlYo3iGSXBOSBkk+I7d+gybLNa1EUoRdsMJNniWrGS9OHYfYKsb4ZW8FyqyFTgMCQuMfyz0FjjVaIVnh/MEYpzijOpVI6qARqS0oQn7gVwc57H9ug0xU2NHbUpth+Z7Ne7SlehtaxsR+6paIurr7TH7SMMfHv37gdAFKs8rwwQQx/kSbARw3HiZgrBRmQJ5fp9c+o6COMU5ePV7oDxwpA5V/NqIb7UIyAvgQTnHp6H65HQGi0ExkvyvoZ6Oi0dqxE80mpuRXIbTuZZq0DeMUrRYPbIkHl+3qMDqWdowHu5aCif/T/nB8c8js27rcVqfi/wBq1+NbarQRyr7bSIS0Lk+DI47Bm+o7g4OOsBofbPaLPaNxSO4t/wDuMFZqNoqIj7bf0mjUEkvGMeXYYGO4Hp0ubosOthY2eKOMit5N29woc4Zl+0g5IP298Z9eoHrp4Vi7zLWH5TL+KbbIHsRJKMhSVBYBh9OoOiwEcDwauxrJ3MfuZAAGfTPb07Bj26AK4SpfAx7duJsuskEolCuvdWVk8gCv1+n0PbqTneBsdnw3Zg2NGWaC7XwasLKqSiOQkyIykgSrjyUYwo9P2Ck+MMx7d2FhCrQV/wA2zX9uTXV5wY0lHhhTYb08YycYHq3cnHUrLCucyU9ClEFY0nulRPIvtViTXigVhHIy9i+T9AchD9PX6jqGWRr21g6MFWUuvQhmpqb8CWq1jwSOiSVPnDIJFfzjYEFHUEfT9elTXFbYlNmn5DRl5QDJL+O/hLGzNjLOuCHBGTj1HUirKtUEyVLSTJYmh/PREYP4qos4JxlwPESEZB7AMf3HTPKMlkvbItayhWkmksCJoYZ8V1aFTNAGZjhpY2wFZsfXBHTJWK14bUpa2e+TXtrNY8UkmxuN7Qib0kAUyn7ie2QpBXGR0txS0ZyUEMBWii/3BV/s1SslanSkGwtGF8+YBymA2O4P7/Tt00wVeDxndJpt9yLjSNOaLbRIpUiGt2Ds7GMH+UckQLKCe/i2cevUE5TBwTDXJe124jiubGk9GxLiYQWyEmiaUePksgPfJ9MnoFVsY6ndPblW7rJYUiB2UTq5ljJUSjx9Vz2Un9fT9ugs1s5B3RfubmBUdVSYSY8pYR2kUEEZKNgkD9elS75Ok0ICSsku3rS16vnBSjV50buA0x8R5ZyCSB3H0+vTRk/c2yAL1hbk0ksdc2J7pkWPB8/GKP7VDgf6fL1Hr0yKLNQKJXRU1tKWxx9aMatRZbN1qNRUb3DZ91XVe5Pih9QT0sN+zvszSTWsyvxa8ZZNesU0ez2OulDt/WSLxKmRWHtplmZseo7Ht26BjlcSYMCzqrG1ni1Vh9xet+4iVdK72pR39vxwv2FUHfJOAD0saRlijug2Dj9mGZIrUn4tosY2grmN5clySASPFGOfuxnpko/JwlmS/pNPDNJp9GbW5tK1MrVf3HIUElrFqU4AwDkKx/YdLBypqBSMm726bCxuLUtSjEihdVrPCOOZWT/6pMP6jeOQMDx8vU9Mk8ZcWpqs1QxW9V7PlVC17NcK6RxpI4LOChz9pH3k9+gVZVrQhu7YvRbTXWK2nGzm2qPXtUZHCRQtEgBlfzALRlcDAyx7H9egXxrNEi3RgrxzS7iRJnlSCNaNULDDThLe34QRrnyYHAGcsc9gOgWZyc81qI6WvtRQmqS0RQ1SrFS9iMiS/GVk8vWQP4OQ2AM5x+nRoWSuMsUpTmBKGts2IZIZV15ZK7SREtJYZz3dpFOWfOAG9MdvToGVVS4tW/VnNm3MLFqgDcgnJPgIwcp/HBdgFwTgHPrnpcZANgbC/aq3KYhsXKkrOa5/pj8aZzIY3btknyJH+Xp0x1Bm8W9lpq/K6FDbcbuf23d65pK4sXQrxwxxSgvDPE2PLAHkgzgNg+hPQVutqakWBbi0ctnU61km2BRzrIJnAu2MBfdu3Zlb7lAYDAxn+CgAdAt93ugGHR3Kxmuvdnv7KyBfv2rCiWay8LBQEj+1QIlyU7gKvrnJ6BlZWAry19jNZr7DUzpKJZEmkB/h4OvZXZMn/mGB+nQWXGonV2tfs00aCHz2M7NEksbA9jgSr4eIJLL3Vm7Zxj6noGjm5rXjMSivLCkivVu3wqYUmIfc/vH7QGPi5zn6qe/ShyeQ6TY61YKbuJ4Y4hJDYq+Xj5BR/wBL3DnxQen0PTZKwu7T/dNQhbBKrIih3lcIqtIw8QwjBBH19Mj69ANM9BJ3ukHFeepyaxcinox6NrUdzZV3WpUnjuosjf0jIcMzeOMdsknHfoZPkmTarO1D6Y4Vttrv9Ot67Ujtz4KQwrGVIinQO+B2DFiO5x/HAHbt0H1LCNVoRqqQ2qlVqiDxoQ4kigvMz+LjMhVGB7Dv/H/h0qaYsuk0TqWh8ElLM5HmSrKR5licgIfUH1/U9AH6KKNQsVSJIIY/OdI6qLGjPMPL3PJcLgj06APZXjrojXWWqzkRQyWJggkYnOAWIOcn7QPXoA8MPj5WK1VJZ5s1Ww2FmjzkDzcdmB7qQf2PbqRRpYF6u6sutikaKb+6QNNXS9ZUZJHkTBKi+RH/ALMfxzn06BbGNTbZ1FsLQsSNWrxvDKiy2LdoMC0ygRJDXT18Fyck57gn06a2jNZLWbJT0ogzDUkJSy0hnnslfekcFe4HiuATnxB7AfTqsNurjIIQgYIKFyNzChvmIay3dcsqeyWMoWRSSCisfINjOT1BZgO3Tl933apeu8+WM58XrzKzYIeM5U9h6+v79SVrONrai9saipV/HtVUIM2VsEf9ufI+OPNiWj8fXDH64B6a5RkGcHPDdiOtfVWrBD7YmZqpHvRWwQ7xP94ZJW/0jx7eR/z6gFmeu6B5eTUdlZuIKnvV9dIsara/pD3APdb0z9xU+h9emllRfONVrcRfajtNhJJyioskc9pEioQUpUjdIYzhT5N2GPXBznpQslsbZLeq5htq+y/sdrTttKdmNUXa0o2jkRVy5EkbYQgepx6+uOmjNM4O9aGWDX67ZStHQsGvMwFuzNAezjPiS8TAZH0zjOegZ5U6e6UZbFyi8guV2mUM8KXaillA/wDcoyw9PX0HSxeK5yCYXbW0p3JIkeN54fEyJN5AxE+JH8gcdu+B6jo/UZY+YGg9/X6ad3h9qTZsjQTscMVlZgv7r6eh6ZXMOzecFbZLFJYotBrWMFWw8dWVUJGYCreSt2wPtPmT3/bpk8PcrMFeGMddLbeTkkhN0WJ7y2dG/wCMPAVnY+9Ao8+2Qy48h+uOl2DStK2Rqu69qG/2LMjWF28cW710blwIpfAJZ8Ah8fvkXyIP1P79Kl1jWYaJBPbsRSItWmuyljK1ZIoUwEwc5eV/EA57HPf/AB6NRllmiRXKF9Aw2NhK9U5kkra0eCQhhgqZThyM+pHiOoKRnJekQx7tKdGzrOO67+4Syfa007iOnETjOXI8pPtJBKj/APGz0DPjKxXo6hpZWs3fuljRazwV4zDGqJnwjAzlgPUlic/XpoZWxsEO0aTxexXta21x+5GI4IEarUSYKuaVhcDwUY+6JmIwP26WGGbQGpa7Y3pBBMDBJRZ6N7Y2wCrhW8UaJQfuZsg+ROAc+vQSzk4AtnUcXtTMLLbfe3FWuI4As9rCjsPL0jX9T2H+PSwvozWBG0vbjaJJXvyR0ar4SHU0xJ7a/UNLISGkK/p2A/fpnoM8XUXTrzLYidCVaKONIpkOBJnOfs9Awx2Poc9GoNfMjmoNJbdpc+yrL/XYF/BgvZQ4Bx3/AG6krA5xwxaRzSsWWk0dhTLan81WOtJKGiIYgAFJAcEA9jg+h6gOKe0eHxQ7N9PRWWlxanXh8KkXuSqkwQkxtPZb3EB8MhSTkfXHR1FdGdDuxavbO1LV06q+gkIp2djE/lFccKAwi79ou3j9mAcHvj1CVlvidw6+eBmjgt4EWbCJ5BWjHjk5A/1ev7enXJYnXhPLda7LHHPDJ5V2LAoE/Usp9R9T2xnoAjvVLcaiHW2JFi8RYb8keJDgkhQVz27jP69Ni6tcF1ddtIvvmZhJCBPM9fBAH7H6H9epLEZrNe9IYV92aZIUjrwtLI8jxwqviqL5k4RAMADGB26ULUzH5CoJDXdCZX9iMRxQxgEsCCWw+CMkH6n1I6bXKHNbEwhcfqRWH1cOwzYr7drfv24/LEP3exH7jeOWACqA+Mt6j0657B8u9o3jbWaHXamguvLXHVVj9pkAcmMfexzgnyBGQcnoNtyQ1xfVCvDa29qsqW55RNHAgDKMDxP2t2CqMZA756k8iaZ47FlTYBlh80WWp4ZfPkVCgj174+45AHf16k9ynboTew9I2REzt4T+fkPL3T94DAEEhT2Pr0qMl+lE1dBUSAGrGppRTynBdCACpOR5N9cjB6D3WWBF6CaJ55qEn9JibM9eBF7EYXyCuPH3GH2k47/4jPUEtFGzoP7lTqx0raTV7Ujf3KOJo/IQkeQX7hgP3x5+p7/seugKu62V0VDrONasz6fXj/ubMefvEYwIVbKsWPdfLHb0Hc9QVq/qinOuxpjeSrJFDGbFb3a+UdJCVLLGWhAAx5Y7+mDn06CA3rYbCitGstUySD8jFsyR14lX/qBZGzgPnuW9cDoGl/kMBMU+vfZ0ZWhiuqspaJ3+6MSD7Z0jOJFV+5VgQCAw7gESMgm09CGBqmzCuM+dl1b/ALdVBUqAD/ADI9cdAEtuC/WgnoUJ2llrwfkRpYxjxCnx9qVSTj7u6N3/AEPbrgYKF29Q0lI6avceXZzQwx2Zink4lsyeZllcD0GCfAkj0Hr1Oouy1DCEd7obo1mj2G90S1NXyau1vi+xRQUtLWlaCSxDLGWaNfNPHLAENn6dNFb8dsT7ZtatJjPVO610sTTxe+xR4j4+I9s/xYqDnyPcHOegruMTm1t4bYeOzPr7ewWOA1bcq2Zp/ZkK9xlkXP3DzHofrg9MimjM1YLzWbBuWl2Tw15KXttFdgfyqjMXuYznLKBjDJ/qyAD0sWwv31tB6+qmuLsZ7rQzTNCi+MUSuJPcBTIbP0yB29e/UHqsEdVWS7ttzbeQJr9dW/EisSgMYrErh5SzAsqnwRQE8QP8D36XJVMr0NmxV+T9i1WX8WClHBJQWJfJf6quCfAn7j4nBBJHcY6Y7ItjP+zmHrb66543Zo7TKTNJsNXKUCJOPDxGI4sZ8XB81+uf36lYZzYTo3tVX4/qau02aLLrkJSGeQxufv8AEv4J5Mh+4lVHp6DoLxZmtDVLt7WWr0otmvLrqUkXs15doojZkDAErG2WYN4juxGR0dBVnJwEqUdDVijl28H5jRhpYZ7XlKQqnt7NZAV74wCR/n0sCzJSk33IttOlWlRfQ0L0y4klEMtwRPH3PgxKKcdgMk/qOoFtP5QTs9XXNizB+SwtuVryXL2bNh3BBJdvQIcDPh/gPTpoNKEJ5DPtLWhvfnosU9F3vVzH7hAeLKtG3kpK+SnP7hh0dCk0WozF+IXLmvhsbOkvG6bezLbo1vbNqfthUmsJjsAcnx9D9egZazgL1ktm3NNPpNdGjvKEs2pnP4oau4d0hAyJCF7EY/XLdDIY3GT7spI9GJHS80TS35LEiSO/j4QIGJJrIAAoYdvLGfUZ6Cy40FYumv8AnRJbqzv/AG60Pxrtdj97Tg+HuKWI8Yx6MSe/S4yQbGSSTGqf2RXhjbXR1zks3mwkRQSAvkCPUdj0wGjZxrIKd2nPxLksHhParStG0DqPykjkHiyk9hLGBk5zhvu9OjoVrKtK6U62qm4lUS5v9tBPJXkmhbabJVaKhrfHzUoiNn8qRTiSQAknsMDPQDTVa1EcbSnsd5e/uFyeetV1zLPptU8o/wC38Pt9+Zl8gZMH7e5VV9O+T0EKqwwlOerZdP7XHNiek59v+msRf3gxjZE8j9hI/kQOxyBjo6DXi9SOpDtHrwVdmFmSGJ5WjU+07RgEYZ3QqrePoF9cfr36Bghh1Vw1rc1us8007F6SqGyQEPi4Gc4AwGB7579wOgbIoNPsXFrbVpDJLII4Z6MgCzROFw5mMR8AE/09gT+mc9KHJ5sKe+jid9arewqKoh8h/Nv5eLZ8uwGR37Zx6dNnRm3NuNbDkPBNxsJr7R26M8Vxq9eMzl4IrMfuo5LKSTnsMdvU9HQ+f+7ma1o//9T+efA9O+simuzxYMqLbzI7PLKpYCN/LB+/Jyx7gfp183PuvtFY18ujuzGTwZkdZcNmQ9gM/b+x7EdSbIthlVvAGSA+McLyxnHmGGFOBjLAD9e/UDqzRyxEZYN5RSuSWRCysVOFbGM/oCzf8Olh8nkaDvEVwY1xAXUnyZezY8P5YP69MCRCirXSRxBHVSQl5pIh4IZGIUqfbAH3Y74GT0AB79F7E0VSxE0tqsfyNZXn+6aOVWLLJYSAqECg/wATjtjJ7kdBVMsklFbt8vbklN4WohBevKB7VokAmOupH2xAj73z93cDt0EqrT7soURy3k5Ahl8BCLKK481UeKx+KnsB6Zx6evS5oep+jaV/aV2CQ9oiUbyVe/kQQDgD/wCnoAnhkmq2ZFEUccs8aFIkT7WbJAPkRnOPQen69SePGvF+ezG1dVaPymQj8nOAFcfUsBkZ68RsX5a8jyy25R+JZYeEt+F1J8o8mTyU9pFxjtg9h16lEytWE1uO2Ll+O/sJzWmpMbF+GqxZMSEeHto/3LJKGXtkePl2/Tqy5Jk/GwVqQ01a6a9R4Rqo/wCpcjh8i4dvRV8fQA49elTRLWQtJAmwgnaexJrQfCXyqMfuEYI9ssMMnkQCxUg9sZwelyzauklqpHNCwSNrKZKyyyMre4AwL+I7jIOex9B0yLcX9wala3Wjk/EvlKkitKtC3kqR6hFcfcpP/DqeUUbWDgmA28EM1Ue/UWW3HF71e+HZI1fx8wvvKoKqGPgQR6g+o6YM4zi509asR2tOPQ8Rvz1XGyu7mYnX2kJPm0wAY98dlUNjsM46V6FaszM5MZg0Ny3sxq6MiQVo3gpvYQBJPb8SwAcemT2I9P1z1ZFl7nPLF22N3upKGKKG9Yk8o2VURfZjT7S3lkkoQT9fp0uM+2/shs4jsJidjSuxS2JhH+fq5pck+E2EkUnuMA9z+gPQMe5FvhVG3VbHjnFll41puNS1rkCxQWIIYvYrKrAsomeX+XkoyCAzE4yR0alKti5nLspRniE15HsCITn/ALSGEqUwpPkRJhiz49Dk/p9Og1q2MghINhqrl1gK5ihkYLCsDP4K3tgs48jgK2MlScZxgZ6UGD3YQSQ06M83klqEmP3HjARlVSyeaqQAT44OTjP+PTZW8fQq0BDSjWW9ULa6TxQ1q5Hi0szAkZLAiNMEsP8ALv0uNE2tkuQve01ueuNnrgG12wLs0kdSXPth8/xYH7T9MD9emDNZNajMDqS16VrZ2Hpyyb6vKi7KxJmaBXZWPZJcZD/aQB2I/fo0NNjKFG0F57j69YY4bEn5e0dZ7VKszDwhkADe0fEEqWyAp7jpQ9xakjVVjamJDYRmWYhfs8kYq3iMfxBIx/6dN9St45NQeSVoYxK0EhD+66u0ccmFK9+7EqAcf59cknVbU1ZDNLJYnrCiws3oEAaRRExJPiofx8hn17ePr14jJdsRChspdhrPxma7kWNf7qEXIgAST4/asiE/Y7Zyex7dchuln+16vbxR7/j0kVfaQl/NrEYMZYDxaC1EcMpGT/E5B7jPp1JWbQp+SxSWaF1HqbFI/wAVqF5gv9M4b3VKYDIe+HBxj+QGOmSzUGqhrLkLVllRKbJmmJ6K+2RN4oWDePYElg65Hoe3SgwCLyjU+N1IREwmngeacSNI80P+qNmVVVR/JS3cnI79AFSTYXrFGzcg1vnSiaOCKY/01LSj+oChJDBSQe2QO+fTronj6l/V0doyxxWrK0ZT5TyQFMFMf0lPg3ZiBgKAcgYOAD0ySL230qikdPJdti3LYS3c3tOy8Mk7RkZV3IdVWQDxcE4I+o6k9zKLWmnm5JQqQKC95Nh5Vq7snuIt6Lw9z7RiMAEjxJ8iMHqGD5Lk1vrT6T45Xi19KrVUhcQHLo3iDEreARxgeR/4EfXoPrmNWowDFCPFoyHE/gZSsKeTIylQv1zkkdhnpc7LSL78SJF5zA/eIZcuFWXOGKjHoRgdKlvvHcTRjLAmRIwZCFbyAb0IwR4k+Xrn/Lpg8CN44LCohhSRZspPHNGWywOM4kyAykdgP8ugD0rIfCNFJtRN+Q0SFVCgNktIZBiNGUfcx7/p36AFtEMdj+4Q2vxXvH8TaXoEeV7GFb24aeTgkY7AZPqSQvUlXyfSDlWvbghrNLCIpUV4468vjKYVkOSjMuMyv/rY9voO2OgZWWolj3BGIBWcRCFsx1WDgRAnPYuSD/x6VLJr5HcaTTeStEsjY9uaGYsVKE5LA9zkD06A42hapXZEhjRvF6sKAWPtKMEJwF7/AKYH+P16CFjm/MJZiiweUJQRzI5VfODvkgY798Z/b9uglkVr1KwKhr0mUKW9q9TkcmFUQecsiOvaIqO/6dNFIytZAmu41HWeZ5Z5LUexc24YrTDKxqfEyM6gYkYgKg74AP69M8kpMYrBuDpTmkh8ofx1LMrRRoC6xBD9hOfQH/D9Oq3oa5Zkn/DqJMLk1ywWmhSIUpGCoFQr/wAuAzO3csQTg47DoOyvb1yTT+TwSI+SIZwwDo+SSfJfT/6P26ZE2VoJd05LbJJIg96O4oDEyykwyqQuQP6SkMz4wDj19e2T01yDNM+2fSEvYamns70NWvGNUbyt70cxaFpZE8SqLGoK/ec5YemPXHUGaZ5qlsvc6mirWlq1IAkOmrGxK7nyQ2nXAGGzjEee/oc46Fizwa1a6JOsW6dRyLYXPbmj/A9rW02ATDzLlHEYP3S+ROT647nOOmmTINfeBJJr9gfjQHwjeUWKkTImVaIibOSAzDIyT9fQdQfRDXZVi2uv0m6mm8qlaOa9YIJiJR/sdHYeiKw7j9gT6dLGXvpzHk2792kur1OuUxCUT1rjKUrs3fBCp9zjv2IwP36W4prl68sFKUBSa17gWXYWBdiixYHcLEJf+XwTAYeR+uTn69HUsdVqJDHDVEzlwxaRCJPoB38cY74x+nUHITi8vGV5pWEATxPkcswH29v2OB0AUvf/ABZY7IQv+ISxMLeb+B7uB++PT9x0AOW9pW6nH6N3W3JJ6Ux9va2kVJp1hkB8XjI9MEjPbIGepKfRWjNdFTULHAJBYgVWjeWOviRHksxgBxKzHBHkSfsbuP16DSK/qWprSWbsCNH4QKjyoXfAYE4IBbt2+g6Oovy9T9DXrB1iewRFYIZg5dMqzZA/RSuOuRQlRIq1iSZWdvdcQyqP5ePfx+z0yD9epF1QvJD7tULWjjlhRxUnQeykUgZvvYFwQxXHf6H06gYBtd10c0kTvLZrW43hiuzMzrWQMQI5S2AyKWwpOSB29B10Ls4zuxECUptTGz6GIWtSfH3NRTK+7B9XaID7DGf5eAIPf7f06CtWZ7RwjUmi84384JlAkdWkZyvZvXHkoBx2P+Y6ksi7FJZ9uaWKYQmQgsy/1CqAYI7dvUfTPQQXopbf/bywRwOhGL9i8jhRGR38PA5DL65PYj165LAs19jr1ngjSo92hY92U3KePCuY+4Uucgs/+kY/xx1B4Ezz1Y57H40q3KrAmGUjwcD1IcfcMj9j11oNqfMyL5Al8dTK48mksyLBNBnCmuGLOyrj9CFOD+mOmV/mK5r7KYV+NWrVKRKGujCRKtpvOWOSdpoTImOwPln1QgfX9+jj2T5t7ZsmsxSCjV12ZRBsbMkdOP8AIHmqHxznDejEdjgegHQagb5I7SIP64f20Kq8P3YYjOFPrgj1B9OlixFyZ1P5TJE35aos1aKU9iykK5PgBlcdyfp6Eep6BM4Nn8yTwmkJjm9tFSHEvkxBGWIHfuCSP/XoAK2YKcntGwwMMQUpIQvmrg+OVKYGQfRvXHUlmLUlpNvMRVuGCmDJUqtDL7SzEfYU791U4OT3OO3brnoHKOpI7NmNaWukOpoxMYLs8CgO/kMKsfoVAYZDA9+pFyxAJaFUloIoIPcWOuJnLiRAQUmKqo8HfJAHcD1OeoApVq+mjY12qpWaRJb89axKQ0rswT7sHIXv4gkfpjoJI51irRpXqUBLWmw1ilPGHLI7do/qQc/Q/UddHuc63XRwvfOqMsgbz8qzu/8A9XYBnJb0bIwQP4/p0AQWp4o69hG9t4C+Z7MwBJPj4mMrgZHkO+e/+A64GAbp5azXt4alqRaVRDNHT8hIC6FV9yLy9AMr5jJUf5ddtAszetEOqhuvLb3MyN7dwNJ5s0askfmsf8QPJE8l7Yz+p65F++TWxZsLVih2DilFK5RJi3qR932gBe+SSMYJ7nqRnjnYFN7dWqvn4wRtUSrKJMFVUyGQ4/b1JP6DqBbjfsTjj9TaUb1WowpoyKtiOOOXxnAPkPCUD+eUBXBzgEHpoXaWB1bV2qH9ytpah2EMaxj8a8A0Zlz4KwZwckEdjgYxgY6gU4wWkvTv+bt5aDWfYrsUmgjAWSYkqfAqCAF7kD06X4pOjNIUdbQaGjHI8DU72xl87GuKzeSQMwcyu7ZLD9Qexzj06ZFlTO9QFl+SOQa+tN4VVjrXg7BVOXjZAPID7cAenp1HYJxn3kxqu4hmqV6VhfGWrWIr2K0bEB4XAEhwc92I8s/qOpLrJrVoDsNotVsIN5c0jWrNmSOjRuJXLyHxyyRrgjxIyc+gPTJiFlZ5rcQZtXZN1H5zVBTpT5QLaMbyShD5DyIJVTj1ODk/XpY0uM9sww7pFNUNqoiwIpEvjOk6ljIfAnIYnJZgfT6kDsD0oXXUh1+qvxV7dW2FmjtxmZJK7LJH5gZjYH9W9Shx39euhZrQE1Ip5Zg9aNHlrBK0U7qUlRZu7+4hLZCHv3yc/TGOmBcsz2oYLdXYxRougut/atvT2rf1JJi7CGRVBILM3Zsn+OPr0uLZtWsc7aCE7LWNuoZLuuaVa+pq6+STtLjvCyEeJJX+Pl+/16ZFsJQ6BGGZGT86zP8A22nqD7aeKnJZ1I8HKgh/ux4sDkHpQ0YBnsrdZbewEv5csfu+6D5liHKsSzAHxGR4Y9SO3TYsysUYmlrtJHaV/cCeMLsAGUpnDE+n+Hb/AB6BbZLrUYprNSS3NJ5vH4xXHkVTkYyjFgcsc4wB/HJ6W1Glizb02u/AFJ7YSbWuWlvXWSGWuyqH8oiQrjwyPEfX0JI7dSBahGq5En9s5BWiTZMpkhlg7C2B6zQFT2dfWRMZU/qvUCrKtIC7eha1LRV9nOza4KlGLc1lSJCIj5RrZ8QQkpwB5j7W9Ox7dMk6s1jurTnuy27VenFN+Rkwoys0v2IZWUMT5eXj4tjPoOwx0oWIUt673FgdmeyfYmmqSStK0URgGW8lVMk9/tAGSfp0ABamxtW5K1KpRW5PHIIz7QMarAw8nYHyymP5YbAB/bt0AV6Z2VuxbtrCNdDEXjaR8u3voxiP3rk+XiSckEAHPp02Txgnb1bUbNXaXJ22f46GCpr1yI4pUVlJzGf6nlnxPYA/Q9SMGHcu0X4+j2cq2pL7rUuWBa29gyzF5rETIgkCDAj8vFEcZAA7+nUGK92H/9X4ipuK+n1j6mKJY3ijSrZnbxZ/JVaTxU91z3yvftgg9fNj7/hNgNwSJRUVmb3ZG7ydlIlUnBBz3XsRgftnpo0wZAyiBfH3WHnPEC+Ilb6ZJ7k+oI6XOidyFV2ExheBXeZpSftVSFB8z2A/XOMDrkfBFLkWptf/ALsl/JKs4NqUfjQjDeOfOQA+JIOCB39R1IqzkoISXY2aGs1ouXtgsf5PnUNmQMVrLKuf+3iTPk3f+WS2O3QUbOSrWogRq9MkeqWrVBi1MkEEVlGl957yIxYCeUMTgls+2p8fTOSCOpaGcbjKMA5Q1mm/HhUxJEsaoPNz/EqQcgY8e3Yf8elS+KzSFZYozEwEf2OZD5M+G8fqT6j06AI/dggmNSTKxE/kd8ghFPkDkfTv3HQccrUszTh2RWbzncMsUNggoA+MNn9RgYH79QM8nQrtOHbxrzAtIvg4b+A8T/qH1U/XqRbk6nprCwitI/uezLHmCsJMPJ7LOUR1wq48QWBbyOf0z0EslWE17liS1RiP4pR1r2ZpCRPYBHuv3H8VOfD/AJj93YYHUrlYreuF5mUGUQN5ND4BlK4DMvfIPpj9j3PTGpZLfoFK0cLuqRuFnmCsyjsO4zjPp+3SxPKB7RtWNvxCxLF5Sf0wfEeQGSR6kj/LroSKrFoXM3ibMIRa/wCM/fxDfd7nl3I/w69xfowLV9pL08OkhcTy7PAvNkhFqRN95ZhgAN/Ef49BX5tnpBSPeWXpJZYtZQSKGvrkEUs0Xj4mwFC4jD9iEXAyT279BSe2lu6ZhSuGlf29NqIspfjrx/1phAwseTf1lB7eQxlTn1GPqerEW9znSQ1as1ys6u1CneeOCV4vbLNhHUuD/pbHkcfXOOlxr2f9mOd2T8WoOQVbwtw0HNy5Xk7GUN4xzfagyWK48RjHQaNpatCGNhbpWdfrdvZsyQtHKNddld18WinUvEw9rJ80f1A7YPfoMjg279KUtRV4VeaWxXD1Y5Pbu13URrJF2BKn6/qSp9e3SptC7K9CfdvWEP5FWxiWSwzP7avGAxRRGRhlHopwPX9eoPAjtJE0s9RpyFmMlu6kgQRiMkFlGRg+PbPj6D16AJriVKEMbSIWJKRy+57YlndR7gl9xRhsgA+oX19T0ABRJBZgN1BXj2FCZ541aOSX8qOQBmickZyPIDLDAIHUi7K1Yv7aKWbTryLWRf3kiMTtFSJQy69VZz92O80THy8fXGV9cDporcYrRtSkS2p9xVgsCWCWX7RFaimAZ/KIFniB7jAzk+h/49KF0Lcr/h2o1RkeO+zoxVQMeYceDBfHPiO//wDF12LlZVnpOZIpVi19VlSIxMzyLJIgQp9/kPu9R3OPr69ADZXuPSSlJA4rxTg1rGA8jOxJCksvl2PcfoDj6dQK8nQAP7diYChSjgeVnFtVUN4p5ZV3DgkkEAEA9u/UDPKJNpFZpXk3GpvpFZuqsKiWJXisBCqr+V4dmByfE/yGB36CewVrGz0vIxDrt4n9m2i493VTspkVi4Tzq2EGShxkjIKj1B6krGVp4tosWNXstY0eIJ99pY5DO1mlNm1Gg8fNpI2ChmGTgoO6/TpkaVyVbdOKUlGYIG2K3lnb8ynrnDlmEkhhiHlP3xkYGMd+lCxBWyjsgK8rNrD4HUz0rgWWGI+6QodPF18fEfY47E/y7jps6GGtr4rUOsozGO9UtObNYWmlnczKuUWNl8SuE7EdvL0PSp6grlTRUtekVNkSnYjZabzKSjKpwgC48QpAwi/5Zz36aPVn5mP8bai/yfxzX7CSae+ull21yu0jfhwzXbrWY4oPDLKcKPNiTg9sDv1LB8i5NV03pUnksvWb2K1aBg8teNu7S+QJz4ghWIOST2/49KH1JfT4h2rZic+yQcBgZJJlXyiA+1seBOVOM4/z6aHAjGCCzjyaJcMJgT3UnxLHH0/TpU9Vf1KGw2Ou1cIl2N/2asziCOKKNi0jBwo8UAJJGfu+gHfoHDqO5FfKLXkWnG5MjyWSpmKDOJEiLA57ep/9epKtnJQArdjUWtpQ03uiefXTC7DRFiRXsuYmAktT9jkZB8BkkHCjI6a2f7FH05YTq62SKfWy25fOSCEVqMBURpXRcgxoO6oCAfM92PqSelTS6rUQw1eQRvbfxlYHEkMDEHDL6EnGVyR36WHCuD70dgNGZGP9WMKT9hDemW9Scds9AHVa3CyPIGZZABCGBKnwU5bIHYkfXo1PZZk/GxESZPIPGHczSSY9z+oO3c/QYOP8OgOT6REDI4x7iLXQNE8kxyfD1yhP1I9R0HiR2fwaX5Mt1ZLQuiGB4IhJH4u0KvHD4SYYlmOckEdi2cAdG8VLVolqwvHEfyF9qQLI15Iz5+MhbIRPL6AYxn9z2z0yNbJYjDO8aYBikRSWYgAADy/ifr9D+vSw4E5K8dqmWrgPCvj7cM/kwj8fuBx3/wAu/UHnyYAW8jKYF9wk+LSx5Zu5Hfse+AD00LtVwfI3hHHXZ/IplhdK+Bk909x3HfAPrnqBMoaaSCa/b39zwbU6KJ6NSSTILkHEjRAtlvI/bkdBi/crVaYQt/NcuTWrl2NWilLTmpEMs6/xRW8cMCPTA9B00aZZWjDSBFCzHs9FC1ypmzoNeZ2sQSiVrDK39P3IxjsoJaNvUen+LTJ82yf3tIfKbVrE7/b7t2VIYEdyQEjDeRZfXDfU47dQfR1lhp1FyGOxd1sk0ximDzQNEoKpIcxzxIWBALjBJP79VoMrQV6spUoMye7ppA9dKK+FaRv6cv4rgmNlwSVYehz9RkdMjWNaDj3K/wCJYh7yqEjj/JKr5Ht2z4gd/wBW9eliyaBtjUGVoLKM8QUhjJG2AQnf+JJPiR9fXrkrC7LDGytK6r4BRG0sDyZ8lb7BgggjH1P166DkAGOTz8pIoy7wuJj5hlV+5CgeX7jv00MhzR7O9RkfUBkkS20j1DOHWBZiuPbOPo3/AODpUpM2t3T2XTClfjqxoZo5g8uujn7FVUDMRJ7Ky98D6jHUDWNZrEI/FhiWpIqvLIQEhmAURAH7m7jGfQfv9OgfDEiQ1YY/ak/pYU/acsMZOO/8sk/XoAFQ1WMt2Ey+cFlVDr6ODggt6/5gDroQPIHrVBBp696Wza1KqgrhsoA39ImRv4mRCwPj+hzjrgYJ690GcaOWQSXIVeVMLmN1z9xIXv5Env2664uo1yu0W6lF9crf2wqK8LZNGV/t8s+bBTge3j1wTgdAtksFBKSrFqOSzsyNJR2qP5yGDIb3PAg+/Eww6gehP/HqDN3090ofiTUIi89YzooMf5tdG9qRQfVAfuBA9cj16k0q2TgmDguVJqcS+95wzB41tKwcYBACsR9D1yckMi1KdeWKPzeSdke0iqI43YA+JRPp27En16k9yjWSGIyss6+MzB0RYxEFUDGG9c9/r9epHFRB55LXj1sjSxeEk7GjAxKsVRlIKq2cfcfQdMrfMrM19lMDOHSxVbewrymXWeYmijsBwSsySyQ/eHI+8k58h6n6fXoZMV7QaLuw2Up30UTuWEMsloMyNJIpiAEniMY9FwCfTOemlvmDLV41ODYwbSrVu0iyw3ElMhqr4vX8Xxg5Pp69yOlS7XZK7Bq8viZCQwSU2JFITwdSMhe5+4Duf19cdKjQKhvw0rCeIa1amk/Fhb7REHAwpkK/Ypwe+Tk9BHJghBstK+83t8znioaeu5Y0NfJ5STQmfxSGBvH7pnH9MswAjBz3OAZKxll6YFz6/wDuWxkt2qNTTRgNJR0WuaZa/hk+ALOxcHAHuFiWZh3x6dBZrY31Rx07tbq7BbEYsNE6ylEcGOPyXJBGRjPYgeg/bo6jPFKqSw2lezBLBJVnDLJHXZnUsWwY38fRlI9fUfT9egVZ+Rm3J9JuL+71u31Fd57yIanuBFk9lXw6o6t4/wBMsPLPfx/x6Z0KRpWesOX9vn8fx5bBWJBGpgrZEjO2M+DHuRnPf9DnpY0qv8obcXkjbYrXmjrTOIY/IsQsh/iMjBIJHcjPQAAuVHumKGrYZI7DN/cBXSMtBXHaSdY2A8mPdR/qOSQMjrkYB9Rmuyz6ulWWCproxTtiAhg+P4JFlsqCD92SMjv6466K1Y8nCWfKFP6SLIJk9gjv+gZlI7YXt+3+PUjRPDN5TOEkaxZgQqthiA6xsQVVj6EeR9cZ6gZ5B3Ss2FuGFoEjqWfM2Xhz4hf458SoJye2B1AsszWC0E8UckVZZ2hpyYnw7eKu6xsqgeP8WDD/AIdz69dAUL12WvTWIujveeOtXCwqB/Vz5SMqkZ7dz++OoFmPkVb0SNHR0FCZ1bX+1urUQJKRr5FFEiKceYx6N69SqLM61SlttjGs1mOEAW5g5uWYGkSMliT4BH7R5x9w9Mdh9OvcjRYx3VxpY+SeRW4se3PBr0/FhfyjKsjhlbJDBPrnGB6Z6lkrcD97MbbHHFNUSp7+AylIV8QPbQKfNV9PX0B+nSxtAZQjku1ZdfsJDXdkYxMAvuBu5hnHmfr4gj9Rk+nTJgsl1hdqk2nmrW6VcRj3LBEgtSFSypMp8XXzHoM/XGD9Olv1Nuv8w3cnoxayOSOBvzIJ2exVqkAztgEy9sHAAHYen6dQexZsfjVYatlM1xGsk/jB5vl5iMsS/wB2Av6/aP06g8DuvRiEbSzOJLDNlpZBCyQzdizYA+1nXH3enYEd89AAZbWssTxVbEcX4ciypK1nyZh749z3EUgAd/q2CB+h6ALuqhr7GKxpp7aN+AYzKasUkc7r39qwiuM+asuGz2yDn16b1M41i6U1UGa2/sI5r2m2MUNG3DIsNqKaXCAmHzNgMw7xS5DDAznsO4PSxo7BVvxey6yj24p4VacVwQ4WNsKvgRnsqrkf8cfXrkASsU9xYLVJUS5YVUkhmkbMkYUqR2LDJ9QT267Fwzr5nevYVX/JtQRCOramC4BhOBlO3YfTtnqA5NE42lytbVbFuGOxZ9kpHemDK6yKQoVRMOzH6sew/wAMdQHKIHom/qjFZxXtVn/uciYRWjcDI9soAwcvnDoQP16AWZqlaHk09aKSnyZlk19gtBX5KYo2Rz5eHjdgAxk+vuBcfqM9SVvG9Imh0ccccV/jFwXA/vM1EzlIWGT5GBsYViQMAnxx+g6Z6gtk54d0qCykE0CWDLx2XXxlr9HZB5Pvll9uIgxDxZcdlPfJ6Cy6ekWb1UPEYKNZ4q1lMVNxA6J78kMg8l+30Pr4Bh4k9jjselBgj0vuym5so7Uc75MgSQMi/cCoM1cqpkbxBz5fUgfp02dBZaFPX61ptZGkEkkK3WFYSgGJgShPuZLZJbwA7L3HUnufO3yFai/snJr92xIKUn4etpw6V/aazPfvQ5SQkN/TjEX3tgd+2emDAe7me0f/1vgZdvRih1cRvQTvFEjWhVeVpRM6qjmPCH7CDjyOD9P26wB9/wAaxDD3y1FcnpuxXXW9mSTHOIIjEI8d8MZvE+IJyT6no45YecS9ca4LF6xJ4CEVJJY09qeyPIhPQnz7Kcevqc9At+TQdou7OCFIa9bY7JjC6vJLftMi+B7dkiP8nfPYEE46W1LLTJzzCTuaGu2UdPYazSiPda3yRthNNK0ssLALIEi8SPJ1yF8/457dM8jUpPB1pqsp+rVtRcllUSJWvGswNZSXdKtlllSUY+xnjyPLAGRkeo6GRb21rRmpSj/UpVaFClQgB9ut5sVhwAWY92bx7ZJ746WNusqTu8ZkEUbgPG+Wiw4Pgx8yFI/w9fTpYNWSQBZq0rpMwlT+v3C+QJGD+mMjoGd6Y5LgeCpKrujhiJApYlwFAXyAyT6dMHR5LWV2sTM+YoSWBXJYy9wew9M+v6DqRAhdn8oqlZ/C1Mv9OzOoIVAv3M2PVfoB9T0HkyzRIbJkhrRayn7kcQy91qZVyFJ++Uk9wzZxkD/6OluOVizPMJq8YMiRGuGFMKaqkArECCgdCPqVPfHTRcFuxKhWXxP8THG0YyP9OAWB+v7jpUe5JJDa/EjhVj5ylm866ehDegJ7YIJPQKsky+UkUckz9gfZ9snLSBcsF/XGe2Sf/Tro4BhtKJLHuMscEfeRB5IUkdfIgj1JwOmDkXIZP7RUvbr8NZLuw8sMZGJjBX+kixjufHOWX0HcnqOKY3JM1pgUl7VVaHtvdAkb7ysbhg03+qQgDOc5x0yaZbWGGGkJksw2toLTaKVihDxSgxxf9pIbBlfPchMdhj1PTJkfcrEHaC9WUS3tqt1fcqbOWS00lQtIgaeKNk7/AKD1A/y6VD21koOFdDmmhehTtV9poLMtKcota6kSMXSFgmchg3g5I+vjnsfXqeMa3yUH9CzVNmTeWdZY4/Nr9ZbiaVb2xg8aM7SLjwDq3mjx+mSo8gO2egyWcvTVYj3VCtTX2VszCWiwrvOriREIJfMa9yYyG7D69BrcazWhqxDjY/KejVuwa/3/ADHtyPHKI4mPn5vI6rhs/TzxnpQgXLoWS+xCigqYu2Z7DhmDBinZvHAP0H6/Xt02LDAY7NeAGZUSuCKr02j8/wAhHXKK4JJKqMMWHcHt6dLkizqdnQr3b4nkWG5PGyQskTtH5xN9oPuEZBYgkL6kYHTAKskEHI7+qu+wkhgovMJr0VePAitSDxz4IWKRSnBIByG7npb9SMn+gE5XTuU68m4pQ+5p7jGGytc5ahalY+S+62AIJe3gcfaSVPqD0yLrZSsA6/5Nb8SXZRK2AYjcVyrxt4FlVQCR7ieuSM/Q/XoPcNaq5sa0ypBXW1GwSWNZQfdRmYeRH+kf8xA9M9ugksabYVzZhD3bNzXBw14YVCiI+BlZApDLnI8fU9v065Fw5uW/ClSyYl2NbczyS1rOvkbyWqYlDn8cEskhJ8B2wDknrojjVgBuTVr2fYikl16zQQTzklnU+QAK/apOfE/cAPUfv0Es/blvi2o2F/YT7bZ1/eOsX8HTUbCwqhnZfba1hCR4pGfANn18iPToKzJM0YQiu2nqfmW/fq2tDbMjVILJkWab2QsIZWQE5c9wCCMYPQMrYOyV3TitmWeXklJqdqVh7cWwYwSRzZLL7bq2EJGDjywfUD16CVrM1osWqciRCnXnnuVraLYE1xxMkkYbJWSQMjeJHbGMenR1GfJ6geLne4mS0ra5DQiDfg2tPOv9B8GM+SuFJYjIPfB+h6OMQtm4Bc5TNt0ENluLXqlZsyRUbEf9H3G7L4Yc9j9FHY9BZss+qZhxek2t+XjstldihrbzTPcm1tpyJa7VrhjeNgikByzBsAgd8EE9DB83/wDyZsabOK3JZEFgNJ5md59Yk00bKCVLfdGPJvtAOewPQfQFsjD64f12xuRSJWGlsoy+cUF6z4LH3XxGB/Inuc47no4xH5IiMWtitW1iX83+3JGCWqxJhi6nup90n0/l5Yx1LILZyttA28+trWxPaZrc3uvVl18MpeaWI/aGeQBvAk+gyBj1HSpDWs8wpHWVdXs5Xo6iKnqL7vdq1IpnmSOygEshkaRB/JE8VRcAYPVnyTNtYOjBaDul0+lv/wBrs1rKWddA8mwiceTrKTKHKyGUlsxP3/cEYx0qyaXG61oR4aSIvPIPJxlnErsXHkMEnBwc9KmmIRMr+bK/nWl8CTHkMGYE4OewP+eOpE+UWp8ErKJv6cq93yuB2Hr27nHSw0ssRJiU2SZI2STE0gwFK/RfLx/ifrj9umDo8WsoeLB9yww8pki/1qi4AHlgEkHPXRXlOEJelWfwBpVpgVqsPEyyoMhlz28Vx9exPp6dK6iTWSokZlt3Ng1qRpJFUn8Ay+JRjjDSeQ/kQMhe/wCuOmSVuk12UK1lREnn9vwaYNI0oHaRlUofdH64HUF4V3YyOvsMCVCMJJfQKBn/AB7Hpf8AUhoJrclUmOEFvbZSJDgduwCgnAYdz2I6Cq75FcEcKeAVXXuWbHkIlALfTucnPp0De8L+2b86itTzX86+yxI7OVWOMjyLdv4/b6D1BI6ZK1lmCGAEba1UqDX6RK8dfX0H99kMnl7vgAFBfuFOST4+vbPU8UzmMoVwHud1qYAsq3hJh1Wy0imXz+mAV+g+mfp0x1NGyzALdCCWantRXmrtXs0L2pa1LIYnP45/N9tAoYAIB/HOSTj0z0Mny7JtfW1Q7ptnq7FWaW5IHuS2JDBGrSFpoVContYAOATjHfy9eg+krMQhrb3k9qCyIJhe18iWKTJXsL7YVvuP24zlcgl/26BhlmGaEcCaZ1lLltNWuvXE8ewj2AP5BrTjtIQVHeu5DqCPXPQUizN4W53nlvCaGYxtUIhKr/ByV8y2T9D5YJwe3SpoRi1m1lMRhL+8U8oJIrnlG0bSP4oQe/kpGT1B4F5XqxRGo0hRnb7iwx5Z7ggenYjronjlealGYgEjEk49D5hh6hlJGfrj0/XpkklaOMwvl/ZdgFBTzzkHK+We2QfQgZ6UOSxb5JqpNS9XkuySjYqMkoukMFMxwYpV7DLgjDL10Ztr6O6CdfsYtpDNce3DZB8Y4nrEeMi+WAYyM4DH6HuP06gvFmK0NoIy3lQKJ4lzD90hiTJCkY/j6Ej6nqR8hrWixmrwwu8QQRTuWGXLgsrA9sEAdv065PACXRvrGzqXKNiKLT1PaW3RbCGZpMK8vkBnKj0Oe56bF2vVLkcNf+8SXa993uUlMNz2mXx+4FVkx6YI7nP19Olhn+UK7BPLXbCvegW9r54x/cK0x9tBE2cBwASxdgFCj6d89SPF+aqdfqpjICL21aOtGIW8G8pMFVVxkhYgAWJ7YH79QZX7uYoW9ruYKsEcftboBmV5bIaCeKNTh/AQkZY/XP0P79AM4L0gLJ/aNtuJbMmwSKMRK/8AaoCa1lJUX7ZACB9oGc5Zs9Mi2vOhunla5Z3Ce5pt7DcqI34Ozuyrl4GKkIsbJ4+fp28QxznI6OOMq+5axLLa3WvCCzob9mOpA9htqSZg/h2bzbxDBiP279LcQu/Omdcm5bDvNEINdprV6aN19kSQqa4UyAnzzgf5Zy/p6dWSyxS5LOwzQhbiDaaLXTG7q5LxqXC2nttSsyAReBTy9zBV+5YKp9BjPcDpbjalJg8lBDDSGHa3jdp2l12vtxbCOFk/Nrjw9oDH/VZ2TMbLjK+vQNM5OE80VTklbUa+R6D0FtRSzVNrtlY1rghcwSGHxVPcjVyUYo5Ct2OCMdBRrZs7l3CyTxNHck309V1ry0dYwRXyQviyoG9Gz2z2HrnoGfJzzbQSpS7h02GuioVNTVsj3ojGGMq+vY+0SCABgE/XuOlmjSYzGeqVDY2P5NbjpoiaEJ7lLfXJ/DyiZyQDlhllIx5HPjgeuT0DDes8M0JasK8STKylb9d1F2NVPi7OQGYnt9revboLNj5hhYIaMEnssS1oqFswEBWXAB8voD2+36YOT36kWBf4NSxa2W7rotCwyoNukTeYYxoVRniiYhXAxg4yRjPUArQL1d5YYqlqxCIKs0eFQEMzZU4YtjP3DBKjuOpAtcfXV/3VP7gXX8iUzyKfGQrXj/pFR7hAU9+w9OoW+YMq2LRc5PuhLZrR1bH9ymrqYYjEpMYZCQviqj/l/kT6dMiyytEUzep0JTTwL9++fZuiONvbGYvIuzr2VVHoPU/Tv0txRVZmtMXKushirpXqq8kcfkfMgGWVvEHyZVGSW9e3oMD6dcl2LKpUFqxFBEXuhfEyrh/bVTnwBXsWPcHt/geuxch2E1lK9lGoLYnnkUm7L5JNHGP6ntZHfsMknHb6de4rxu6U6kIaGHeV4mvXKkXsolchBCLBYoWEhGCwDd/Ujt11x9SeToPfEDw2bc2v99f3Ba+01tyxR2XHYK8jVNpBW8qglSwcNAGOJgv3sv8AHv0qDTMwDgaW6BcNZ3jornWUKfkj2J2YBpEQYKl8Y7n0GegrWWgLTG7oPKsOssDa35LW52ATDstfIjUrnPcegx/j9emQWa62hfvT7u1dlS9R8jN4xobK/c8ccnj4qftUl/UN9fU9BDOSogSTSbKrzG7LDqnmkvQRyGFJosGGFzED5kj6uewz49j6HqClxmTghcmllNCneaskX5eubzgMizwTyV38jgEhfCQg/r6/v1Jt/JQgu1sZPyIbK6l4EdvC4SnutEIh/TlOTk+OceI+hwB1BW5OhNBTJIBXpbtMJ7lfeRxlIK+IgJkHkfPyx9rfQD9OumCPbTPaHyogspYqwI0/tIHEjOI2gVW8n8ZWxnIH+n1/y6V0Ltj5gPZTTvXX3qJhlrSH2A7hwrSMEw6kHDd++DjHfqRYt6mpbEYirSRS+JaqboJaGIjOPAnBUID3P/NgfxPQAJ29ivDZgnthJUVhdnDQuJZnRgGeVY/sPlgE/tjpgOWT7jcTw3Y9hppUs+0zLr7LRCNpfcXEsUzB28vP1AwPFsHpQYKtlbfLqME1ST39zVjK1FuIym0AQZa8wwPFwcmN84D/ALHpspFmaM9IzWrJs7xvuabiMEwy07ZZZI51PixIHdGhwQyH0Hr9D0FkGILMisktELhPaDwyF2rrnxDqhXuVJPmQT2746ACNu8wt1GnnkpWEjZ46NZAkZVHPi4JyuSe5BPYYyMno0FmPkN0SRWdVRtwDxk1qz2d5TnkSGf7kPdGBw3mf9P0bqCRbeWtPqjsZqU1W3HLAGji8wEkwVwnuABo1UfcT/q7jpcZWWAS0NluJ6+qoW3etsZWTYbP20/7dVOXZnb7vuRvFcDBZhj69MiulnX9x/ve9q5qlXRrBqpNfEbMVOyFMMNKFDAhKrn/qYOSCDgE4zjoK7Fq8yaaUHz7HW7CYNfpF61dznYU/OatNKAvmD5YJ7fQg9hkHpUYZxfpHcVTj8ULXOMXJhRqlZPw6k3v1wGOCVicnxwew7jqRryUwFk5JtNDbjr6+lBbsWma3b8pfC5LFKSg7v5Ln0BHlk4AHTJHnYK5+2Gw2+2p3J6mhvEVS1T8ukqzGPxQKISEf7lVT27DGejUsuTW2j50+SKlzZ8btXSh0UPH7NTYO9wlFtQxW4hIgIB8jk+TFhgYAx0GK93UJj//X/nzp7XKdZpodduPbbYXI4oJNpVskPIiEOWjCRjxLA/dnvnr5ufUcb7Pm9ccKPMuQyqliWGpBaGITanlldwncHCgA4GAcE5z39OmTSL+z/VnCVe7yDbjws3CkbBvbr1kigwo7Fiw85CGPf+XQXSuDghLdKtSjPkkCJO/kPzpCJHBByfvPftjpXQtFfmFYGrxquPCKWt5v3wARkLkA/wDEjqT0Fm9x2pZ2kKvWRoJlaRY43kheeGQmZ4Y2ixghvv7nPicL9emeSZ7JYytNVC4k9tl1zWFiijRLMMzkkS15D4gA9/JlYFG7+uM+vSxeLs1i9PBHM8pWNkdQWrWDhmQN49yM4OceOG6WGeJAdV4HMjLYYTIS7echVSSBkKyjBx2/ToGVSJZXSz7x9qQsHltPMis0UeAnkgY+vbxH+Z6ZFmVqwMi2DPZarSQ3bcytZhdsFYxjs0hBACZXGSD1HUX0b1Lt+ZtRDTrQrHs9rfd2E9nyw0vj5FgF/wBShjgZwB6dSVjNeYioVWWIIsvjekykwQYBIw3ct6j6AZ9OgsVliwg+1kyVBzGYR5BMZGTkfQHGMdv06WGuMTSjK+Ecf9QFYimc/aACCM98/semTyJVYFCyeIkhYpKFbByAGz3B9P8A6eoLAmWCNfxDJEU8/wCu1ZSD3IIDd+wb9vToKgXL2tm2M/47CR6+uYSWY4BnJb+Efkc5b/Ux9QOw6lUQzjNEit3p4r9vV0dSNhFV8KkmwUxJB7q4Zoy2fJyjEAv9T2+nTJm1cJPNCLG0qbK/a/P/ALKsUgUSYDHxypIx9oIYD6nt2/Xo5Iqz7QnEv8a0s8lUVYKkKAWneu5ZJpATIWz45RT/AKu/c/t26Wa+YvkvbU8MJ5oN9sI9ZA2v08e3FqbBN6Z28JIlHk0efuwG/iPTHTW0HtrB1oao9x8n5bKtOtcp1C7zR0npk2TLG5wxLYATGO4B7H19eo6Gt8XqTbHk2/rbC3Qs6pZYKbn86xFMZJGkUCbwJ7YcqftBznOB0Atgyxft1ZnNnSXInp1Asc8aII8xovvyAIfR1Jy3+B7/AE6BVZmjPSJX9hzHILEi4Ro7EVDEcIVsSOiucBvLK+nbJ/foLxlmiFoYLe1jfKrfqu6TixvpFgRBIcqPcRSreHYEMAB9CfqqKqlWc3Y66xx2hNHVUxxRpH4Dwdh5BXfPkAvZS3+Qx1P6jTIqzauSB68lSEyUEY25FtuZWhlmPvBwO3k2MYz2HoOmdBZUuRyPZdIfdcSU1NkPMgT+fZs+Iw5A+nj0oMBTU7elJft6CejNsaaQe2Yp198T17L+DpOQME+Rwo9WH1yOmylZxlG6DNtqBoZa4ZXn082V09+bzZajfx/GkLfb9uMI/wDqHb1HR0LNVqsfob8c21alNJiKssft1pXdSqsCv9IoCCfQAH0Pr9OlD3LA1cE8zxyH2rbs8ccsMhLSsD6TxyZwAfqMYPQBXe3a1Uyw16zVNxDG6UhYf3RLKmZmbxxhSyt2we2PTrsXBVSpduXKGshmlk2Gyl8Wv+ahI4WT3ZJ3VvRVBxn9cDpggZtrXrijDxpENWneWOk7ofb8KcXoqOuCxkIChz/qLZGOgzaqs7k9SU4KV2uhvwpI68qJcdUkSFovYb28EIT64C+XoxHYY6DRlSTXVo69elWrNLYSQpVivMskhb3GlAkFhsMqAkAnv9MH06WOlQPR09CrXfWQWbeqtHwiiHukssshLPH7UjFJFXx+047Z+mMdQDRafjT0rMVVeRR7BrMgnuVdjBFAAsQPh5tEwypP2kdsnv00LeMgmAPJIuRCGnNHOlbWH+o+pFm48eUYDxjMwPgnj2xn9xjPQLM4MyHXycin+T01ujsQUrVTW/3m/rJsKLdd7TghZnVsOjDBU49B2PUsGAYxlaakb2vIN7UnqtBCkBpourFVJ39vDMWkLgpgucAZYEDpU0a3s+YPrynetGIqdalUd/D261f3LB8myCQHKgDJycjpku1vbMHdLsiXp4ve2thrkLN7brLIkcbOHAYBIFAIJ+hz/j0F4tjIIQhAlaOJBHEkEaZDVY1wTkjv27H19elx4tzxV7VeWnD4k2mNiIPhvCWLur5H1BXP7jt0ALGo4/FWme3WhRLSyOlSukkpSGX/AKrQSJkAvL9GA9PHxHY9Mckyy+M4c9UYq84vRta8vc96M/jVx/1MsfEh/oO4IOf06WNatQPTVcASQuahdXZkCjxdmcfVskD1Axgds9BHFJGT/tnXxHuSZiZFwcKcN9pH/N/+DpYd6laxKsNUJIUjjd2/Clqe2GnH1LH9iPFe3oD0yVXTTcItaz7sIa+a2ujbxuWX+1bAUBvCMk+n0Yj9MdR1J5WpDsLct65Yp1K0UOuoyLFfsoJGlZlGAhHYAY/Ttg9SUiy1Wa6EHiKRn2mMtePGAP5AdiAi+o/4Zx0Gj4xMAI37r5iMMwLFx5E984HYAZ7HoI4pG7Rxu8rIopxDJLZzjHYY/XJ6gcLCqsksMCIrJIw84vPIAUevp9uMjuOg5a2Tp1WJbUvdWR/fWxKftEaDHcdv4j6dHQruLqL8GvFQ7HkFzyAMTX0eyoPjEB4qPFsebSHGF/X9+mljIZNnSaakUF2WytLH58d/FzGIJYrLR+SDvjxWI/dgg4Gc9R0D8XnEW7q7qQP72nhlrP8Ae8FuTxJKEkIG8ThsjOMkf49BXfiM/wDUCV5JazVNheYTCwDQ/GpyPE6SIjspRkVSSSQHJHpn6YHUr/cGbzmMnhmuj1rt9vBdrVW4fF7MPjClxbaq3j4BmZW8M5yO31PTfJNat7Qm9cef90cin8fDTVgjpm4ZLkhMh8soyMUBXwx6EHv0p0LH8ZLVPaNNfr1rOjjhtbBWrVolkDrZZyPteQ+IVgCzHIIYdgegW8FRKF2hV0dxta6tLRkDW9dcZ8ztGsmPDPbCoR449cY+nSxeY1msVI600RUxoQ0kjARKMR4zkKR3IBz9Tn/DqB8sS1bUswiycSt77u5yyg4PiH/iP8OgAirJVIEjCWOQjzRQQGUdl7kZx5DvjoAsykupdR4qv8Cc5ZvUdge+B1B4A/YUa26qjU7WlDZokrY9u2GeN2T7gSyFWGR6kHK+vXRLKsMtooajScZr8cWjoa9nVs9mXYwbGdnszNcmkCSO7tj3IyFCqoH8QMd+mTI9eHtFpK9pPy6dpRFfgwLXifDBHceOe5BBz2/z79LGt7J+mFiCmyOiSyV0/Ji9oPnyDKcjsCMKOgOyEKDRT1/yY7DlPGWKOFnJTxkX1CYAZlx2zjvnHQyCxJDrbdYM3sxuqv7ngFOZC8eQHJJJJGfXt0DS6x5roJNpbeC3KsNaq4mdXwUMoAUAsxwyKMHA+vQUebZ7QR/MNma7f7yUK4elr4JMxq/iMO2T3IZvTB9AOgaxq1GA8kCxffarGEzZRIZVXJIx4vhCRg/qfX69QPgmxQ1t2sIXiZxOQzxWVGPIE+TYOe+PX9egkoyaarSnrPSeXWrWKSU/wCf6Txgr5xhvIKSGI9PqR01oeHFh/oTa7a8jr2p447kdioA8SvYhjkJTywz9vEAY/wBOc9AsqsIPPdlu0r1Zat6slanMhsV4KaqxikdQxIMgX7Vz2Hc56aWKTOYOCiGfjablF3VW+PaifXpJSks36sVh53ezD7+VaFMoAcADxYk5/wAOluMZHGLVoRrsa7kMta1Yub0RuzffDrqcCBu4x4lmfB7kdxkdQWWmDFarFstnNDQ2sk+01umaSOpBsZ7FiOCNp/NxFD5LHD5sfNlRcMxyQT36b4xPjIIZjSLtVNcssNWKONWYTsIIo1YApkDEfj6gYJI9R9eqs0i2oHjuB4XRP6a2E8vKvjswOAWBHYY9DnH7dQWSoPlaNjYl8SwoKLRgvYSGUYHmMxg4OMEY+o/TqRjslfabGv5i1Ytrce3gR/iiRiqMnkBGxxkxo3mCfUZx6Y6FRflXgmLlaSnDWneVjL4vLnCLOFACqSAfT64+vUalm18xEv19nSn2H48zVrVmR7FOzQZkECoAkmSwIVnGMkknPp0GZNG1oWaOWdgaNSvGXZHwfddvuAkVs4c+XqPXP79QXZQmnuRKbiQ+0rk14gBH9zePZWz2AHcnPUnuUbHvrEZ4JkG7gdZjHA7R+BlUxoo9C4JPYHtntn6dSZXJXbQiSWbGorxfgSRWLuxYpt9rZjwYkMniQ+T2dcnv/pAHbpkFlaMNodtbZMBmqy7OVvbji9p4uxEP8fMHBypxgntkHpcuyjWmaKLYbCU/iqJpD5SqY1lRQVzER5Ej/D9OvcWI5rCXBMFWVJrJMVWOxGEfyA7j3EDfc2MnpcZaVAeso1Jr9OwbDzzYeDwz4RGFAG8gmTklxjJ/fpkV2f7hRBYe3sElUlJMRVolIV1rw4Hl9p8fLzJx+3c9KnYVuX5W2VXUULS1kqRG5cevKjofdDEQFyPFmHjkgEY6krO8LMi7aA1pzuLMbxN+JBLKkKMvu91chRlQfLBOR3746ZIWxkEJDeq7CEVJByezfiqBqlW37EIrpdH9X22UKBjJ/ln7h29eghnGQzFaxudxNY45ZQRLdrG9Rms2Yx+M8MhjaNUiBBTxVTnJ+4YIA9OgpsZg4JnZoxo/H2wjgCz04IfL3WRKICLIz+Pkvi+e6j65P6DoNZ4yECXm2NW+VqNXsMrmOP8AFgZzgZZmPmwBRfoT3B6OgeBgD8VSvf08cliL2d5KBYW94+2ZYVcsk0QJPiFbAx+v7HoFsktRuxHalnhlg2RaG8FK2RXjVWPmnunC/wAQpHcdKl3yO6SVpbHvJXp2Z7EiNiWCUK8TtMMhz6OAoQ+RB/y6aFS5JRsa5J44pq+s/KQ+/X1//c5yxAMrkL4N2ODjy79KDIq7DXzXppbCsRs0DVlPuBUKO3kFAH1KpjPqP8+mhYqRTyU4EE8X4/gFrSVqsRMcZkJBww+4FSTlj9T0qMlqS+NBHHLL7kieaa6WGuxmCwSsPuRFALS+nYfyHbOemxbJY2sMG50wvJZ32qpuNiVKbbVosinYxxERNICmMSRgdv8AnH2+vQLrM0bQovs69alE1SRlrTTLBPJ2jHjjx8XUAeJUZBJ+pwelCxC70680dMyrHJGUbLLLKiAxkDzhZgM47ev1+nQBzLVi1sT2mgms0bA/o3JHWNh4/wBWQSBAwLME7kjH17dAAm9YtXp2u3ZiaESLHR9kmukdcr7qSlh/zehz00dDRp6k+o1y7bYpK1rbRx3LcUgQTRQoxFeB8D+m2T5DGcuwz2HUmRyTNaalECEhihoWbc1YzW7M/wDfrrK49tpZGELRIZGJUIo9vwGcnuPqeoLxZWjaLy6+jFKsxjlWaNGrTtZmc1kYS+8rjBHiVU47D19fp1J7C/Jp6SXK2xsVZqayhIKbwyLGslcyEsz+w4IkXsVLHPfHb06UGiw/HhJEN4vK5I4IpGsVReq151aTt7Y8xhmyTg59T3+nTZX8dcglo7qLWzR6maCveji/IOygs2l8nyXZZliJDlckegP1GMdBGuD17R8+/ItrY63jMzWJI0lE1eim3HlKfcmtxpG5QjHiGwHODgd8fXpkxOcxlE//0Pg+prRWS/FGfbio5qumCUVj3V/BmLAduwAx183Pu2E2CrVcGMyWohLNJ/K7FIDkr2OAV9SBj/D16ZNHyBr0zL3/AK8kqzAJEZVJMY7ABsAYHboGlvmHIj7U6RpIBJIPYRoyMMrAsT3HcdLHZ1OPFWkWZXjHtmXw8lDevrkEdj3HUkgC9trHtQyQxeM6+M0M5DeSyxElc4A8v0P1KkjqBcNVIqMetr2KUfg4ka9qK9hnJT3EC2aY9wfxcgsAQPEgY/XoK/GrQp2i66STQRWtROizsI5qbp5eDqe+WycFceufr2HSxeMn6KzFO8c0LArIPelcnDSPn+JDKPH9P1x0ByQX/wB3Jdnqasf9y/k96eyoaKIMRhSf0UYwo6ZK1pqCEulaWgrexVgN/aWQZIovJWedsnDSPn7UXPYDt9PXpXd1/cV3iPXeWypJq9vWZ7EX3PHC4iVhny96I4OHQ4yOxH0yD1IcaasTVPeiZYbxN2QMRVuRAKsiHK+Q7giQY+8EfuO3QaXGloRv7ZiHl5Es5YeI8R6AEk5yPr0DPGIlmme3KRAUCokPvozZZwCQ2T6sAR3/AE6ZFu6d2Y3f8lPbYIyk2HU+IfBX7Rj7iM9+2M9GgNFkyTSSxRxxl5pwUpwynAyi+TMw9fEf6s9gOgVZZowhTapX02pjoxf1LlplnS0fMN7jDyeZiP5eOe374HQqUjOLrTXRVjStDVWCqfbSsG9uVD/E98NnuAzk5YY7k/vnoLgp2ZmeaEI+HUCYIykCbzjKFcKcAg4OOoFzJtjamqW7I7PO3uSfjzlvAuqsFAIIK4x2+h/fpoRyeyLvxelOPS0rFryetShf8yCs6rL5SN9pUMSDgk5wf8ehko/Z/wBkaRWt+/Z10LKdlWrA16lOQZdvMFS3lGQMgtnBz9R1JrBlrpTgqfj1SFWpmG0GKyShvLILljnJ7AfX/h0ocgOnM+s2ytrlh2EQb24xcYxRxyOvkyydiH8j2jz28vU9NFRkle4V7NqRJV1pX8TXVA7QtfPsKquxE64YDyX78J9Qfp6dAyq1WH14bVYUKFWcrE6x1adiNgpDxRKUmVj5AJ49nDDJ9B6dByL2weKeGWvThaGpYP4CwVR4uA4Mj4GWx6Z8sfoelySGOx7dNtdD5E0ysdEMZJT7bn+ZcnxLn0IH6YGOmCDpXmkanUohal+5/wBzHsLWWVQxEbSSL9CAv8e3kfp0EtMwQw1ZQ5mhxujLT06tf5FLJJahoZEYsT/yazYY941APlhcYyAg6gyN7JTAjUbq09expd7adlsuK0d+eJBXue4zNLXcPlFbGQjdvIDsQ3rJetLd2IobXVWeMO0sEbbnQRhbHuWSfyqKYx4zMoDPEAT4uvcYHkPr0FioXamyt2LNWavWrV0k8rBuR5DDAwv8y3l5Zz9vcdiM9KDAOjrU706Cdc3ZP+6vSXbSIqTxESeTeWWCEDH6/wCR6bOh04hUFDVbjnVqpI8+0oragq2IkSOrD5e8PETN/wBMlckk/dgYAyOgo8kz2hNgjvbkJbu1K8+23X3QyVH8I6cfn/TWNiSPAZyQT2+7oGNbJJUdENuoLS2JaADhpGJZpAR9kkpTCsp7qoz9D9eglVoh2N9RSeOONhYaJRXmnGZW8CTKyAnJye5P1z29OoAXai355ojF5JarnPuWvvYnw8soygrgt9v3YGegZ2SajpJNjsGt32NSjrWMVpgS0tj3B/JhKSgJOQpwf29epIDO6nlh16623bIqUhJr9c1h/It6EySFUPm5J8cjIBHQNmR8f0lObk17Yywu+x1uttR3Fd2cJENqGj8PEhlY+Z8iP079NsnzZlb6w1a3DLXrUQZVPvDu03j4zwyDPiGTyA9fQkE/49VR9AW/QirrGTGntSUHYiGOWJy3crjJPiCBj6/8emywHyqnlVhiZvBqxKL7g8Qx9QFPoCeoPQt1W84/GOQIkX2lMAgOe/iB65OT2+vr0udFW1ZlptBlwSQnqGJEbZ7Yx6Z+h65FwELMd6+9OzG9eGwVVZYjKn488X3V5Af5DxJKsfTBxnqdBBnGVhtc1Ib8q/0kGxcPZj8jlNh7RLnxz291VL49Ac/r0sXeMZhOZnelMpNkHW3VjgkgyRmVs4AbDeI/U9v8emjyI5nEtOZ5ZAsZHg4jcZiQ+gyQM5HbPQSVadCxucGZPY0yENXgPjFLKEYAYBwRH+uO7dQVHJ7RFc2EhkqVdJVSzX18nnamHisbCLIEEWMAd/r6Z7dLUNCOHOEJ4BeVdnriYbyFYTNbckTZOGhlUgeJU9lJyAfrjpknG2SygFqJ2SF4nY+crzYEiH/UrgscMuP+H7dLGuW1rHfkUZrAQyRrnxgY4EgwcA+BJPpg9SK3SKsZWhHnEYG8GeZACe3bGQxx2+mevc6O1DRSxOwkTxR1iiQ49tS36Ad8k5J6k47oQ1+sk2UxgZfKlVkb8yR/uWaSMe54YHcgE/cB+3QLtNdZqZW38lO9s4kKgw0mQyHyIjlsRDAA/wBKiMHI/wDd0FdjVoN0oOY1f3Vf2xL5j2WGQ48ftdgc98+mOmRzQUdyZJdba8JWaOR1mYMXzCrAKwGP3GRjoPNlYxe5er2thoakiLZq1rrztYOfdMlevJ7aEZUEZP2tjOfXPTaxgvdpt+kRZaWuvq/lBZCypXdce1gHIUdif8z0ox8zV4SyMzzo3nOIvekhysyMPDyLN45J9MfXx+vS5bg/fQTW6T+wVheJl8AMnwkDD7kJ/wDd37f4dQeLN4ZoGHLtXWjkxBtNew9yRUz4X0j8B2x3jlX+X7f4dBkmbM4u15LDpPUCv+VUlaCeBhiRLAGPbYfqPUenQa34bh08kwDxyQlJVOFf7x7fiR9wwMEHHf8Ac9QL/wCEU5NikhSvMfccHPuyp4uUD4+4DORn6jpsYGKGeKnK9lsQSVEbw8sBOy5JUNkEAZ9elDkHEWNwytHFFFp5u00gY+c0jMreESjuEbGCw/THoegp8lkqIQ2F6zmOrpZUrrUcSzzlPUx+sKhj9o7YLr3H0756kXxmM7spAXr7YMJA1TZw/fA57Sxtn1c9w0b/AE/UfoejqQzaBDXrkUn42yH4tqGN3ijHk0TYH/UiIyX8QSCuc46joWSzNYurNXggrpYsNThmKxTTRAiOIN5BWAbsQxP+XQRfObF+enrmuJfiatJ5xhbRy4MZ7ylsqQFQFgMd+muONeSow1JRgeXXU9VXra0h02caP+QchhHIod5WRx5KfoO3r26VKNZatNVIIZZPbSH3o0ox5MRLDs4YAAKvr65Pf06noabi6l2nNHG0bWoveTEkNj2/FfMN9owDkjB79v26OgcXUCwG9Clc2rR3j00NWS1MntysHJKllyP4r9pP16g8ydklidS8Pv8AkPNHR/tKn19O4I/foAEe7YivokeY42xN7BAAK/qR2GAPXoAz7nFt2sRyytHY17+NYKP5eTPkBSMgsR6D1A6bXEM3rWhmDXEdo1O/s2jV9hfqtG+rp1UVHljExRWRif8ATgZYn9eoMTgvsqRqu32X93rtflcwSTxk7Ww4CkOFJLN4gdjjB/XqDTdkF8WuF47U+fGN5GrzMqAZQoXSQ9mwRgA49fXqWThYm22yqyxIgeRFxHalkg8j/q8lRQyg917k/v0qNiDqJnTZyzxzsmts+40UQcjEhJAjGT/MEgjt3z1Jzs/3G8ssVJpq9YPbWTzYTPkRk/ydD2UnH079+3R8Sz5Gos63XCTd15URYYLy+TUNmsng8ULHMMSqy/1ASSAfocd+p5NgX4t6qEZKoeps6MUhtWNazSVZahOHiJBT7sD7l8fHP1/z65GGlSxVlheBmtVGSO4rzr5eP9F4mEeSAfuYn0Hpj16ggq1/yYpVq+T2jIhkjitzKZcuwUSyqo8VVR6Aevb9upF+TRJSZK9v3A4vswNRi8gAaRcH2/FhgDI7sc/4nqRbW9tHNrWbjW3DvbUi25mBSOFVARY5BkxqDgkgdyrfyI/XHQHjNQFsOKWdj7R0+x/uM80AtXNfaRcWVZ/NfbbBCuw7eLf8uOmeQLKrT7QCrCxW1+ko2bDzy66SzfWsMqUDTnyyzEMoVl/icBe+BjoIV/lLTW5r1w0hI0dWAlUEYTKJInm5J7ABsYDDqTo5/ITXrRtT22hQeEMYvsWDCEhQ6j/QMEAn9elT3W+QQrWZoY51V4mhaV2S8iBQ8YPiSpAJwzZVf1IPUHZfShP7UQjn8t5ef/svDx8VZl+/7l9AFxk+nTRj2WuZNaDjamrrde0VKAwxQE+3YdPczJ4ZkY9xgu3Zfr+nQXiy4nvDeRXNo/jzXgtt/wAly80peLI8/bOAyjPb6D179B2RUkuLDsNV7f4UUoSzJKpDiQ4yO5GEZO37nsB9epGNAFq3kt7+57leMUY9j7VaSYlZDM1cFy4HbsPQYx39OoKrB3szPSNJSCRnZY3lEj4WvFFnzZo8tjxyMsP1z0qbQqFL+us19zbiarcEcteCjU8JWiEnf3JFLZc+OQVGSM9QeBZsWAXisRKskqtGZFtuV/ohW9xfUkOwIAJ7Dt10Tx9QHuLs1R6+7rwtbjvQrVFeD7/OEEFkdmBxJHj1x+vTJSLM0ZroX1aMtK3dpzxm07J+RJG3uLGsEXYN4n6ghWI757fXoLE5lkVY6/uRE3bw86hnYeUMBPkYww8T9rA4U5IH17dAAam349o31MiNtm9qd5Cz/wBMD7PBI8EBu6k/p9egg7/J8Et2JoWlSJcQeOR4JIxhBQernvhhgnsM9+joN8YK6+hRrGtyDkOwjrtEki0WRWP9vhYZwMn75SoznuV9AOgyOSzlaalED2327g3cFk05xpmxFW1EXewarN5iyxiJ8Zfr7Y7eJ/XPRqMrYyzSOtlpztIF5PorybG/KxazXnES1dlGAQuPFQI5lBwGYfTD/r0Fmt6UoNg3ErxyVRrI0noeYtU9iZhLHJ2UI+DgN44J8cjHfJHfpQsS1eeR1rRbNzOI4U/t3syosYbJ80J/j9w9MZz6/t0AT6rjcW329fVRK0Ou1vsb221fxmVjPM0iwTPnxH8M+GO4/QddHgyzRhCHLtlZ2vI9lrPxq8Gr0oDya+RU9+zNJhwkojZj4Adx9QSOmSjxivdAE6nXTVpZPCp+f/8AcWuZ2nCxklSY44w2WQgnBxhTn06g9+UTyWErmUWAbEddlaSVXDxJXB82Zz9oVj6sME5HboGmPkKdq1PPYsGSJhHK59uRFzX7L7n8R3IPZQf1+nUEklnXbO4tKg6ffa/7aOZ2ZBX8h5Ep44ZXz9oz3AGeuhjdGWpUbRVva1tt5vzY2q7iVmRSPaXyJiCj7Gc/YxJz/j36BsxDndKptBchslno3oQkArs/e1HcrvErFggKhlw2cD1OemDJe7dg/9H4Qoy0NkszxwOLEFSvXa75FZX8QIyY/HuGX+ODnIPfHWAPtmDunl+oattTrp1/CB8lqVY2M8ihSSzBhg5/UHAIx9eg1wxaxhWsRwef48NmAyVRX+73ULeTswYdix7EA5yD1J7h2fyW0pmn/FS4VmetX8TFEq5Kgr3ZR4j6Ht0AXHWO0hRi5SZyjJgmBkxgHt38+/rjGPr0ocleeAiskcK+YRyFlcYKqGwTgjBPbtkdugCldN+ha1SxS+FdpQVnkGWErjx7n0+4E4J7A4HU6Hix8z9YsVtTJMs1gVdPdEmwpiUBPFw+ZIVx6jP3hR3AP7dQQq0dVoNhdRp45ZYILLr7bzKBMf2QSD7VPr5H1z2x1IuzkqO0cG4scRpatA0kAaO1Ood4gS33eWTl3/wPQK8asfqtCtVYzRmV5yQ8s1r7nZQMsSPRQPp9Ogu1lgxMwCgzTmLxKyJ+OAHjLHAkQAH7gPX9uoLUk18UUlyzTtN4id45IrXkSnr90kBwCCCBkD09fTPSxV7M4PtSW9fsZdPu6ubtjwapdgTwW0hIz2T0cD+SD0Az6HposuV6pYCRtPPLC5nKsEaP1yQPTv64A+0fp0AssSMyxJHbsgmGq3hFIW8vEM2OyZ+7Jx2PfpYYZ2QjqrFbVy3L1iT3NnEPakVl9xYyxz7KjGMvnv8AQnt9OmTJs3pynZtz2p7F+4SHmPhFA58hHEEKpGvpj2wfXH8s9BpFbQLEfuTvOGiiil+4yhGIIAA+4fTJHc9SJAvb66ns682unC2qcr+3eVGdSCpDq3mn3L4nv656YPNn5mccx1joGtQP5RxqEr13UhpZoz6kjsRn1ycn6dNLFHkfs9Qfw6vFT4fSTaVjSu3qqbVbRVT4SWB7ir9mQqjOBnpUrvZ/2Y10mkiSjb0UU0Vmz51J7rqorSOy+OUfIC9gcMR+3QaQO0qirRu2azxxT2v6dgTuXlj8SRIjZOAAfuOO/fpU9SOfRwR6xIpGEtexgy2W8g0ye5nsV8ifEnIX1GM9NFeVri2lhWhK62okapfnszCKUNGJGPupXIyv2jBUE9x3HfpYXZrwnVmZNk7xPREUsHnHHceSWtI8LN5B4o0yMMPoe2TgEdMASRLSqGw6tIszgu0aPj2JJEGQScggdlHfHfI6ACFatc3HFt9ao2qGvj0Mmqqxjaz+zbtzXXZVEEKBnlMSgySA+KgD6nt1INZKCEG7Cero9WVW4k22kLR1FvP4sQp++zYwAVRR+nr2UfXoM1xp8lMQa6lEJoadWbFpmXYci3GGklMCL5Jkp5difuyvYD9Og0q9qGkXb0tTYJsbrVCXBipzUp18opDISYy7AKVXJ8icHv8AU/RQsep5p+SLUJiu3JdlqkUR17fl5Tx+AHmsmFV2i8hhXx5YxkEd+uxcJbXQQT2ht+HeFdpIFkn1lola0pJ7NWdSyxv5erDsT6gdciyzIr0Da5BcTS7ClYpmtHHa39a3hZErRvg+bSA5MhyAckEE9SWTLNEdOecltX/a47qisdGGKte3iFQFdAQYK65GBgYkKnAwB0yUmN9UVKe0alEWsqBRd2EdVAyslmY+yXAzhv1YZPb6dBYhy3SqwCeW0FipQ5kF+HDsPAFmdkwBkEfaG79LklaWzLs64Ovb8iukoRFKqrSOsYZmZz/EENkj0wD0wGtoq3autppFYDyU4LIL3LuuZSgH2jIQk5XJyAAPTrkWEG7TSCvho/ydbfD2a1/yJZrETYQtGT2/pt4svZR9cHroswtA06aZ45rcskrqZOO153hlVqv/ALzEAQY5OxDYOP19egBG4rdhpcqX8mNyqVNhZidfItJFJeMXhn08SynPln6Y6ab2T5W394azVp66ahTkMIgjMBmq1ELtGZGbGJlTsWHdVIx2HcdVh9Ax1eiUtfVti0YJJ12DeXlUWNPCBmVPMKGIB8mPopHbGOmSzWHbTytYorAjiw8harJ5AKkJ9zLuhbBAP0J9R9OpGCeKTtKHsNNKiiBIpMfcOxBUoozgY/fHQBenhgd/eLy+dcqsJtqTKpOE8GC5BA/Y/wCPShyRPUmnuMCfbTxyDAMl2z3yXHYfoB26AB9ZZrsm9120l8Hd4vbmhA8kmyPalBb0UeIPb65U+vUiGjVGYgbbPITUnd03M/lRsVKKeTxsp75jxgDJDYOO2D0FlybJbmrWKqLY28oStTWL3oGGYcj08mUeUjdvoMZ9B0FJyZpiKaZ9x4LL78WsBMsK9/dbIOPJifsQ59AM/wCHQMrYy9dL1SrHWDR10xGcD23XP3Dswz/6jqS3JJVaUzJHO7zSx/fCCUE4I8cAqOzqP4n1I7HqD0a/QIV6lzYa55tSYztK0KrYo208fyI4wfOOfthGBGFwMj/A9LEq1wPV2FW/DNJ7L0hXU1p45gymJycPG+MYJ+oPqv16ZGN4uxII4Ix5M4RldJQQBn9D5HGO/wDgegZVJJUw0sIb8OWwDfssxLlIz2ZsnJUhsYUev+HQLZKyGl2i63UQavT5heSL3PyEGJIPIY93yP1k7gY7k9/p1BmsYrWAM/tJCYUjX+pmuEkx4r5qMA4zkgjOf8f16k0rJUCCvAWlkijWJS6qQVjCA+vme37nqRIAXdVQt2bG1lXFmvC1GrNG8ihopcEK0X8G8T3LEdumBFkwZ6t3XcoqRRJJeRxJXneHDPEqr7gZVbGAp+5s9senTJ8292rQVz6EqSsdYhjrmvHGBDWrysh8kBwGLd/EOR6n0HfpY+gYxmtCdpYuGzSji9meMRPsLaRI0uYc+KspyPuz9mMfqR0DHJvF6Hzyhd8+f9WMI3kiu5wACe+R+/YdKnudU9nPrtkmwqxK0f31NushP9WBvQhUySyschh/h0HiytWLvIKatE3JNOhsCeFLmzeGYySW40xEh8ME+5H39MZHbqSjWs2hXobWxZgSESGaGFvbCEEhlc9vCQZzkfqfX9x0yXpZcyySiL3VmuBSIHUeJVF7eOH7HtjP79BCwY1mofkUqPdiMegg8KjtI59y5Jn+KRjB8PoWz3Pb079BXZLJ0Cbb7WpZkkoauP8AHp0swe/UBBJ9DCniO5Hjhm/yHfoFcYrWuylRkHhVrrII45cmt7Iy4PckKCf0HQXh66MDBIspiup/TURqfKMev1BB/cHI6W66kcfUtpbpvXbUbaskRmbyr3K5Ygu/YeAXujDORnH/AA6CjaVo3YgXa1liGR2lkl3FaMKJmaPFiBB/HKfxcDA7j/h0DS2TrbpJoqtMybDeWlaWGBXkqyTqQCg7s4Rx2JPY5GO379QK5NntRFaDc2Jr1i89dUsWlCwzy5/pxEYjDKmfJR/qX1Ge3p00Wa2tEJkm24MkKA2SK5EBJCBTksfQEjvg49MdLFizrWC9en4hp6y5ePym8psEeXdQO/qGOMgdBycQPFDBMxiFewWV7xx92Ae6fbn/AIAenUAc2DK/laiVDVGI1gORK7gj7xg4A/bqep6crUCP4yzugVpEBETweTGTIGCfLAP+Xp1B5mf82pw04L1iRxDVQoUl8XdiWkVgw8cnzX08QM9WixUZtaxMBOAbOvLyiWNA0cdxrMUEUxVLAjhZ3bGQVXBGe30I/fAyfP8AAm4T1rYSSwlyQa5kWGSC0qAeBwSSV7EkeufUdKG1WLenFaGhdmmJgEkgjgdAWBZWz9w/5SgHc+nU/EX5IvT3Ib88YklkhUv5Ir9nwzeUftg/Qn6n17dLDPJKU1WrqWEVIe6jzpZ2M0uQ0Hl/Swcg+vqTnOe4GOpLI6SzszZszyutaKLMFlYCQPYLBY8kjJLdjnrnUFSfY63+6au0wMrTTOXiaF/GWCdj4ADuMENj9yD36BnjViWrFNbrLa81exCkt67XZAskkrqsc3kc5JBT7VIxkA/XqRX4xTEosw2Gkkihjpf0zJ7lrPu4ZfuIjySD6YyM5+nQNtMwQlWNZ5ITX1EoryIqmTYtGJJVjlByfMA+P6suc5HoOmTIcWdyarKS0xDRdbEyizLGFavNYCqz4X+ThO2FH8QMev69KmlVGJNjDsGkhkkE7+HmEVB5gv6+flnxzjo6Bq1+5BLrrtYWpdDFGljxFsUZXYRSuPUkgHx/UFe59Olxplr4GU7ZNqL1u9NGJCPKa57ShgwXvN4mXwJIBwR6j9OrEo+VP3QW9qkbgfWH3klSOahKMt7cTL9w9v0Y9yDn69x10SMaUHfRpJfEc6+JLV7K5dojKWPj49vIEeQH165GOhJotdanRtmXMGojXxghyYgUj/iQrH7SR3x9D1Jm85k+1EPenonEty1/TksIsMcEQBFeIHCxqP8AUTnLEf4eg6GCzxuMowHt2dFNGvK3vWa3uRtKjMPBj3dTjsSwAGCOx9MdSMgo3hXsNJPCJnnHt01Vu5kY/wAYygIb7T9gb6/p0AAJoqjtZh2TyI2RYhhkJj9wxjxjjYH/AFliM/XH7d+gnQFivWS9UkkgzWt2BesuhXxktCB4pQpVsgDA9fqfqOoKL20tRycxo1WO2KsdnV3FsRzwtFZgmhIaCNvVPvAJIYev/DpU3hVtQVjWnlif2CkX9teWMg24ZAQ+Acdw/quPp2Pfro9xXeOaecNL/wB4kf8AQkBwvuFMAu2CPvP16YKllopRzTaxQsbCSpbmVrkPl4rXlaQYkGQT9w+1h+nf16BXrW/uV6sr04HozVUtwztMLPighiiLOXXykj7spHr39RgdAL/Isfj1wTJMXruj+S+zI8iyB08CFLAHxUYAIAOT9e/XJIZ1Ep2HI9fqdeYI7W4tU9VTO9mWKvV9wkBpZZCqokfdnOCcDOCcDroa5VmoUqusj113YttdxVelVnswLdqTO1NIoJjH7sEkqhpPe8SykgZUgAZPQZrJ5OtrSiF6G7XvSzbi0iSpVlaPT66WQExSEeSe4AcCRwQxJBCjsOgssbjKIxzKscOs0mx85r1h47EljDBYrEx8xH4sv8VAzgED/wBegsQSm0GpsytrZlVpZMWdXL/SSxHESjyOHXxjlJ/iVPceuR0oMjdeh4/yvX2jCJ6u9qsgi2CY/IiyRlZ+5BjGe4wVP0OOmytZZmhFDZ2d7oZHi3FP3Ek9paGw1wZqsjlvAJEHz7bsx/gw/wA+lCyH+hs04Jxa88MTT7+zNHK8ZCP7t6fIRSMH7IkHcH/Sp+p6bKVq9PSM5qPsoLDGSzG20JnlsbV/LE/uviTJUekmcknBA/y6Cy1bGmv7O0rm5RgDxo5rSwTNmSKKJREzKT3YkgFcE9j+g65FivDcpwyPrdfYC3iS0kEkav8AjsIzKwAP8s/q2e/broYIEpw/jyyX63uW6wexVCSKJ2UD7SwVhjPqoPpjoFuRoKOxre5I9rWTy7DYa5PdsVbjBHjdGGWBBCSZQtkHsM5GOgaUKmmMcF+1NXll1+ljBfd/jyQkRVnIMRxIPcYhwAxUElfUfXoGhG5zL+ObsrxmWoIP6wIJAWW5XiUsinJy75H1x+nTapivdp//0vgXjdGppks7K9ahq37tdIWiV3lhrLECqgFwQXIOXI9SewGOvn5929tLWAy1rX1marHOiWoGMVj3lciRAAxXC9+xOcA/49dGrCFazREFfym/JXyeda83msTYbuML3RsgNjPcdugC/FfpMVCyMVsExB5PIlwV8u5XuP8A6fp0AFalkFvAPER4n3F+8MVz6jGB2I9B69KHIUM0D+btL7UcbD3BJlRhV8gSX9B+n69dDABubIXIZ4KVVb1WZTWmsWGeBVLt6I7H78dj9vp2PUHkyyTbZBrK2qbczQTCrKL0Ffw8/O4s